Processing of Amyloid Precursor Protein (APP) by β- and γ-secretase produces Aβ peptides and APP IntraCellular Domain [##REF##16930452##1##,##REF##12142353##2##], the former being the major component of AD amyloid plaques. Recent evidence indicates that AID is a biologically active intracellular peptide. Initial findings indicated that AID could sensitize cells to apoptotic stimuli [##REF##12214090##3##]. Subsequent studies have suggested a role of AID in calcium release from endoplasmic reticulum stores [##REF##11917117##4##]and in gene transcription [##REF##11441186##5##]. The putative transcriptional role of AID has attracted most of the attention because of the functional parallel with Notch signaling, another γ-secretase substrate. In the case of Notch, γ-processing releases NICD that, in the nucleus, binds transcription factors and activates transcription of specific gene targets [##REF##10221902##6##,##REF##10481190##7##]. For APP, similar models have been suggested, where AID travels to the nucleus bound to Fe65 and Tip60 to activate transcription of target genes [##REF##11441186##5##]; furthermore, Fe65 would also boost AID generation [##REF##17855370##8##]. The evidence that AID, Fe65 and Tip60 can all be found on the KAI1 [##REF##12150997##9##] and Neprilysin (NEP) [##REF##15944124##10##] promoters supports this model. AID gene targets that have been described so far include <italic>KAI1 </italic>[##REF##12150997##9##,##REF##16230462##11##], <italic>GSK3 </italic>β [##REF##16230462##11##,##REF##12923068##12##], <italic>NEP </italic>[##REF##15944124##10##], <italic>EGFR </italic>[##REF##17556541##13##], <italic>LRP </italic>[##REF##17920016##14##] and <italic>APP </italic>itself [##REF##15331662##15##], and genes involved in cell cycle control [##REF##18438935##16##] and in tumorigenesis [##REF##17556541##13##]. A genome-wide approach to AID-mediated gene transcription has shown a possible effect of AID in regulating the expression of proteins related to cytoskeletal organization [##REF##17093061##17##] but failed to confirm previous target genes, as have other studies [##REF##16729020##18##,##REF##18559276##19##]. Given this ambiguity in results, we have reexamined the role of AID in transcription and apoptosis <italic>in vivo </italic>studying AID-transgenic (AIDtg) mice. We have found that AID does not univocally regulate the basal expression of <italic>APP, NEP, KAI1 </italic>and <italic>p53 in vivo </italic>in the mouse brain and that the brain transcriptome of AIDtg and littermate mice are identical. Altogether, these findings suggest that a transcriptional role for AID could be inducible. Nonetheless, toxicity tests performed on forebrain primary cortical neurons from AIDtg mice show that AID has the potential to sensitize neurons to toxic stimuli, possibly via a p53-dependent pathway [##REF##17054906##20##,##REF##17908046##21##].</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>Processing of Amyloid Precursor Protein (APP) by β- and γ-secretase produces Aβ peptides and APP IntraCellular Domain [##REF##16930452##1##,##REF##12142353##2##], the former being the major component of AD amyloid plaques. Recent evidence indicates that AID is a biologically active intracellular peptide. Initial findings indicated that AID could sensitize cells to apoptotic stimuli [##REF##12214090##3##]. Subsequent studies have suggested a role of AID in calcium release from endoplasmic reticulum stores [##REF##11917117##4##]and in gene transcription [##REF##11441186##5##]. The putative transcriptional role of AID has attracted most of the attention because of the functional parallel with Notch signaling, another γ-secretase substrate. In the case of Notch, γ-processing releases NICD that, in the nucleus, binds transcription factors and activates transcription of specific gene targets [##REF##10221902##6##,##REF##10481190##7##]. For APP, similar models have been suggested, where AID travels to the nucleus bound to Fe65 and Tip60 to activate transcription of target genes [##REF##11441186##5##]; furthermore, Fe65 would also boost AID generation [##REF##17855370##8##]. The evidence that AID, Fe65 and Tip60 can all be found on the KAI1 [##REF##12150997##9##] and Neprilysin (NEP) [##REF##15944124##10##] promoters supports this model. AID gene targets that have been described so far include <italic>KAI1 </italic>[##REF##12150997##9##,##REF##16230462##11##], <italic>GSK3 </italic>β [##REF##16230462##11##,##REF##12923068##12##], <italic>NEP </italic>[##REF##15944124##10##], <italic>EGFR </italic>[##REF##17556541##13##], <italic>LRP </italic>[##REF##17920016##14##] and <italic>APP </italic>itself [##REF##15331662##15##], and genes involved in cell cycle control [##REF##18438935##16##] and in tumorigenesis [##REF##17556541##13##]. A genome-wide approach to AID-mediated gene transcription has shown a possible effect of AID in regulating the expression of proteins related to cytoskeletal organization [##REF##17093061##17##] but failed to confirm previous target genes, as have other studies [##REF##16729020##18##,##REF##18559276##19##]. Given this ambiguity in results, we have reexamined the role of AID in transcription and apoptosis <italic>in vivo </italic>studying AID-transgenic (AIDtg) mice. We have found that AID does not univocally regulate the basal expression of <italic>APP, NEP, KAI1 </italic>and <italic>p53 in vivo </italic>in the mouse brain and that the brain transcriptome of AIDtg and littermate mice are identical. Altogether, these findings suggest that a transcriptional role for AID could be inducible. Nonetheless, toxicity tests performed on forebrain primary cortical neurons from AIDtg mice show that AID has the potential to sensitize neurons to toxic stimuli, possibly via a p53-dependent pathway [##REF##17054906##20##,##REF##17908046##21##].</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Materials and methods</title>","<title>Construction of the transgenic plasmid</title>","<p>The cDNA sequence corresponding to human AID 50, 57 or 59 was subcloned into BamHI-XhoI sites of pHY12 vector, which bears SV40 polyA signal. A NotI-NotI fragment, comprising the transgene, was then cloned into the pNN vector, downstream of the 8-kb CaMKIIα promoter. The whole plasmid was then linearized with SalI, run on agarose gel, purified and injected into oocytes of FVB mice that were than implanted in pseudo pregnant C57BL/6 mice.</p>","<title>Mice breeding and handling</title>","<p>Mice were maintained on a FVB background and handled according to the Ethical Guidelines for Treatment of Laboratory Animals of Albert Einstein College of Medicine. The procedures were described and approved in animal protocol number 20040707.</p>","<title>Mice Genotyping</title>","<p>Genomic DNA was extracted and purified from mice tails with DNeasy Tissue Kit (Qiagen), according to the manufacturer's protocol. PCR was conducted using Taq PCR Core Kit (Qiagen) and a Touchdown PCR protocol, starting at 60°C. Primers were constructed on the pNN (fw) and pHY (rev) vectors used for cloning, as follows: fw: 5'-CGAGTGGCCCCTAGTTC-3', rev: 5'-CACTGCATTCTAGTTGTGGTTTG-3'. Internal control primers for β-Actin are as follows: fw: 5'-ACCCACACTGTGCCCATCTA-3'; rev: 5'-CGGAACCGCTACTTGCC-3'. PCR products were run on a 1.5% TBE agarose gel with 0.05% Ethidium Bromide.</p>","<title>Mouse Brain Dissection</title>","<p>Brains were dissected from sacrificed mice using a 3-diopter magnification lens, in ice-cold, RNase, DNase free 1× PBS (Sigma) made in DEPC double distilled water. One hemisphere, for protein extraction, was shock frozen in liquid nitrogen and stored at-80°C, the other hemisphere was processed for RNA extraction as described. Forebrains only were utilized.</p>","<title>Primary Neuronal Cultures</title>","<p>Culture plates were coated with 15 μg/mL Poly-L-Ornithine (Low Molecular Weight, Sigma) for 45 minutes at room temperature. Poly-L-Ornithine was the aspirated and wells were soaked with 4 μg/mL mouse Laminin (Invitrogen), for 12–16 hours in a cell culture incubator at 37°C, 95% humidity and 5% CO2. Eight weeks old FVB female mice were bred with age matched male mice for 3 days. Pregnancy was ascertained according to vaginal plug and weight gain of the females. Females were sacrificed by cervical dislocation, after sedation with isoflurane, at 17.5 days of gestation. Foetuses were processed separately, in order to obtain pure transgenic cultures. Genotyping was carried out as described, by isolating tail DNA. Forebrains were dissected in ice cold HBSS (Invitrogen) + 0.5% w/v D-Glucose (Sigma) and 25 mM Hepes (Invitrogen), under a dissection microscope (Zoom 2000, Leica). Dissociation was carried out in ice cold dissection medium plus 0.01%w/v Papain (Worthington), 0.1%w/v Dispase (Roche) and 0.01% w/v DNase (Worthington), first by means of sterile razor blades, then by serial pipetting with flamed sterile glass Pasteur pipettes, and incubation at 37°C twice for 15 minutes. Cells were then spun down at 220 g for 5' at 4°C, resuspended in Neurobasal Medium with 2% B27, 1 mM Na Pyruvate, 100 units/ml penicillin, 100 μg/ml streptomycin, 2 mM Glutamax (all from Invitrogen), filtered through a 40 μm cell strainer (Fisher), counted and plated on coated 6 well plates at a density of about 750.000 cells/well. Culture medium was completely replaced after 16–20 hours, and new medium (30% of starting volume) was added every 3 days until needed. mRNA harvest was performed at 14 and 9 DIV. Also, at 9 DIV, neurons were treated for 3 hours with 500 μM H2O2 in culture medium devoid of Na-Pyruvate, and for 16 hours with either 700 μM Kainic Acid (Sigma), 7 pg/μL FAS Ligand (Upstate), 1 μM Staurosporine (Sigma), 1 μM Aβ 1–42 (Anaspec) or 500 μM Glutamic Acid (Sigma) in their regular culture medium. Also, since replacement of conditioned culture medium with fresh medium determines neuronal suffering in 8 h, and complete death in 30 h, medium was changed 16 hours previous to cell damage and viability tests. All compounds were resuspended, when necessary, according to the manufacturer's instructions, and brought to the desired concentration in sterile double distilled water. Aβ 1–42 was solubilized in Hexafluoroisopropanol (HFIP, Sigma) to 200 μM to prevent aggregation, and stored at -80°C in aliquots. The amount needed was then thawed, HFIP was evaporated under the cell culture hood, and Aβ resuspended in sterile double distilled water to the desired concentration.</p>","<title>Immunostaining of cultured neurons and transgenic mice brains</title>","<p>Cells, plated on Poly-D-Lysine coated coverslips (24 well plates), were washed in TBS once and fixed with 4% PFA for 30' at room temperature (RT), washed again and permeabilized with 0.2% Triton X-100/TBS for 10' on ice, and cold methanol for 5' on ice. Blocking of aspecific antigenic sites was performed with 10% Goat Serum/0.2% Triton X-100/TBS for 1 hr at RT. Primary antibodies were: anti MAP2 (Sigma, monoclonal clone HM-2, 1/500), anti NeuN (Chemicon, monoclonal clone A60, 1/500), anti GFAP (Abcam 7260, polyclonal 1/500). Secondary antibodies were anti-mouse Alexa Fluor 350 and anti rabbit Alexa Fluor 488, all in 5% Goat Serum/0.1% Triton X-100/TBS for 90' at room temperature. All washes in between and after antibodies incubations were 2 × 10' with TBS pH7.6/0.2% Triton X-100. Coverslips were then mouted on Superfrost Plus(+) glass slides with a glycerol based mount and stored at 4°C, shaded from light. This procedure was optimized in order to obtain maximum reduction of background. Zeiss Axioskop, with fluorescence filters, AxioCam and Axiovision software was used for images acquisition.</p>","<title>Assessment of neuronal toxicity and viability</title>","<p>Cell suffering was assessed by detecting LDH liberated in the culture medium by damaged neurons treated with toxic/pro-apoptotic stimuli (Roche), according to the manufacturer's instructions. Cell viability was assayed by WST1 incorporation in lively cultured neurons after treatment with toxic/pro-apoptotic stimuli (Roche), according to the manufacturer's instructions.</p>","<title>AID peptide detection and western blots</title>","<p>Frozen hemispheres were homogenized through sonication (3 × 30\" cycles, with 5\" pulses) in ice with HU 2–2575 Sonifier (Branson Sonic Power) at #4 power. Buffer is as follows: 2%SDS, 1× Roche Protease Inhibitors Complete Mini-tablets, with EDTA, 5 mM Na3VO4, 50 mM NaF, 1 mM DTT, 1 mM PMSF. Homogenates were spun down at 49000 rpm (100000 g) on a TLA110 rotor (Beckman) at 4°C for 70'. Supernatants, corresponding to 1 mg of total proteins, quantified using BIORAD Smart Spec 3000 and Protein Assay Reagent, were pre-cleared in Protein A Plus (Pierce) for 4 hours at 4°C. Lysates were then incubated with 1 μg of rabbit C-terminal APP antibody (Zymed) over night at 4°C. Finally, Protein A Plus (Pierce) was added again and incubated for 4 hours at 4°C. Beads were washed, resuspended in NuPAGE LDS Sample Buffer/β-MercaptoEthanol, boiled, and 10 μL were loaded on a 4–12% NuPAGE gel. Proteins were then blotted on a 0.2 μm nitrocellulose membrane (Schleicher & Schuell), blocked in 5% milk/PBS and probed with either rabbit anti APP C-terminal antibody (Zymed, 1/500 dilution) or with the rabbit C8 antibody (provided by Dennis Selkoe, 1/500 dilution). Western Blots on <bold>homogenates </bold>from AIDtg and littermate mice were carried out as described previously [##REF##11724784##22##]. Secondary antibody was a goat anti rabbit-HRP (Southern Biotech, 1/3000 dilution). C8 was diluted in Superblock/PBS (Pierce), while secondary antibody was dilute in 5% milk/PBS. Blots were developed with SuperSignal West Pico Chemiluminescent Substrate (Pierce) and SuperSignal West Dura Extended Duration Substrate (Pierce).</p>","<title>RT and Quantitative PCR</title>","<p>Each experiment was done in triplicate. Several primer pairs were tested, prior the experiments, to check for proper amplification and to rule out primer dimerization. Selected primers are as follows:</p>","<p>-hsAID: fw: 5'-GCATCGATTCTAGAATTCG-3'; rev: 5'-CCACCACACCATGATGAAT-3'</p>","<p>-hsAPP: fv: 5'-TCGGAAGTGAAGATGGATGC-3'; rev: 5'-CCTTTGTTCGAACCCACATC-3'</p>","<p>-mmKAI1: fv: 5'-CCTCTTCCTCTTCAACTTGCT-3'; rev: 5'-CGGAAATGAAGCTGTTCTTG-3'</p>","<p>-mmNeprilysin: fw: 5'-GGACATGAAATCACACATGG-3'; rev: 5'-AAATTATTTGCCGACTGCTG-3'</p>","<p>-mmβ-actin: fv: 5'-AAATCGTGCGTGACATCAAA-3; 5'-TCTCCAGGGAGGAAGAGGAT-3'.</p>","<p><bold>Mouse brain mRNA </bold>was extracted with Trizol reagent (Invitrogen), processed and purified with RNeasy Protect Kit (Qiagen) according to the manufacturers' protocols. Two μg of RNA were retro transcribed to cDNA using SuperScript III First-Strand Synthesis System for RT-PCR kit (Invitrogen). Quantitative PCR was carried out using Power Sybr Green PCR Master Mix on a ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems) according to the manufacturer's protocols. Data analysis was conducted according to M. W. Pfaffl [##REF##11328886##23##] and Applied Biosystems references and protocols.</p>","<title>Sample preparation and hybridization for micro array analysis</title>","<p>Each experimental point was performed in triplicate. Mouse Brains were homogenized in TRIZOL reagent (Invitrogen) and extracted following the manufacturer's protocol. A further purification step with the PROTECT kit (Qiagen) was added. cRNA was generated by using the Affymetrix One-Cycle Target Labeling and Control Reagent kit (Affymetrix Inc., Santa Clara, California, USA), following the manufacturer's protocol. The biotinylated cRNA was hybridized to the MOE 430 2.0 Affymetrix DNA chips, containing over 39000 genes and open reading frames from <italic>M. musculus </italic>Genome databases GenBank, dbEST and RefSeq. Chips were washed and scanned on the Affymetrix Complete GeneChip<sup>® </sup>Instrument System, generating digitized image data files.</p>","<title>Micro array data analysis</title>","<p>DAT files were analyzed by MAS 5.0 for detection calls (Affymetrix Inc.) and RMA for expression values. The expression values obtained were analyzed by using GeneSpring GX (AgilentTechnologies). Results were filtered for flag (presence call), then for fold change > 1.5, obtaining a total of 5019 probe sets differentially expressed in the samples versus the controls. Statistical analysis was initially performed using the Two-Way ANOVA using Age and Transgene Expression as parameters to test. As Age was the only parameter to give significant results, we next applied a Welch T-Test on Age using as p-value cutoff 0.001, multiple testing correction Bonferroni, obtaining a set of 380 genes statistically significant. Transgene Expression didn't give any significant result even using a p-value cut-off 0.05.</p>","<title>Statistical analysis</title>","<p>All quantified data represent an average of at least triplicate samples. Error bars represent standard errors of the mean. Statistical significance was determined by Student's t test and a p < 0.05 was considered significant.</p>"],"string":"[\n \"<title>Materials and methods</title>\",\n \"<title>Construction of the transgenic plasmid</title>\",\n \"<p>The cDNA sequence corresponding to human AID 50, 57 or 59 was subcloned into BamHI-XhoI sites of pHY12 vector, which bears SV40 polyA signal. A NotI-NotI fragment, comprising the transgene, was then cloned into the pNN vector, downstream of the 8-kb CaMKIIα promoter. The whole plasmid was then linearized with SalI, run on agarose gel, purified and injected into oocytes of FVB mice that were than implanted in pseudo pregnant C57BL/6 mice.</p>\",\n \"<title>Mice breeding and handling</title>\",\n \"<p>Mice were maintained on a FVB background and handled according to the Ethical Guidelines for Treatment of Laboratory Animals of Albert Einstein College of Medicine. The procedures were described and approved in animal protocol number 20040707.</p>\",\n \"<title>Mice Genotyping</title>\",\n \"<p>Genomic DNA was extracted and purified from mice tails with DNeasy Tissue Kit (Qiagen), according to the manufacturer's protocol. PCR was conducted using Taq PCR Core Kit (Qiagen) and a Touchdown PCR protocol, starting at 60°C. Primers were constructed on the pNN (fw) and pHY (rev) vectors used for cloning, as follows: fw: 5'-CGAGTGGCCCCTAGTTC-3', rev: 5'-CACTGCATTCTAGTTGTGGTTTG-3'. Internal control primers for β-Actin are as follows: fw: 5'-ACCCACACTGTGCCCATCTA-3'; rev: 5'-CGGAACCGCTACTTGCC-3'. PCR products were run on a 1.5% TBE agarose gel with 0.05% Ethidium Bromide.</p>\",\n \"<title>Mouse Brain Dissection</title>\",\n \"<p>Brains were dissected from sacrificed mice using a 3-diopter magnification lens, in ice-cold, RNase, DNase free 1× PBS (Sigma) made in DEPC double distilled water. One hemisphere, for protein extraction, was shock frozen in liquid nitrogen and stored at-80°C, the other hemisphere was processed for RNA extraction as described. Forebrains only were utilized.</p>\",\n \"<title>Primary Neuronal Cultures</title>\",\n \"<p>Culture plates were coated with 15 μg/mL Poly-L-Ornithine (Low Molecular Weight, Sigma) for 45 minutes at room temperature. Poly-L-Ornithine was the aspirated and wells were soaked with 4 μg/mL mouse Laminin (Invitrogen), for 12–16 hours in a cell culture incubator at 37°C, 95% humidity and 5% CO2. Eight weeks old FVB female mice were bred with age matched male mice for 3 days. Pregnancy was ascertained according to vaginal plug and weight gain of the females. Females were sacrificed by cervical dislocation, after sedation with isoflurane, at 17.5 days of gestation. Foetuses were processed separately, in order to obtain pure transgenic cultures. Genotyping was carried out as described, by isolating tail DNA. Forebrains were dissected in ice cold HBSS (Invitrogen) + 0.5% w/v D-Glucose (Sigma) and 25 mM Hepes (Invitrogen), under a dissection microscope (Zoom 2000, Leica). Dissociation was carried out in ice cold dissection medium plus 0.01%w/v Papain (Worthington), 0.1%w/v Dispase (Roche) and 0.01% w/v DNase (Worthington), first by means of sterile razor blades, then by serial pipetting with flamed sterile glass Pasteur pipettes, and incubation at 37°C twice for 15 minutes. Cells were then spun down at 220 g for 5' at 4°C, resuspended in Neurobasal Medium with 2% B27, 1 mM Na Pyruvate, 100 units/ml penicillin, 100 μg/ml streptomycin, 2 mM Glutamax (all from Invitrogen), filtered through a 40 μm cell strainer (Fisher), counted and plated on coated 6 well plates at a density of about 750.000 cells/well. Culture medium was completely replaced after 16–20 hours, and new medium (30% of starting volume) was added every 3 days until needed. mRNA harvest was performed at 14 and 9 DIV. Also, at 9 DIV, neurons were treated for 3 hours with 500 μM H2O2 in culture medium devoid of Na-Pyruvate, and for 16 hours with either 700 μM Kainic Acid (Sigma), 7 pg/μL FAS Ligand (Upstate), 1 μM Staurosporine (Sigma), 1 μM Aβ 1–42 (Anaspec) or 500 μM Glutamic Acid (Sigma) in their regular culture medium. Also, since replacement of conditioned culture medium with fresh medium determines neuronal suffering in 8 h, and complete death in 30 h, medium was changed 16 hours previous to cell damage and viability tests. All compounds were resuspended, when necessary, according to the manufacturer's instructions, and brought to the desired concentration in sterile double distilled water. Aβ 1–42 was solubilized in Hexafluoroisopropanol (HFIP, Sigma) to 200 μM to prevent aggregation, and stored at -80°C in aliquots. The amount needed was then thawed, HFIP was evaporated under the cell culture hood, and Aβ resuspended in sterile double distilled water to the desired concentration.</p>\",\n \"<title>Immunostaining of cultured neurons and transgenic mice brains</title>\",\n \"<p>Cells, plated on Poly-D-Lysine coated coverslips (24 well plates), were washed in TBS once and fixed with 4% PFA for 30' at room temperature (RT), washed again and permeabilized with 0.2% Triton X-100/TBS for 10' on ice, and cold methanol for 5' on ice. Blocking of aspecific antigenic sites was performed with 10% Goat Serum/0.2% Triton X-100/TBS for 1 hr at RT. Primary antibodies were: anti MAP2 (Sigma, monoclonal clone HM-2, 1/500), anti NeuN (Chemicon, monoclonal clone A60, 1/500), anti GFAP (Abcam 7260, polyclonal 1/500). Secondary antibodies were anti-mouse Alexa Fluor 350 and anti rabbit Alexa Fluor 488, all in 5% Goat Serum/0.1% Triton X-100/TBS for 90' at room temperature. All washes in between and after antibodies incubations were 2 × 10' with TBS pH7.6/0.2% Triton X-100. Coverslips were then mouted on Superfrost Plus(+) glass slides with a glycerol based mount and stored at 4°C, shaded from light. This procedure was optimized in order to obtain maximum reduction of background. Zeiss Axioskop, with fluorescence filters, AxioCam and Axiovision software was used for images acquisition.</p>\",\n \"<title>Assessment of neuronal toxicity and viability</title>\",\n \"<p>Cell suffering was assessed by detecting LDH liberated in the culture medium by damaged neurons treated with toxic/pro-apoptotic stimuli (Roche), according to the manufacturer's instructions. Cell viability was assayed by WST1 incorporation in lively cultured neurons after treatment with toxic/pro-apoptotic stimuli (Roche), according to the manufacturer's instructions.</p>\",\n \"<title>AID peptide detection and western blots</title>\",\n \"<p>Frozen hemispheres were homogenized through sonication (3 × 30\\\" cycles, with 5\\\" pulses) in ice with HU 2–2575 Sonifier (Branson Sonic Power) at #4 power. Buffer is as follows: 2%SDS, 1× Roche Protease Inhibitors Complete Mini-tablets, with EDTA, 5 mM Na3VO4, 50 mM NaF, 1 mM DTT, 1 mM PMSF. Homogenates were spun down at 49000 rpm (100000 g) on a TLA110 rotor (Beckman) at 4°C for 70'. Supernatants, corresponding to 1 mg of total proteins, quantified using BIORAD Smart Spec 3000 and Protein Assay Reagent, were pre-cleared in Protein A Plus (Pierce) for 4 hours at 4°C. Lysates were then incubated with 1 μg of rabbit C-terminal APP antibody (Zymed) over night at 4°C. Finally, Protein A Plus (Pierce) was added again and incubated for 4 hours at 4°C. Beads were washed, resuspended in NuPAGE LDS Sample Buffer/β-MercaptoEthanol, boiled, and 10 μL were loaded on a 4–12% NuPAGE gel. Proteins were then blotted on a 0.2 μm nitrocellulose membrane (Schleicher & Schuell), blocked in 5% milk/PBS and probed with either rabbit anti APP C-terminal antibody (Zymed, 1/500 dilution) or with the rabbit C8 antibody (provided by Dennis Selkoe, 1/500 dilution). Western Blots on <bold>homogenates </bold>from AIDtg and littermate mice were carried out as described previously [##REF##11724784##22##]. Secondary antibody was a goat anti rabbit-HRP (Southern Biotech, 1/3000 dilution). C8 was diluted in Superblock/PBS (Pierce), while secondary antibody was dilute in 5% milk/PBS. Blots were developed with SuperSignal West Pico Chemiluminescent Substrate (Pierce) and SuperSignal West Dura Extended Duration Substrate (Pierce).</p>\",\n \"<title>RT and Quantitative PCR</title>\",\n \"<p>Each experiment was done in triplicate. Several primer pairs were tested, prior the experiments, to check for proper amplification and to rule out primer dimerization. Selected primers are as follows:</p>\",\n \"<p>-hsAID: fw: 5'-GCATCGATTCTAGAATTCG-3'; rev: 5'-CCACCACACCATGATGAAT-3'</p>\",\n \"<p>-hsAPP: fv: 5'-TCGGAAGTGAAGATGGATGC-3'; rev: 5'-CCTTTGTTCGAACCCACATC-3'</p>\",\n \"<p>-mmKAI1: fv: 5'-CCTCTTCCTCTTCAACTTGCT-3'; rev: 5'-CGGAAATGAAGCTGTTCTTG-3'</p>\",\n \"<p>-mmNeprilysin: fw: 5'-GGACATGAAATCACACATGG-3'; rev: 5'-AAATTATTTGCCGACTGCTG-3'</p>\",\n \"<p>-mmβ-actin: fv: 5'-AAATCGTGCGTGACATCAAA-3; 5'-TCTCCAGGGAGGAAGAGGAT-3'.</p>\",\n \"<p><bold>Mouse brain mRNA </bold>was extracted with Trizol reagent (Invitrogen), processed and purified with RNeasy Protect Kit (Qiagen) according to the manufacturers' protocols. Two μg of RNA were retro transcribed to cDNA using SuperScript III First-Strand Synthesis System for RT-PCR kit (Invitrogen). Quantitative PCR was carried out using Power Sybr Green PCR Master Mix on a ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems) according to the manufacturer's protocols. Data analysis was conducted according to M. W. Pfaffl [##REF##11328886##23##] and Applied Biosystems references and protocols.</p>\",\n \"<title>Sample preparation and hybridization for micro array analysis</title>\",\n \"<p>Each experimental point was performed in triplicate. Mouse Brains were homogenized in TRIZOL reagent (Invitrogen) and extracted following the manufacturer's protocol. A further purification step with the PROTECT kit (Qiagen) was added. cRNA was generated by using the Affymetrix One-Cycle Target Labeling and Control Reagent kit (Affymetrix Inc., Santa Clara, California, USA), following the manufacturer's protocol. The biotinylated cRNA was hybridized to the MOE 430 2.0 Affymetrix DNA chips, containing over 39000 genes and open reading frames from <italic>M. musculus </italic>Genome databases GenBank, dbEST and RefSeq. Chips were washed and scanned on the Affymetrix Complete GeneChip<sup>® </sup>Instrument System, generating digitized image data files.</p>\",\n \"<title>Micro array data analysis</title>\",\n \"<p>DAT files were analyzed by MAS 5.0 for detection calls (Affymetrix Inc.) and RMA for expression values. The expression values obtained were analyzed by using GeneSpring GX (AgilentTechnologies). Results were filtered for flag (presence call), then for fold change > 1.5, obtaining a total of 5019 probe sets differentially expressed in the samples versus the controls. Statistical analysis was initially performed using the Two-Way ANOVA using Age and Transgene Expression as parameters to test. As Age was the only parameter to give significant results, we next applied a Welch T-Test on Age using as p-value cutoff 0.001, multiple testing correction Bonferroni, obtaining a set of 380 genes statistically significant. Transgene Expression didn't give any significant result even using a p-value cut-off 0.05.</p>\",\n \"<title>Statistical analysis</title>\",\n \"<p>All quantified data represent an average of at least triplicate samples. Error bars represent standard errors of the mean. Statistical significance was determined by Student's t test and a p < 0.05 was considered significant.</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<title>Generation of AID transgenic animals</title>","<p>To directly examine the effects of AID in vivo, and in the brain, we generated transgenic mice expressing AID under the control of the CaMKIIα promoter, targeting its expression to the forebrain regions (which comprise the thalamus, hypothalmus and the upper telencephalon) of the postnatal mouse [##REF##9054501##24##]. These areas are most relevant to Alzheimer's pathology. Endogenous AID is very short lived and therefore virtually undetectable [##REF##11553691##25##]. We generated transgenic lines expressing either the 59- or 57-residue AID peptide, which would be produced by γ-cleavage together with either Aβ40 or Aβ42, respectively. In addition, transgenic lines expressing a \"ε-cleavage\" AID of 50-residue [##REF##11583985##26##,##REF##11483588##27##] were also made. AID cDNAs were cloned downstream of the 8-Kb CaMKIIα promoter and into a plasmid containing a mini-intron and the SV40 polyadenylation sequence [##REF##9054501##24##] (Figure ##FIG##0##1A##). The linearized plasmids were injected into oocytes of FVB mice that were than implanted in pseudo pregnant C57BL/6 mice. Tail-DNA PCR, showed that 9 out of 63 pups obtained had integrated the <italic>AID </italic>transgenes (samples are shown in Figure ##FIG##0##1B##). More specifically, we obtained two AID59 (AID59-4.4 and -1.1), four AID57 (AID57-13.3, -5.1, -5.2 and -8.1) and three AID50 (AID50-3.4, -1.5 and 5.2) founder mice. Germline transmission was observed for all founders. The expression levels of the <italic>AID </italic>transgene mRNA and protein were determined by real-time quantitative PCR and Immunoprecipitation followed by Western blot analysis, respectively. Total RNA and protein lysates were isolated from the forebrain of adult AIDtg animals. Different levels of <italic>AID </italic>mRNA and AID peptide were found in the different transgenic mice (compare Figure ##FIG##0##1C## and ##FIG##0##1D##). Of note, AID50-1.5 and AID50-3.4 lines expressed the highest levels of <italic>AID </italic>mRNA but no detectable AID50 protein. This data suggests that AID50 is the more unstable AID peptide form.</p>","<p>All mice show, up to 24 months of age, a regular growth pattern and mating ability, and we cannot detect any gross deficit or behavioral abnormality among the different AIDtg lines compared to the wild type littermates.</p>","<title>APP, KAI1, NEP and p53 gene expression is not altered in AID transgenic adult animals</title>","<p>To determine whether AID affects <italic>APP, KAI1, NEP </italic>and <italic>p53 </italic>mRNA expression <italic>in vivo </italic>in the brain, RNA from the forebrain of adult (3–8 months) AID57-5.1, AID57-13.3, AID59-4.4, AID59-1.1, AID50-1.5, AID50-3.4, AID50-5.2 and control littermates were analyzed by real-time quantitative PCR. The data presented in Figure ##FIG##1##2## show that there is no obvious correlation between <italic>AID </italic>mRNA and <italic>APP, KAI1, NEP </italic>and p53 levels, considering also age, sex and AID transgene levels of expression. Overall, these data suggest that AID is not involved in the basal expression of putative AID transcriptional targets in the adult mouse forebrain.</p>","<title>AID does not regulate basal gene expression in the mouse brain</title>","<p>A role for AID in transcription cannot be nonetheless excluded from the above evidence. AID might indeed regulate transcription of yet unidentified genes. To address this point we took advantage of our AID tg mice. It is foreseeable that an AID target should be dis-regulated in the forebrain of AID tg mice. RNA from the forebrain of AID59-4.4, AID57-5.1, AID57-13.3 and control littermates was prepared from either 9 days or 18 days old mice. AID50tg mice were not included in this analysis because we could not detect expression of the AID50 peptide. Nine day old animals were selected as further negative controls because the transgenic cassette should be expressed only two weeks after birth. However, we detected expression of <italic>AID </italic>mRNA before day 18, in the 9 days old AIDtg (Figure ##FIG##2##3##). Before using these samples for micro array analysis, the RNAs were tested for <italic>APP, KAI1, NEP </italic>and <italic>p53 </italic>expression. Once more, we saw no clear-cut correlation between expression of AID and that of its putative gene targets (Figure ##FIG##2##3##, AID 57-5.1 and 13.3 shown). Since we did not test <italic>EGFR </italic>and <italic>LRP </italic>mRNA levels, those genes (even their basal transcription) may still be regulated by AID alone, without over-expression of Fe65. Regardless, we analyzed the forebrain transcriptome of these mice using an Affymetrix DNA chips, containing over 39000 genes and open reading frames from <italic>M. musculus </italic>Genome databases GenBank, dbEST and RefSeq. Statistical analysis performed using age and transgene expression as parameters to test, showed that age difference was the only parameter to give significant results, yielding a set of 380 genes that were differentially expressed between 9 and 18 day old mice (data not shown), indicating changes in the transcriptome during post-natal development. Transgene expression didn't give any significant result even using a p-value cut-off 0.05 indicating that the forebrain transcriptome was identical in all age-matched mice analyzed. The above data argue against a role for AID in basal transcriptional regulation.</p>","<title>Transgenic AID expression is detectable in fetal neurons in culture, does not influence the expression of target genes, but increases neuronal sensitivity to toxic and apoptotic stimuli</title>","<p>The finding that TgAID, under the control of our forebrain promoter, is expressed even at postnatal day 9, has led us to think that we could exploit the potentiality of neuronal cultures to assess the role of AID. Neurons from embryonic day 17.5 fetuses, cultured for 9 days, showed detectable TgAID expression (Figure ##FIG##3##4A##). As for postnatal and adult mice though, the presence of AID 57 (data not shown for AID 59) did not seem to influence the relative expression of our target genes (Figure ##FIG##3##4B–E##).</p>","<p>Since AID has been implicated in pathways leading to cell death and apoptosis [##REF##12214090##3##,##REF##12923068##12##,##REF##17121854##28##] we aimed to determine its role under cellular stress conditions. We prepared neuronal cultures from AID59 (and AID57, not shown) mice and littermates. Purity of these cultures was assessed by staining for Microtubule Associated protein 2 (MAP2), Neuronal Nuclei (NeuN) and Glial fibrillary Acidic Protein (GFAP) (Figure ##FIG##4##5A## and ##FIG##4##5B##). MAP2 is the major microtubule associated protein of brain tissue, is known to promote microtubule assembly and to form side-arms on microtubules. It also interacts with neurofilaments, actin, and other elements of the cytoskeleton. It electively stains dendrites. NeuN (or Neuronal Nuclei) reacts with most neuronal cell types throughout the nervous system of mice including cerebellum, cerebral cortex, hippocampus, thalamus. Developmentally, immunoreactivity is first observed shortly after neurons have become postmitotic. The immunohistochemical staining is primarily localized in the nucleus of the neurons. GFAP is a member of the class III intermediate filament protein family. It is heavily, and specifically, expressed in astrocytes and certain other astroglia in the central nervous system. Antibodies to GFAP are therefore very useful as markers of astrocytic cells.</p>","<p>As shown in figure ##FIG##4##5C##, AID59 (analogous results for AID57, not shown) positive neurons have a lower threshold to cell damage induced by toxic or pro-apoptotic stimuli, as indicated by LDH release in culture medium. In particular, H2O2, Kainate and Staurosporine show the biggest differences in LDH release between AID positive and negative cells; the biggest difference in cell viability is seen in Kainate and Staurosporine treatments. When 1 μM Aβ 1–42, 500 μM Glutamate and \"starvation\" were used as noxious stimuli, no difference was detected between transgenic and non-transgenic neurons (data not shown). As expected, there was no difference in these indicators, between AID positive and negative neurons, in non-treated cells (not shown). In figure ##FIG##4##5D##, LDH release was weighed with WST-1 incorporation in the same cells. It is possible that transcription of genes involved in apoptosis, e.g., p53 etc, may be regulated by AID under the stress or pathological conditions.</p>"],"string":"[\n \"<title>Results</title>\",\n \"<title>Generation of AID transgenic animals</title>\",\n \"<p>To directly examine the effects of AID in vivo, and in the brain, we generated transgenic mice expressing AID under the control of the CaMKIIα promoter, targeting its expression to the forebrain regions (which comprise the thalamus, hypothalmus and the upper telencephalon) of the postnatal mouse [##REF##9054501##24##]. These areas are most relevant to Alzheimer's pathology. Endogenous AID is very short lived and therefore virtually undetectable [##REF##11553691##25##]. We generated transgenic lines expressing either the 59- or 57-residue AID peptide, which would be produced by γ-cleavage together with either Aβ40 or Aβ42, respectively. In addition, transgenic lines expressing a \\\"ε-cleavage\\\" AID of 50-residue [##REF##11583985##26##,##REF##11483588##27##] were also made. AID cDNAs were cloned downstream of the 8-Kb CaMKIIα promoter and into a plasmid containing a mini-intron and the SV40 polyadenylation sequence [##REF##9054501##24##] (Figure ##FIG##0##1A##). The linearized plasmids were injected into oocytes of FVB mice that were than implanted in pseudo pregnant C57BL/6 mice. Tail-DNA PCR, showed that 9 out of 63 pups obtained had integrated the <italic>AID </italic>transgenes (samples are shown in Figure ##FIG##0##1B##). More specifically, we obtained two AID59 (AID59-4.4 and -1.1), four AID57 (AID57-13.3, -5.1, -5.2 and -8.1) and three AID50 (AID50-3.4, -1.5 and 5.2) founder mice. Germline transmission was observed for all founders. The expression levels of the <italic>AID </italic>transgene mRNA and protein were determined by real-time quantitative PCR and Immunoprecipitation followed by Western blot analysis, respectively. Total RNA and protein lysates were isolated from the forebrain of adult AIDtg animals. Different levels of <italic>AID </italic>mRNA and AID peptide were found in the different transgenic mice (compare Figure ##FIG##0##1C## and ##FIG##0##1D##). Of note, AID50-1.5 and AID50-3.4 lines expressed the highest levels of <italic>AID </italic>mRNA but no detectable AID50 protein. This data suggests that AID50 is the more unstable AID peptide form.</p>\",\n \"<p>All mice show, up to 24 months of age, a regular growth pattern and mating ability, and we cannot detect any gross deficit or behavioral abnormality among the different AIDtg lines compared to the wild type littermates.</p>\",\n \"<title>APP, KAI1, NEP and p53 gene expression is not altered in AID transgenic adult animals</title>\",\n \"<p>To determine whether AID affects <italic>APP, KAI1, NEP </italic>and <italic>p53 </italic>mRNA expression <italic>in vivo </italic>in the brain, RNA from the forebrain of adult (3–8 months) AID57-5.1, AID57-13.3, AID59-4.4, AID59-1.1, AID50-1.5, AID50-3.4, AID50-5.2 and control littermates were analyzed by real-time quantitative PCR. The data presented in Figure ##FIG##1##2## show that there is no obvious correlation between <italic>AID </italic>mRNA and <italic>APP, KAI1, NEP </italic>and p53 levels, considering also age, sex and AID transgene levels of expression. Overall, these data suggest that AID is not involved in the basal expression of putative AID transcriptional targets in the adult mouse forebrain.</p>\",\n \"<title>AID does not regulate basal gene expression in the mouse brain</title>\",\n \"<p>A role for AID in transcription cannot be nonetheless excluded from the above evidence. AID might indeed regulate transcription of yet unidentified genes. To address this point we took advantage of our AID tg mice. It is foreseeable that an AID target should be dis-regulated in the forebrain of AID tg mice. RNA from the forebrain of AID59-4.4, AID57-5.1, AID57-13.3 and control littermates was prepared from either 9 days or 18 days old mice. AID50tg mice were not included in this analysis because we could not detect expression of the AID50 peptide. Nine day old animals were selected as further negative controls because the transgenic cassette should be expressed only two weeks after birth. However, we detected expression of <italic>AID </italic>mRNA before day 18, in the 9 days old AIDtg (Figure ##FIG##2##3##). Before using these samples for micro array analysis, the RNAs were tested for <italic>APP, KAI1, NEP </italic>and <italic>p53 </italic>expression. Once more, we saw no clear-cut correlation between expression of AID and that of its putative gene targets (Figure ##FIG##2##3##, AID 57-5.1 and 13.3 shown). Since we did not test <italic>EGFR </italic>and <italic>LRP </italic>mRNA levels, those genes (even their basal transcription) may still be regulated by AID alone, without over-expression of Fe65. Regardless, we analyzed the forebrain transcriptome of these mice using an Affymetrix DNA chips, containing over 39000 genes and open reading frames from <italic>M. musculus </italic>Genome databases GenBank, dbEST and RefSeq. Statistical analysis performed using age and transgene expression as parameters to test, showed that age difference was the only parameter to give significant results, yielding a set of 380 genes that were differentially expressed between 9 and 18 day old mice (data not shown), indicating changes in the transcriptome during post-natal development. Transgene expression didn't give any significant result even using a p-value cut-off 0.05 indicating that the forebrain transcriptome was identical in all age-matched mice analyzed. The above data argue against a role for AID in basal transcriptional regulation.</p>\",\n \"<title>Transgenic AID expression is detectable in fetal neurons in culture, does not influence the expression of target genes, but increases neuronal sensitivity to toxic and apoptotic stimuli</title>\",\n \"<p>The finding that TgAID, under the control of our forebrain promoter, is expressed even at postnatal day 9, has led us to think that we could exploit the potentiality of neuronal cultures to assess the role of AID. Neurons from embryonic day 17.5 fetuses, cultured for 9 days, showed detectable TgAID expression (Figure ##FIG##3##4A##). As for postnatal and adult mice though, the presence of AID 57 (data not shown for AID 59) did not seem to influence the relative expression of our target genes (Figure ##FIG##3##4B–E##).</p>\",\n \"<p>Since AID has been implicated in pathways leading to cell death and apoptosis [##REF##12214090##3##,##REF##12923068##12##,##REF##17121854##28##] we aimed to determine its role under cellular stress conditions. We prepared neuronal cultures from AID59 (and AID57, not shown) mice and littermates. Purity of these cultures was assessed by staining for Microtubule Associated protein 2 (MAP2), Neuronal Nuclei (NeuN) and Glial fibrillary Acidic Protein (GFAP) (Figure ##FIG##4##5A## and ##FIG##4##5B##). MAP2 is the major microtubule associated protein of brain tissue, is known to promote microtubule assembly and to form side-arms on microtubules. It also interacts with neurofilaments, actin, and other elements of the cytoskeleton. It electively stains dendrites. NeuN (or Neuronal Nuclei) reacts with most neuronal cell types throughout the nervous system of mice including cerebellum, cerebral cortex, hippocampus, thalamus. Developmentally, immunoreactivity is first observed shortly after neurons have become postmitotic. The immunohistochemical staining is primarily localized in the nucleus of the neurons. GFAP is a member of the class III intermediate filament protein family. It is heavily, and specifically, expressed in astrocytes and certain other astroglia in the central nervous system. Antibodies to GFAP are therefore very useful as markers of astrocytic cells.</p>\",\n \"<p>As shown in figure ##FIG##4##5C##, AID59 (analogous results for AID57, not shown) positive neurons have a lower threshold to cell damage induced by toxic or pro-apoptotic stimuli, as indicated by LDH release in culture medium. In particular, H2O2, Kainate and Staurosporine show the biggest differences in LDH release between AID positive and negative cells; the biggest difference in cell viability is seen in Kainate and Staurosporine treatments. When 1 μM Aβ 1–42, 500 μM Glutamate and \\\"starvation\\\" were used as noxious stimuli, no difference was detected between transgenic and non-transgenic neurons (data not shown). As expected, there was no difference in these indicators, between AID positive and negative neurons, in non-treated cells (not shown). In figure ##FIG##4##5D##, LDH release was weighed with WST-1 incorporation in the same cells. It is possible that transcription of genes involved in apoptosis, e.g., p53 etc, may be regulated by AID under the stress or pathological conditions.</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion and Conclusion</title>","<p>The findings that AID might regulate apoptosis and Ca++ flux were met with some skepticism. On the contrary, hints to a transcriptional role of AID generated great enthusiasm given the parallel with Notch signaling. Several reports have pointed to few possible AID transcriptional targets. The evidence that AID is found on the <italic>KAI1 </italic>promoter, where it is perhaps complexed to Fe65 and the hystone acetyltransferase Tip60 [##REF##12150997##9##], have supported a direct role for AID in transcription. It can also be hypothesized that AID regulates transcription indirectly and that APP functions as a \"hanger\" that restrains Fe65 outside the nucleus: APP processing would activate transcription, as it liberates Fe65 and allows it to translocate to the nucleus. More recent data have suggested that the APP/Fe65 interaction promotes a \"conformational maturation\" of Fe65 that is converted into a transcriptionally active state [##REF##15044485##29##]. However, the reported AID-dependent changes in gene expression has been questioned [##REF##16729020##18##]. Therefore, we have reexamined the role of AID in <italic>in vivo </italic>transcription. Overexpression of AID in the mouse brain did not affect the levels of these three putative AID gene targets. Although these findings question the role of AID in basal transcription of these candidate genes, it is still possible that authentic AID targets genes have not been yet characterized. To address this we have analyzed the effect of AID expression on the mouse brain transcriptoma. The data show that the gene expression pattern of AIDtg and littermate mice is identical, failing to identify any other potential AID gene targets. Thus, AID might have a transcriptional function either in a small subset of forebrain neuronal cells, in cell types different than those analyzed here or under specific signaling or stressful conditions. Genome-wide analysis, conducted on neuronal cells expressing inducible AID, has shown that several genes involved in cytoskeletal dynamics can be regulated by AID. The finding has been confirmed, by SYBR Green real-time PCR, in brains of AD patients for 2-Actin, IGFBP3, and TAGLN [##REF##17093061##17##]. These target genes do not seem to be regulated by AID in our model. This might be due to two reasons. Induction of the AID transgene was allowed for 72 hours in culture before any effect could be detected. Our mice overexpressed AID for several days, as also evident by AID mRNA detection in cultured neurons. It is foreseeable that any effect of AID overexpression, during a longer period of time and in a more complex setting, as is the living mouse brain, would probably result in a different expression arrangement, especially of genes devoted to maintaining the integrity of the cell. Also, sporadic AD brains are a much more complex and entropic system than ours, allowing for complex interactions between different pathogenic entities. Thus, we cannot exclude that a dis-regulation of these target genes may happen later in the life of our mice or under different stress conditions. The role of the intracellular fragment of APP, could possibly be understood by studying its effect under specific stress situations, e.g. under apoptotic or oxidative stimuli, where it could play either a protective or a detrimental role for the cell, depending on other factors such as cell types and interaction with other proteins. This would also explain the predisposition of some brain regions to Alzheimer's pathology. AID has been proposed as a possible mediator of cell death, via a reduction of the cellular threshold to apoptosis [##REF##12214090##3##]. But recent findings have also pointed to a possible protective effect of the APP c-terminal/Fe65 interaction, involving DNA damage response [##REF##17121854##28##]. Our data show that over-expression of AID in cultured neuronal cells predisposes them to a higher degree of suffering, i.e. to a lower resistance to toxic and apoptotic stimuli. In our hands, only selective stimuli could reveal this peculiarity, possibly because of different threshold to cell damage for each experimental compound. Recent works show a role for AID in <italic>p53 </italic>associated cell death [##REF##15944124##10##]. In our model, under toxic stimuli, AID may lower the threshold to cell death through a p53-dependent mechanism by augmenting p53 expression. However, further experiments are required to test this hypothesis.</p>","<p>We believe that the key to understand the role of APP processing in gene regulation lays in the complex interaction of APP domains with other intra- or extra-cellular factors, possibly having a role only in certain stressful situation or at a given \"age\". Further work will explore the nature of this complex network.</p>"],"string":"[\n \"<title>Discussion and Conclusion</title>\",\n \"<p>The findings that AID might regulate apoptosis and Ca++ flux were met with some skepticism. On the contrary, hints to a transcriptional role of AID generated great enthusiasm given the parallel with Notch signaling. Several reports have pointed to few possible AID transcriptional targets. The evidence that AID is found on the <italic>KAI1 </italic>promoter, where it is perhaps complexed to Fe65 and the hystone acetyltransferase Tip60 [##REF##12150997##9##], have supported a direct role for AID in transcription. It can also be hypothesized that AID regulates transcription indirectly and that APP functions as a \\\"hanger\\\" that restrains Fe65 outside the nucleus: APP processing would activate transcription, as it liberates Fe65 and allows it to translocate to the nucleus. More recent data have suggested that the APP/Fe65 interaction promotes a \\\"conformational maturation\\\" of Fe65 that is converted into a transcriptionally active state [##REF##15044485##29##]. However, the reported AID-dependent changes in gene expression has been questioned [##REF##16729020##18##]. Therefore, we have reexamined the role of AID in <italic>in vivo </italic>transcription. Overexpression of AID in the mouse brain did not affect the levels of these three putative AID gene targets. Although these findings question the role of AID in basal transcription of these candidate genes, it is still possible that authentic AID targets genes have not been yet characterized. To address this we have analyzed the effect of AID expression on the mouse brain transcriptoma. The data show that the gene expression pattern of AIDtg and littermate mice is identical, failing to identify any other potential AID gene targets. Thus, AID might have a transcriptional function either in a small subset of forebrain neuronal cells, in cell types different than those analyzed here or under specific signaling or stressful conditions. Genome-wide analysis, conducted on neuronal cells expressing inducible AID, has shown that several genes involved in cytoskeletal dynamics can be regulated by AID. The finding has been confirmed, by SYBR Green real-time PCR, in brains of AD patients for 2-Actin, IGFBP3, and TAGLN [##REF##17093061##17##]. These target genes do not seem to be regulated by AID in our model. This might be due to two reasons. Induction of the AID transgene was allowed for 72 hours in culture before any effect could be detected. Our mice overexpressed AID for several days, as also evident by AID mRNA detection in cultured neurons. It is foreseeable that any effect of AID overexpression, during a longer period of time and in a more complex setting, as is the living mouse brain, would probably result in a different expression arrangement, especially of genes devoted to maintaining the integrity of the cell. Also, sporadic AD brains are a much more complex and entropic system than ours, allowing for complex interactions between different pathogenic entities. Thus, we cannot exclude that a dis-regulation of these target genes may happen later in the life of our mice or under different stress conditions. The role of the intracellular fragment of APP, could possibly be understood by studying its effect under specific stress situations, e.g. under apoptotic or oxidative stimuli, where it could play either a protective or a detrimental role for the cell, depending on other factors such as cell types and interaction with other proteins. This would also explain the predisposition of some brain regions to Alzheimer's pathology. AID has been proposed as a possible mediator of cell death, via a reduction of the cellular threshold to apoptosis [##REF##12214090##3##]. But recent findings have also pointed to a possible protective effect of the APP c-terminal/Fe65 interaction, involving DNA damage response [##REF##17121854##28##]. Our data show that over-expression of AID in cultured neuronal cells predisposes them to a higher degree of suffering, i.e. to a lower resistance to toxic and apoptotic stimuli. In our hands, only selective stimuli could reveal this peculiarity, possibly because of different threshold to cell damage for each experimental compound. Recent works show a role for AID in <italic>p53 </italic>associated cell death [##REF##15944124##10##]. In our model, under toxic stimuli, AID may lower the threshold to cell death through a p53-dependent mechanism by augmenting p53 expression. However, further experiments are required to test this hypothesis.</p>\",\n \"<p>We believe that the key to understand the role of APP processing in gene regulation lays in the complex interaction of APP domains with other intra- or extra-cellular factors, possibly having a role only in certain stressful situation or at a given \\\"age\\\". Further work will explore the nature of this complex network.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Discussion and Conclusion</title>","<p>The findings that AID might regulate apoptosis and Ca++ flux were met with some skepticism. On the contrary, hints to a transcriptional role of AID generated great enthusiasm given the parallel with Notch signaling. Several reports have pointed to few possible AID transcriptional targets. The evidence that AID is found on the <italic>KAI1 </italic>promoter, where it is perhaps complexed to Fe65 and the hystone acetyltransferase Tip60 [##REF##12150997##9##], have supported a direct role for AID in transcription. It can also be hypothesized that AID regulates transcription indirectly and that APP functions as a \"hanger\" that restrains Fe65 outside the nucleus: APP processing would activate transcription, as it liberates Fe65 and allows it to translocate to the nucleus. More recent data have suggested that the APP/Fe65 interaction promotes a \"conformational maturation\" of Fe65 that is converted into a transcriptionally active state [##REF##15044485##29##]. However, the reported AID-dependent changes in gene expression has been questioned [##REF##16729020##18##]. Therefore, we have reexamined the role of AID in <italic>in vivo </italic>transcription. Overexpression of AID in the mouse brain did not affect the levels of these three putative AID gene targets. Although these findings question the role of AID in basal transcription of these candidate genes, it is still possible that authentic AID targets genes have not been yet characterized. To address this we have analyzed the effect of AID expression on the mouse brain transcriptoma. The data show that the gene expression pattern of AIDtg and littermate mice is identical, failing to identify any other potential AID gene targets. Thus, AID might have a transcriptional function either in a small subset of forebrain neuronal cells, in cell types different than those analyzed here or under specific signaling or stressful conditions. Genome-wide analysis, conducted on neuronal cells expressing inducible AID, has shown that several genes involved in cytoskeletal dynamics can be regulated by AID. The finding has been confirmed, by SYBR Green real-time PCR, in brains of AD patients for 2-Actin, IGFBP3, and TAGLN [##REF##17093061##17##]. These target genes do not seem to be regulated by AID in our model. This might be due to two reasons. Induction of the AID transgene was allowed for 72 hours in culture before any effect could be detected. Our mice overexpressed AID for several days, as also evident by AID mRNA detection in cultured neurons. It is foreseeable that any effect of AID overexpression, during a longer period of time and in a more complex setting, as is the living mouse brain, would probably result in a different expression arrangement, especially of genes devoted to maintaining the integrity of the cell. Also, sporadic AD brains are a much more complex and entropic system than ours, allowing for complex interactions between different pathogenic entities. Thus, we cannot exclude that a dis-regulation of these target genes may happen later in the life of our mice or under different stress conditions. The role of the intracellular fragment of APP, could possibly be understood by studying its effect under specific stress situations, e.g. under apoptotic or oxidative stimuli, where it could play either a protective or a detrimental role for the cell, depending on other factors such as cell types and interaction with other proteins. This would also explain the predisposition of some brain regions to Alzheimer's pathology. AID has been proposed as a possible mediator of cell death, via a reduction of the cellular threshold to apoptosis [##REF##12214090##3##]. But recent findings have also pointed to a possible protective effect of the APP c-terminal/Fe65 interaction, involving DNA damage response [##REF##17121854##28##]. Our data show that over-expression of AID in cultured neuronal cells predisposes them to a higher degree of suffering, i.e. to a lower resistance to toxic and apoptotic stimuli. In our hands, only selective stimuli could reveal this peculiarity, possibly because of different threshold to cell damage for each experimental compound. Recent works show a role for AID in <italic>p53 </italic>associated cell death [##REF##15944124##10##]. In our model, under toxic stimuli, AID may lower the threshold to cell death through a p53-dependent mechanism by augmenting p53 expression. However, further experiments are required to test this hypothesis.</p>","<p>We believe that the key to understand the role of APP processing in gene regulation lays in the complex interaction of APP domains with other intra- or extra-cellular factors, possibly having a role only in certain stressful situation or at a given \"age\". Further work will explore the nature of this complex network.</p>"],"string":"[\n \"<title>Discussion and Conclusion</title>\",\n \"<p>The findings that AID might regulate apoptosis and Ca++ flux were met with some skepticism. On the contrary, hints to a transcriptional role of AID generated great enthusiasm given the parallel with Notch signaling. Several reports have pointed to few possible AID transcriptional targets. The evidence that AID is found on the <italic>KAI1 </italic>promoter, where it is perhaps complexed to Fe65 and the hystone acetyltransferase Tip60 [##REF##12150997##9##], have supported a direct role for AID in transcription. It can also be hypothesized that AID regulates transcription indirectly and that APP functions as a \\\"hanger\\\" that restrains Fe65 outside the nucleus: APP processing would activate transcription, as it liberates Fe65 and allows it to translocate to the nucleus. More recent data have suggested that the APP/Fe65 interaction promotes a \\\"conformational maturation\\\" of Fe65 that is converted into a transcriptionally active state [##REF##15044485##29##]. However, the reported AID-dependent changes in gene expression has been questioned [##REF##16729020##18##]. Therefore, we have reexamined the role of AID in <italic>in vivo </italic>transcription. Overexpression of AID in the mouse brain did not affect the levels of these three putative AID gene targets. Although these findings question the role of AID in basal transcription of these candidate genes, it is still possible that authentic AID targets genes have not been yet characterized. To address this we have analyzed the effect of AID expression on the mouse brain transcriptoma. The data show that the gene expression pattern of AIDtg and littermate mice is identical, failing to identify any other potential AID gene targets. Thus, AID might have a transcriptional function either in a small subset of forebrain neuronal cells, in cell types different than those analyzed here or under specific signaling or stressful conditions. Genome-wide analysis, conducted on neuronal cells expressing inducible AID, has shown that several genes involved in cytoskeletal dynamics can be regulated by AID. The finding has been confirmed, by SYBR Green real-time PCR, in brains of AD patients for 2-Actin, IGFBP3, and TAGLN [##REF##17093061##17##]. These target genes do not seem to be regulated by AID in our model. This might be due to two reasons. Induction of the AID transgene was allowed for 72 hours in culture before any effect could be detected. Our mice overexpressed AID for several days, as also evident by AID mRNA detection in cultured neurons. It is foreseeable that any effect of AID overexpression, during a longer period of time and in a more complex setting, as is the living mouse brain, would probably result in a different expression arrangement, especially of genes devoted to maintaining the integrity of the cell. Also, sporadic AD brains are a much more complex and entropic system than ours, allowing for complex interactions between different pathogenic entities. Thus, we cannot exclude that a dis-regulation of these target genes may happen later in the life of our mice or under different stress conditions. The role of the intracellular fragment of APP, could possibly be understood by studying its effect under specific stress situations, e.g. under apoptotic or oxidative stimuli, where it could play either a protective or a detrimental role for the cell, depending on other factors such as cell types and interaction with other proteins. This would also explain the predisposition of some brain regions to Alzheimer's pathology. AID has been proposed as a possible mediator of cell death, via a reduction of the cellular threshold to apoptosis [##REF##12214090##3##]. But recent findings have also pointed to a possible protective effect of the APP c-terminal/Fe65 interaction, involving DNA damage response [##REF##17121854##28##]. Our data show that over-expression of AID in cultured neuronal cells predisposes them to a higher degree of suffering, i.e. to a lower resistance to toxic and apoptotic stimuli. In our hands, only selective stimuli could reveal this peculiarity, possibly because of different threshold to cell damage for each experimental compound. Recent works show a role for AID in <italic>p53 </italic>associated cell death [##REF##15944124##10##]. In our model, under toxic stimuli, AID may lower the threshold to cell death through a p53-dependent mechanism by augmenting p53 expression. However, further experiments are required to test this hypothesis.</p>\",\n \"<p>We believe that the key to understand the role of APP processing in gene regulation lays in the complex interaction of APP domains with other intra- or extra-cellular factors, possibly having a role only in certain stressful situation or at a given \\\"age\\\". Further work will explore the nature of this complex network.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>Regulated intramembrane proteolysis of the β-amyloid precursor protein by the γ-secretase yields two peptides. One, amyloid-β, is the major component of the amyloid plaques found in Alzheimer's disease patients. The other, APP IntraCellular Domain, has been involved in regulation of apoptosis, calcium flux and gene transcription. To date, a few potential target genes transcriptionally controlled by AID, alone or complexed with Fe65/Tip60, have been described. Although the reports are controversial: these include <italic>KAI1</italic>, <italic>Neprilysin</italic>, <italic>p53, EGFR, LRP </italic>and <italic>APP </italic>itself. Furthermore, <italic>p53 </italic>has been implicated in AID mediated susceptibility to apoptosis. To extend these findings, and assess their <italic>in vivo </italic>relevance, we have analyzed the expression of the putative target genes and of the total brain basal transriptoma in transgenic mice expressing AID in the forebrain. Also, we have studied the susceptibility of primary neurons from such mice to stress and pro-apoptotic agents.</p>","<title>Results</title>","<p>We found that AID-target genes and the mouse brain basal transcriptoma <bold>are </bold>not influenced by transgenic expression of AID alone, in the absence of Fe65 over-expression. Also, experiments conducted on primary neurons from AID transgenic mice, suggest a role for AID in sensitizing these cells to toxic stimuli. Overall, these findings hint that a role for AID, in regulating gene transcription, could be induced by yet undefined, and possibly stressful, stimuli <italic>in vivo</italic>.</p>","<title>Conclusion</title>","<p>Overall, these data suggest that the release of the APP intracellular domain may modulate the sensitivity of neuronal cells to toxic stimuli, and that a transcriptional role of AID could be inscribed in signaling pathways thatare not activated in basal conditions.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>Regulated intramembrane proteolysis of the β-amyloid precursor protein by the γ-secretase yields two peptides. One, amyloid-β, is the major component of the amyloid plaques found in Alzheimer's disease patients. The other, APP IntraCellular Domain, has been involved in regulation of apoptosis, calcium flux and gene transcription. To date, a few potential target genes transcriptionally controlled by AID, alone or complexed with Fe65/Tip60, have been described. Although the reports are controversial: these include <italic>KAI1</italic>, <italic>Neprilysin</italic>, <italic>p53, EGFR, LRP </italic>and <italic>APP </italic>itself. Furthermore, <italic>p53 </italic>has been implicated in AID mediated susceptibility to apoptosis. To extend these findings, and assess their <italic>in vivo </italic>relevance, we have analyzed the expression of the putative target genes and of the total brain basal transriptoma in transgenic mice expressing AID in the forebrain. Also, we have studied the susceptibility of primary neurons from such mice to stress and pro-apoptotic agents.</p>\",\n \"<title>Results</title>\",\n \"<p>We found that AID-target genes and the mouse brain basal transcriptoma <bold>are </bold>not influenced by transgenic expression of AID alone, in the absence of Fe65 over-expression. Also, experiments conducted on primary neurons from AID transgenic mice, suggest a role for AID in sensitizing these cells to toxic stimuli. Overall, these findings hint that a role for AID, in regulating gene transcription, could be induced by yet undefined, and possibly stressful, stimuli <italic>in vivo</italic>.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>Overall, these data suggest that the release of the APP intracellular domain may modulate the sensitivity of neuronal cells to toxic stimuli, and that a transcriptional role of AID could be inscribed in signaling pathways thatare not activated in basal conditions.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>LG participated in the design of the study, handled the mice colony and genotyping, designed the experiments, performed most of the experiments and cultures, participated in the final analysis and draft preparation. DZ participated in the mice colony handling and genotyping, and characterization of tg mice. RW participated in the mice colony handling and genotyping. ET participated in the design of the study. PDL performed all the micro-array experiments and analysis. MT participated in the design of the study. LD conceived and designed the study, designed the tg mice, participated in the design of the experiments, participated in the handling of the mice colonies and genotyping, and in the analysis of the data, prepared the draft.</p>"],"string":"[\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>LG participated in the design of the study, handled the mice colony and genotyping, designed the experiments, performed most of the experiments and cultures, participated in the final analysis and draft preparation. DZ participated in the mice colony handling and genotyping, and characterization of tg mice. RW participated in the mice colony handling and genotyping. ET participated in the design of the study. PDL performed all the micro-array experiments and analysis. MT participated in the design of the study. LD conceived and designed the study, designed the tg mice, participated in the design of the experiments, participated in the handling of the mice colonies and genotyping, and in the analysis of the data, prepared the draft.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>This work was supported in part by Alzheimer Disease Research Grant A2003-076; National Institutes of Health Grants RO1 AG22024 and RO1 AG21588, the CARISA Foundation, the MIUR and the Regione Piemonte.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>This work was supported in part by Alzheimer Disease Research Grant A2003-076; National Institutes of Health Grants RO1 AG22024 and RO1 AG21588, the CARISA Foundation, the MIUR and the Regione Piemonte.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Characterization of AID transgenic mice</bold>. <bold>A </bold>Schematic representation of the transgenic AID constructs (fragments are not depicted in scale). The location of the PCR primers a and b used for genotyping is shown. <bold>B </bold>PCR of 63 pups (18 are shown here) revealed that 9 of them (three are shown here, number 1, 4 and 15) had integrated the AID transgene. In the same PCR tube, β-actin was amplified to control for genomic DNA content. Vec. represents the control PCR performed using the transgenic vector as a template. <bold>C </bold>Real Time PCR showing the expression levels of the <italic>AID </italic>transgene in different lines. <bold>D </bold>Immunoprecipitation and western blot was conducted from a brain hemisphere of AIDtg and littermate (Con) mice. Mice lines that expressed the AID protein at the mRNA level, and had a detectable band at the western blot analysis were selected for further studies.</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>In vivo expression of candidate AID targets is not affected by transgenic AID expression, in adult mice</bold>. Real Time Quantitative PCR shows the relative expression of <italic>AIDtg </italic>protein, <bold>A</bold>, <italic>APP</italic>, <bold>B</bold>, <italic>NEP</italic>, <bold>C</bold>, <italic>KAI1</italic>, <bold><italic>D</italic></bold>, <italic>and p53</italic>, <bold><italic>E </italic></bold>in the forebrain and hippocampus of AIDtg and their littermate control mice. Values are relative to 100% value given arbitrarily to a littermate mouse. Experiments were conducted in triplicate loading, and the error bars represent standard deviations.</p></caption></fig>","<fig position=\"float\" id=\"F3\"><label>Figure 3</label><caption><p><bold>AID is already expressed at postnatal day nine, but does not influence the expression of the candidate genes</bold>. Real Time Quantitative PCR shows the relative expression of <italic>AIDtg </italic>protein <bold>A</bold>, <italic>APP</italic>, <bold>B</bold>, <italic>NEP</italic>, <bold>C</bold>, <italic>KAI1</italic>, <bold><italic>D</italic></bold>, <italic>and p53</italic>, <bold><italic>E </italic></bold>in the forebrain and hippocampus of AIDtg and their littermate control mice as early as 9 and 18 days post-natal. For <italic>APP, NEP</italic>, <italic>KAI1 </italic>and <italic>p53 </italic>expression, values are relative to 100% value given arbitrarily their day 9 and day 18 littermates. For <italic>AIDtg </italic>protein, 100% value was assigned to the first day 9 littermate mouse. Experiments were conducted in triplicate loading, and the error bars represent standard deviations.</p></caption></fig>","<fig position=\"float\" id=\"F4\"><label>Figure 4</label><caption><p><bold>AIDtg expression in cultured fetal primary neurons does not change the relative expression of <italic>APP, NEP, KAI1 and p53</italic></bold>. <bold>A </bold><italic>AIDtg </italic>expression was confirmed by tail genotyping of fetuses (not shown) and by QPCR data on cultured neurons (dark bars). Expression of <italic>AID</italic>, <bold>A</bold>, <italic>APP</italic>, <bold>B</bold>, <italic>NE</italic>P, <bold>C</bold>, <italic>KAI1</italic>, <bold>D</bold>, and <italic>p53</italic>, <bold>E</bold>, is relative to the 100% value given arbitrarily to the first <italic>AIDtg </italic>mouse. Experiments were conducted in triplicate loading, and the error bars represent standard deviations. Cultures were harvested at DIV 14. Similar results were achieved from younger cultures (DIV 9, not shown) and in the <italic>AIDTg 59 </italic>line (not shown).</p></caption></fig>","<fig position=\"float\" id=\"F5\"><label>Figure 5</label><caption><p><bold><italic>AIDtg </italic>expression in cultured fetal primary neurons increases their sensitivity to toxic and apoptotic stimuli</bold>. <italic>AIDTg </italic>line 59.4.4, at DIV 9. To verify the purity of the neuronal cultures, cells were stained with anti-NeuN (Blue) plus anti-GFAP (red), <bold>A</bold>, and NeuN (Blue) plus anti-MAP2 (red), <bold>B</bold>. <bold>C </bold>Toxicity of indicated stimulus was assessed by measuring LDH release. <bold>D </bold>Released LDH was weighed against WST-1 uptake in the LDH/WST-1 ratio, which confirms the trend of LDH release. <bold>C </bold>and <bold>D </bold>Values from toxic stimuli were weighed against values from untreated cells to express the increase of the indicators of cell damage. Average values refer to at least 3 AIDtg and 3 littermate mice; measurements were done on 6 separate wells of 96 well culture plate for each foetus' neurons. Similar results were obtained for <italic>AIDTg </italic>57 line (not shown).</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p><bold>Characterization of AID transgenic mice</bold>. <bold>A </bold>Schematic representation of the transgenic AID constructs (fragments are not depicted in scale). The location of the PCR primers a and b used for genotyping is shown. <bold>B </bold>PCR of 63 pups (18 are shown here) revealed that 9 of them (three are shown here, number 1, 4 and 15) had integrated the AID transgene. In the same PCR tube, β-actin was amplified to control for genomic DNA content. Vec. represents the control PCR performed using the transgenic vector as a template. <bold>C </bold>Real Time PCR showing the expression levels of the <italic>AID </italic>transgene in different lines. <bold>D </bold>Immunoprecipitation and western blot was conducted from a brain hemisphere of AIDtg and littermate (Con) mice. Mice lines that expressed the AID protein at the mRNA level, and had a detectable band at the western blot analysis were selected for further studies.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p><bold>In vivo expression of candidate AID targets is not affected by transgenic AID expression, in adult mice</bold>. Real Time Quantitative PCR shows the relative expression of <italic>AIDtg </italic>protein, <bold>A</bold>, <italic>APP</italic>, <bold>B</bold>, <italic>NEP</italic>, <bold>C</bold>, <italic>KAI1</italic>, <bold><italic>D</italic></bold>, <italic>and p53</italic>, <bold><italic>E </italic></bold>in the forebrain and hippocampus of AIDtg and their littermate control mice. Values are relative to 100% value given arbitrarily to a littermate mouse. Experiments were conducted in triplicate loading, and the error bars represent standard deviations.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F3\\\"><label>Figure 3</label><caption><p><bold>AID is already expressed at postnatal day nine, but does not influence the expression of the candidate genes</bold>. Real Time Quantitative PCR shows the relative expression of <italic>AIDtg </italic>protein <bold>A</bold>, <italic>APP</italic>, <bold>B</bold>, <italic>NEP</italic>, <bold>C</bold>, <italic>KAI1</italic>, <bold><italic>D</italic></bold>, <italic>and p53</italic>, <bold><italic>E </italic></bold>in the forebrain and hippocampus of AIDtg and their littermate control mice as early as 9 and 18 days post-natal. For <italic>APP, NEP</italic>, <italic>KAI1 </italic>and <italic>p53 </italic>expression, values are relative to 100% value given arbitrarily their day 9 and day 18 littermates. For <italic>AIDtg </italic>protein, 100% value was assigned to the first day 9 littermate mouse. Experiments were conducted in triplicate loading, and the error bars represent standard deviations.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F4\\\"><label>Figure 4</label><caption><p><bold>AIDtg expression in cultured fetal primary neurons does not change the relative expression of <italic>APP, NEP, KAI1 and p53</italic></bold>. <bold>A </bold><italic>AIDtg </italic>expression was confirmed by tail genotyping of fetuses (not shown) and by QPCR data on cultured neurons (dark bars). Expression of <italic>AID</italic>, <bold>A</bold>, <italic>APP</italic>, <bold>B</bold>, <italic>NE</italic>P, <bold>C</bold>, <italic>KAI1</italic>, <bold>D</bold>, and <italic>p53</italic>, <bold>E</bold>, is relative to the 100% value given arbitrarily to the first <italic>AIDtg </italic>mouse. Experiments were conducted in triplicate loading, and the error bars represent standard deviations. Cultures were harvested at DIV 14. Similar results were achieved from younger cultures (DIV 9, not shown) and in the <italic>AIDTg 59 </italic>line (not shown).</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F5\\\"><label>Figure 5</label><caption><p><bold><italic>AIDtg </italic>expression in cultured fetal primary neurons increases their sensitivity to toxic and apoptotic stimuli</bold>. <italic>AIDTg </italic>line 59.4.4, at DIV 9. To verify the purity of the neuronal cultures, cells were stained with anti-NeuN (Blue) plus anti-GFAP (red), <bold>A</bold>, and NeuN (Blue) plus anti-MAP2 (red), <bold>B</bold>. <bold>C </bold>Toxicity of indicated stimulus was assessed by measuring LDH release. <bold>D </bold>Released LDH was weighed against WST-1 uptake in the LDH/WST-1 ratio, which confirms the trend of LDH release. <bold>C </bold>and <bold>D </bold>Values from toxic stimuli were weighed against values from untreated cells to express the increase of the indicators of cell damage. Average values refer to at least 3 AIDtg and 3 littermate mice; measurements were done on 6 separate wells of 96 well culture plate for each foetus' neurons. Similar results were obtained for <italic>AIDTg </italic>57 line (not shown).</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":[],"string":"[]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1750-1326-3-12-1\"/>","<graphic xlink:href=\"1750-1326-3-12-2\"/>","<graphic xlink:href=\"1750-1326-3-12-3\"/>","<graphic xlink:href=\"1750-1326-3-12-4\"/>","<graphic xlink:href=\"1750-1326-3-12-5\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1750-1326-3-12-1\\\"/>\",\n \"<graphic xlink:href=\\\"1750-1326-3-12-2\\\"/>\",\n \"<graphic xlink:href=\\\"1750-1326-3-12-3\\\"/>\",\n \"<graphic xlink:href=\\\"1750-1326-3-12-4\\\"/>\",\n \"<graphic xlink:href=\\\"1750-1326-3-12-5\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":29,"string":"29"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:37"},"citation":{"kind":"string","value":"Mol Neurodegener. 2008 Sep 2; 3:12"},"package_file":{"kind":"string","value":"oa_package/93/1b/PMC2538519.tar.gz"}}},{"rowIdx":119684,"cells":{"accession_id":{"kind":"string","value":"PMC2538520"},"pmid":{"kind":"string","value":"18761749"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>The Chronic Care Model is a conceptual framework that supports the evidence-based proactive and planned care for chronic diseases [##UREF##0##1##,##REF##12132606##2##]. It has received widespread acceptance as a framework for improving the care of chronically ill patients. Measures of chronic care delivery are required to target efforts to improve chronic care and to monitor change of chronic care delivery over time. The Patient Assessment of Chronic Illness Care (PACIC) is a 20-item questionnaire for patients, which intends to measure chronic care delivery and which has been validated in USA for diabetes [##REF##16249535##3##] and in Germany for osteoarthritis [##REF##17824876##4##]. A version for chronic care in general practice in The Netherlands was not yet available, although many chronic patients receive most of their health care in general practice. Therefore the aim of our study was to develop a Dutch version of the PACIC instrument and test it on patients with diabetes or COPD in general practice.</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>The Chronic Care Model is a conceptual framework that supports the evidence-based proactive and planned care for chronic diseases [##UREF##0##1##,##REF##12132606##2##]. It has received widespread acceptance as a framework for improving the care of chronically ill patients. Measures of chronic care delivery are required to target efforts to improve chronic care and to monitor change of chronic care delivery over time. The Patient Assessment of Chronic Illness Care (PACIC) is a 20-item questionnaire for patients, which intends to measure chronic care delivery and which has been validated in USA for diabetes [##REF##16249535##3##] and in Germany for osteoarthritis [##REF##17824876##4##]. A version for chronic care in general practice in The Netherlands was not yet available, although many chronic patients receive most of their health care in general practice. Therefore the aim of our study was to develop a Dutch version of the PACIC instrument and test it on patients with diabetes or COPD in general practice.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<title>Design and setting</title>","<p>An observational study was performed in randomly sampled patients from four general practices, which were situated in a rural area in the south-eastern part of The Netherlands. Two practices were single-handed and two practices were group practices. All practices were involved in a program to enhance structured diabetes care, while no such program existed for COPD care. Ethical approval was received for this study from the Arnhem-Nijmegen ethical committee.</p>","<title>Study population</title>","<p>In each practice patients with diabetes mellitus and with COPD were sampled from the medical record system. An alphabetically ordered list of patient names was made, from which every second patients was included up to 30, except for one practice, which could provide only 20 COPD patients. A total of 230 patients was approached (120 diabetes patients and 110 COPD patients). Written questionnaires were sent by the practices, followed by postcard reminders three weeks later. Patients were invited to complete the questionnaire and return it anonymously in a prepaid envelope to the research institute. Informed consent was not explicitly asked, but implied when a patient returned the questionnaire.</p>","<title>Measures</title>","<p>The questionnaire included the following measures. Patient assessment of chronic illness care (PACIC) was measured with a 20 item questionnaire, which used a five point response scale (ranging from 1 = 'almost never' to 5 = 'almost always') [##REF##16249535##3##]. Higher scores mean more frequent presence of the aspect of structured chronic care. This instrument has five pre-defined domains: patient activation (3 items), delivery system/practice design (3 items), goal setting/tailoring (5 items), problem solving/contextual (4 items), follow-up/coordination (5 items). The English version was translated and culturally adapted in a structured procedure, including forward and backward translations, each by two independent researchers and then established in a consensus meeting with the four individuals involved. Next, face to face interviews were done with 15 elderly patients with chronic illness from one general practice. This led to substantial adaptations, mainly to simplify and clarify the questions, which were also discussed with the authors of the PACIC. Finally, we made two slightly different versions, one for patients with diabetes and one for patients with COPD (see Additional file ##SUPPL##0##1##). These versions different in two ways: the heading referred to diabetes or lung disease, and item 19 referred to lung physicians (for COPD patients) or internist, surgeon or ophmatologist (for diabetes patients). Aggregated mean scores for five domains and for the total instrument were calculated as described in previous research [##REF##16249535##3##]. No scores per domain were determined for patients with missing values on on more than one third of the items in the domain.</p>","<p>Patient enablement (PEI) was measured with a six-item questionnaire (with three response categories: 0 = 'same or worse', 1 = 'better', 2 = 'much better') [##REF##9613486##5##]. The range of the aggregated sum score was 0 to 12, with a higher score indicating a higher level of enablement. Respondents giving two or more missing values were excluded. Patient evaluations of general practice were measured with the Europep instrument, a 23-item internationally standardised and validated questionnaire (with a five point answering scale, ranging from 'poor' to 'excellent') [##REF##11141874##6##]. For this study, we determined the overall mean value on the 17 dichotomized (excellent versus other values) items focused on clinical performance (Cronbach's alpha = 0.97). Respondents with more than 5 missing items were excluded. Finally the questionnaire contained questions on patient age, gender, highest education, and overall health status (single item with five point response scale, 'excellent to 'poor).</p>","<title>Data-analysis</title>","<p>The analysis of the measurement properties of the PACIC was based on published quality criteria for questionnaires [##REF##17161752##7##]. The content validity of the PACIC is based on the Chronic Care Model [##UREF##0##1##,##REF##12132606##2##]. The interpretability of the instrument (the extent that qualitative meaning can be assigned to the qualitative scores) was based on the percentage of chronic patients who provided valid responses on each of the items. In addition, we checked for floor and ceiling effects in terms of percentage of patients using the most extreme (upper or lower) response categories.</p>","<p>Principal factor analysis (PCA, factors with eigenvalue > 1, varimax rotation) was applied to examine the number and type of domains in the instrument [##UREF##1##8##]. We determined the Kaiser-Meyer-Olkin Measure of sampling adequacy and the Bartlett's test of sphericity. Internal consistency (the extent to which items measure the same concept) was expressed in terms of Cronbach's alpha for each of five domains in PACIC and for the total PACIC instrument. Reliability was expressed as an intra class coefficient (ICC, absolute agreement), which was based on variation between patients divided by total variation (taking patients random and items fixed). Values > 0.70 for alpha and ICC were considered acceptable [##REF##17161752##7##].</p>","<p>The analysis of construct validity was based on the following hypotheses. We expected that higher PACIC scores, reflecting patient perceived presence of structured chronic care, would be positively related to both patients' perceived enablement after the latest visit to the GP and to patients' overall evaluations of general practice. To verify this expectation, we used linear regression analysis [##UREF##2##9##] with PACIC scores as dependent factor, enablement or evaluation as independent factor, and patient age and gender also included in the model. All data-analysis was done with SPSS 14.</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<title>Design and setting</title>\",\n \"<p>An observational study was performed in randomly sampled patients from four general practices, which were situated in a rural area in the south-eastern part of The Netherlands. Two practices were single-handed and two practices were group practices. All practices were involved in a program to enhance structured diabetes care, while no such program existed for COPD care. Ethical approval was received for this study from the Arnhem-Nijmegen ethical committee.</p>\",\n \"<title>Study population</title>\",\n \"<p>In each practice patients with diabetes mellitus and with COPD were sampled from the medical record system. An alphabetically ordered list of patient names was made, from which every second patients was included up to 30, except for one practice, which could provide only 20 COPD patients. A total of 230 patients was approached (120 diabetes patients and 110 COPD patients). Written questionnaires were sent by the practices, followed by postcard reminders three weeks later. Patients were invited to complete the questionnaire and return it anonymously in a prepaid envelope to the research institute. Informed consent was not explicitly asked, but implied when a patient returned the questionnaire.</p>\",\n \"<title>Measures</title>\",\n \"<p>The questionnaire included the following measures. Patient assessment of chronic illness care (PACIC) was measured with a 20 item questionnaire, which used a five point response scale (ranging from 1 = 'almost never' to 5 = 'almost always') [##REF##16249535##3##]. Higher scores mean more frequent presence of the aspect of structured chronic care. This instrument has five pre-defined domains: patient activation (3 items), delivery system/practice design (3 items), goal setting/tailoring (5 items), problem solving/contextual (4 items), follow-up/coordination (5 items). The English version was translated and culturally adapted in a structured procedure, including forward and backward translations, each by two independent researchers and then established in a consensus meeting with the four individuals involved. Next, face to face interviews were done with 15 elderly patients with chronic illness from one general practice. This led to substantial adaptations, mainly to simplify and clarify the questions, which were also discussed with the authors of the PACIC. Finally, we made two slightly different versions, one for patients with diabetes and one for patients with COPD (see Additional file ##SUPPL##0##1##). These versions different in two ways: the heading referred to diabetes or lung disease, and item 19 referred to lung physicians (for COPD patients) or internist, surgeon or ophmatologist (for diabetes patients). Aggregated mean scores for five domains and for the total instrument were calculated as described in previous research [##REF##16249535##3##]. No scores per domain were determined for patients with missing values on on more than one third of the items in the domain.</p>\",\n \"<p>Patient enablement (PEI) was measured with a six-item questionnaire (with three response categories: 0 = 'same or worse', 1 = 'better', 2 = 'much better') [##REF##9613486##5##]. The range of the aggregated sum score was 0 to 12, with a higher score indicating a higher level of enablement. Respondents giving two or more missing values were excluded. Patient evaluations of general practice were measured with the Europep instrument, a 23-item internationally standardised and validated questionnaire (with a five point answering scale, ranging from 'poor' to 'excellent') [##REF##11141874##6##]. For this study, we determined the overall mean value on the 17 dichotomized (excellent versus other values) items focused on clinical performance (Cronbach's alpha = 0.97). Respondents with more than 5 missing items were excluded. Finally the questionnaire contained questions on patient age, gender, highest education, and overall health status (single item with five point response scale, 'excellent to 'poor).</p>\",\n \"<title>Data-analysis</title>\",\n \"<p>The analysis of the measurement properties of the PACIC was based on published quality criteria for questionnaires [##REF##17161752##7##]. The content validity of the PACIC is based on the Chronic Care Model [##UREF##0##1##,##REF##12132606##2##]. The interpretability of the instrument (the extent that qualitative meaning can be assigned to the qualitative scores) was based on the percentage of chronic patients who provided valid responses on each of the items. In addition, we checked for floor and ceiling effects in terms of percentage of patients using the most extreme (upper or lower) response categories.</p>\",\n \"<p>Principal factor analysis (PCA, factors with eigenvalue > 1, varimax rotation) was applied to examine the number and type of domains in the instrument [##UREF##1##8##]. We determined the Kaiser-Meyer-Olkin Measure of sampling adequacy and the Bartlett's test of sphericity. Internal consistency (the extent to which items measure the same concept) was expressed in terms of Cronbach's alpha for each of five domains in PACIC and for the total PACIC instrument. Reliability was expressed as an intra class coefficient (ICC, absolute agreement), which was based on variation between patients divided by total variation (taking patients random and items fixed). Values > 0.70 for alpha and ICC were considered acceptable [##REF##17161752##7##].</p>\",\n \"<p>The analysis of construct validity was based on the following hypotheses. We expected that higher PACIC scores, reflecting patient perceived presence of structured chronic care, would be positively related to both patients' perceived enablement after the latest visit to the GP and to patients' overall evaluations of general practice. To verify this expectation, we used linear regression analysis [##UREF##2##9##] with PACIC scores as dependent factor, enablement or evaluation as independent factor, and patient age and gender also included in the model. All data-analysis was done with SPSS 14.</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<p>In total, we received completed questionnaires from 165 patients: 88 diabetes patients (response rate 73%) and 77 COPD patients (70%). Table ##TAB##0##1## provides descriptive information on the patient samples. The patients' mean age was 68 years); only a minority had medium or high education (36%); and just over half of them (55%) reported a good or excellent health status. Diabetes patients were, compared to COPD patients, more frequently female (57 versus 35%). More diabetes patients than COPD patients (66 versus 41%) reported good to excellent health status.</p>","<p>Table ##TAB##1##2## provides descriptive information on the PACIC items. Not all responders had completed all items of the PACIC questionnaire. The percentage of non-responders of all patients varied between 22 and 35%. Three items (numbers 15, 17 and 20) had 30% or more non-responders. The percentage of responders who used the lowest answering category (indicating complete absence of structured chronic care) varied from 7 to 76%, and was in 11 items 30% or higher. The percentages of responders who used the highest answering category (indicated complete presence of the aspect) varied from 10 to 54%, and was in 6 items 30% or higher.</p>","<p>The factor analysis identified five factors (explaining 70% of the variation; KMO = 0.844; Bartlett's test of spherity p = 0.000), which mostly confirmed the internal consistency for three of the five pre-defined domains (Table ##TAB##2##3##). The items for the remaining two domains, delivery system/practice design and follow-up/coordination, were scattered across domains.</p>","<p>Despite this partial support for the pre-defined factor structure in the PACIC instrument. Cronbach's alpha's and ICCs were above our threshold of 0.70 for the overall measure and for most pre-defined domains (Table ##TAB##3##4##). Lower than threshold values were identified for the ICCs in the domains delivery system/decision support and follow-up/coordination. The association of the aggregated Europep score and PACIC domains and overall score were all positive, as expected. However, higher enablement in patients was associated with lower scores on PACIC domains and overall score, as opposed to our expectation.</p>"],"string":"[\n \"<title>Results</title>\",\n \"<p>In total, we received completed questionnaires from 165 patients: 88 diabetes patients (response rate 73%) and 77 COPD patients (70%). Table ##TAB##0##1## provides descriptive information on the patient samples. The patients' mean age was 68 years); only a minority had medium or high education (36%); and just over half of them (55%) reported a good or excellent health status. Diabetes patients were, compared to COPD patients, more frequently female (57 versus 35%). More diabetes patients than COPD patients (66 versus 41%) reported good to excellent health status.</p>\",\n \"<p>Table ##TAB##1##2## provides descriptive information on the PACIC items. Not all responders had completed all items of the PACIC questionnaire. The percentage of non-responders of all patients varied between 22 and 35%. Three items (numbers 15, 17 and 20) had 30% or more non-responders. The percentage of responders who used the lowest answering category (indicating complete absence of structured chronic care) varied from 7 to 76%, and was in 11 items 30% or higher. The percentages of responders who used the highest answering category (indicated complete presence of the aspect) varied from 10 to 54%, and was in 6 items 30% or higher.</p>\",\n \"<p>The factor analysis identified five factors (explaining 70% of the variation; KMO = 0.844; Bartlett's test of spherity p = 0.000), which mostly confirmed the internal consistency for three of the five pre-defined domains (Table ##TAB##2##3##). The items for the remaining two domains, delivery system/practice design and follow-up/coordination, were scattered across domains.</p>\",\n \"<p>Despite this partial support for the pre-defined factor structure in the PACIC instrument. Cronbach's alpha's and ICCs were above our threshold of 0.70 for the overall measure and for most pre-defined domains (Table ##TAB##3##4##). Lower than threshold values were identified for the ICCs in the domains delivery system/decision support and follow-up/coordination. The association of the aggregated Europep score and PACIC domains and overall score were all positive, as expected. However, higher enablement in patients was associated with lower scores on PACIC domains and overall score, as opposed to our expectation.</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>This study showed that the Dutch version of the PACIC instrument had mixed measurement properties when applied for assessing diabetes care and COPD care in general practice in a rural setting. The five previously defined domains were confirmed and their internal consistency was good. The correlation with patient evaluations of general practice was positive, and diabetes patients reported higher presence of structured chronic care than COPD patients as expected. However, substantial numbers of patients did not provide answers to the PACIC questions, although they returned the questionnaires and completed other parts of the questionnaire reasonably well. Also, we found that a number of items might have floor or ceiling effects. A surprising finding was that better scores for chronic care were linked to lower patient reported enablement after the latest consultation in general practice.</p>","<p>The mean scores on the PACIC domains and total instrument were similar to those found in diabetes patients in the USA [##REF##16249535##3##], but higher than those found in patients with osteoarthritis in Germany [##REF##17824876##4##]. The PACIC scores for diabetes patients in The Netherlands may be explained by the attention for enhancing structured diabetes care in recent years. For instance, there is no such attention for osteoarthritis, so we would expect similar scores for this condition compared to scores found in Germany. Despite the differences, our findings regarding measurement properties were similar to those found in Germany [##REF##17824876##4##].</p>","<p>Obviously, the study had a number of limitations. The patient sample was relatively small, and only four general practices from a rural setting were involved, but it was not our aim to generalize the descriptive figures. It is difficult to speculate on how the validation results could be affected by the rural setting. Criterion validity, test-retest reproducibility and responsiveness to change could not be analysed. A substantial proportion of the patients used the lowest answering category, which may indicate a floor effect of the measure (inability to discriminate between patients). We suggest, however, that the scores might perfectly reflect reality – a complete absence of specific aspects of structured chronic care. The high number of non-responders was worrying. An explanation for the non-response may be a perceived lack of relevance of the aspects covered by the items. Some of the aspects covered in the PACIC instrument may be unknown or not relevant to many chronic patients in general practice in The Netherlands. A second explanation may be that the non-response actually implies absence of the aspects mentioned in the PACIC questionnaire – but we think we cannot be certain about such inferences. A final explanation for this is translation problems. A direct translation of the English questions into the Dutch language did not result in understandable language, so we had to rephrase the items quite substantially. Despite this, the final questionnaire might have remained too difficult for many patients.</p>","<p>We can only speculate about the (weak, but 5 out of 6 times highly significant) negative association between patient enablement with the latest visit in the practice and PACIC scores. Perhaps patients with a stronger internal health locus of control and better self-management 'ask' less for enablement, so that they do not need help in general practice regarding the aspects covered by PACIC. Enablement and structured chronic care (including patient activation) may be fundamentally different concepts, as opposed to our expectations beforehand. The finding might also suggest that structured chronic care could have some negative consequences, despite its intention to enhance self-management in patients.</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>This study showed that the Dutch version of the PACIC instrument had mixed measurement properties when applied for assessing diabetes care and COPD care in general practice in a rural setting. The five previously defined domains were confirmed and their internal consistency was good. The correlation with patient evaluations of general practice was positive, and diabetes patients reported higher presence of structured chronic care than COPD patients as expected. However, substantial numbers of patients did not provide answers to the PACIC questions, although they returned the questionnaires and completed other parts of the questionnaire reasonably well. Also, we found that a number of items might have floor or ceiling effects. A surprising finding was that better scores for chronic care were linked to lower patient reported enablement after the latest consultation in general practice.</p>\",\n \"<p>The mean scores on the PACIC domains and total instrument were similar to those found in diabetes patients in the USA [##REF##16249535##3##], but higher than those found in patients with osteoarthritis in Germany [##REF##17824876##4##]. The PACIC scores for diabetes patients in The Netherlands may be explained by the attention for enhancing structured diabetes care in recent years. For instance, there is no such attention for osteoarthritis, so we would expect similar scores for this condition compared to scores found in Germany. Despite the differences, our findings regarding measurement properties were similar to those found in Germany [##REF##17824876##4##].</p>\",\n \"<p>Obviously, the study had a number of limitations. The patient sample was relatively small, and only four general practices from a rural setting were involved, but it was not our aim to generalize the descriptive figures. It is difficult to speculate on how the validation results could be affected by the rural setting. Criterion validity, test-retest reproducibility and responsiveness to change could not be analysed. A substantial proportion of the patients used the lowest answering category, which may indicate a floor effect of the measure (inability to discriminate between patients). We suggest, however, that the scores might perfectly reflect reality – a complete absence of specific aspects of structured chronic care. The high number of non-responders was worrying. An explanation for the non-response may be a perceived lack of relevance of the aspects covered by the items. Some of the aspects covered in the PACIC instrument may be unknown or not relevant to many chronic patients in general practice in The Netherlands. A second explanation may be that the non-response actually implies absence of the aspects mentioned in the PACIC questionnaire – but we think we cannot be certain about such inferences. A final explanation for this is translation problems. A direct translation of the English questions into the Dutch language did not result in understandable language, so we had to rephrase the items quite substantially. Despite this, the final questionnaire might have remained too difficult for many patients.</p>\",\n \"<p>We can only speculate about the (weak, but 5 out of 6 times highly significant) negative association between patient enablement with the latest visit in the practice and PACIC scores. Perhaps patients with a stronger internal health locus of control and better self-management 'ask' less for enablement, so that they do not need help in general practice regarding the aspects covered by PACIC. Enablement and structured chronic care (including patient activation) may be fundamentally different concepts, as opposed to our expectations beforehand. The finding might also suggest that structured chronic care could have some negative consequences, despite its intention to enhance self-management in patients.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>A validated Dutch version of the PACIC instrument is now available. Further research into its validity is recommended, particularly with respect to the high number of non-responders and the counterintuitive finding regarding patient enablement. Also, the questionnaire needs to be tested in other settings than primary care, before using it in those settings.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>A validated Dutch version of the PACIC instrument is now available. Further research into its validity is recommended, particularly with respect to the high number of non-responders and the counterintuitive finding regarding patient enablement. Also, the questionnaire needs to be tested in other settings than primary care, before using it in those settings.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>Many patients with chronic illness receive health care in primary care settings, so a challenge is to provide well-structured chronic care in these settings. Our aim was to develop and test a Dutch version of the PACIC questionnaire, a measure for patient reported structured chronic care.</p>","<title>Methods</title>","<p>Observational study in 165 patients with diabetes or COPD from four general practices (72% response rate). Patients completed a written questionnaire, which included instruments for assessing chronic illness care (PACIC), evaluations of general practice (Europep), enablement (PEI), and individual characteristics.</p>","<title>Results</title>","<p>The patients had a mean age of 68.0 years and 47% comprised of women. Twenty-two to 35% of responding patients did not provide answers to specific items in the PACIC. In 11 items the lowest answering category was used by 30% or more of the responders and in 6 items the highest answering category was used by this number of responders. Principal factor analysis identified the previously defined five domains reasonably well. Cronbach's alpha per domain varied from 0.71 to 0.83, and the intraclass coefficient from 0.66 to 0.91. Diabetes patients reported higher presence of structured chronic care for 14 out of the 20 PACIC items. The effect of patient evaluations of general practice on the PACIC score was positive (b = 0.72, p < 0.004), but the effect of patient enablement on the PACIC score was negative (b = -1.13, p < 0.000).</p>","<title>Conclusion</title>","<p>A translated and validated Dutch version of the PACIC questionnaire is now available. Further research on its validity is recommended.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>Many patients with chronic illness receive health care in primary care settings, so a challenge is to provide well-structured chronic care in these settings. Our aim was to develop and test a Dutch version of the PACIC questionnaire, a measure for patient reported structured chronic care.</p>\",\n \"<title>Methods</title>\",\n \"<p>Observational study in 165 patients with diabetes or COPD from four general practices (72% response rate). Patients completed a written questionnaire, which included instruments for assessing chronic illness care (PACIC), evaluations of general practice (Europep), enablement (PEI), and individual characteristics.</p>\",\n \"<title>Results</title>\",\n \"<p>The patients had a mean age of 68.0 years and 47% comprised of women. Twenty-two to 35% of responding patients did not provide answers to specific items in the PACIC. In 11 items the lowest answering category was used by 30% or more of the responders and in 6 items the highest answering category was used by this number of responders. Principal factor analysis identified the previously defined five domains reasonably well. Cronbach's alpha per domain varied from 0.71 to 0.83, and the intraclass coefficient from 0.66 to 0.91. Diabetes patients reported higher presence of structured chronic care for 14 out of the 20 PACIC items. The effect of patient evaluations of general practice on the PACIC score was positive (b = 0.72, p < 0.004), but the effect of patient enablement on the PACIC score was negative (b = -1.13, p < 0.000).</p>\",\n \"<title>Conclusion</title>\",\n \"<p>A translated and validated Dutch version of the PACIC questionnaire is now available. Further research on its validity is recommended.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>MW initiated, designed and coordinated the study, carried out data-analysis and wrote the manuscript. JvL contributed to the development of the Dutch version of PACIC and checked the tables in the manuscript. HPJ and JH organized and carried out the data-collection. All authors read earlier versions of the manuscript, provided critical comments, and approved the final manuscript.</p>","<title>Pre-publication history</title>","<p>The pre-publication history for this paper can be accessed here:</p>","<p><ext-link ext-link-type=\"uri\" xlink:href=\"http://www.biomedcentral.com/1472-6963/8/182/prepub\"/></p>","<title>Supplementary Material</title>"],"string":"[\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>MW initiated, designed and coordinated the study, carried out data-analysis and wrote the manuscript. JvL contributed to the development of the Dutch version of PACIC and checked the tables in the manuscript. HPJ and JH organized and carried out the data-collection. All authors read earlier versions of the manuscript, provided critical comments, and approved the final manuscript.</p>\",\n \"<title>Pre-publication history</title>\",\n \"<p>The pre-publication history for this paper can be accessed here:</p>\",\n \"<p><ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www.biomedcentral.com/1472-6963/8/182/prepub\\\"/></p>\",\n \"<title>Supplementary Material</title>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>We thank the participating patients and practices.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>We thank the participating patients and practices.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":[],"string":"[]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Patient characteristics (n = 165)</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"left\">Total population<break/></td><td align=\"left\">Diabetes patients <break/>(n = 88)</td><td align=\"left\">COPD patients <break/>(n = 77)</td></tr></thead><tbody><tr><td align=\"left\">Mean age (SD)</td><td align=\"left\">68.0 (10.3)</td><td align=\"left\">68.8 (8.9)</td><td align=\"left\">67.2 (11.7)</td></tr><tr><td align=\"left\">Percentage women</td><td align=\"left\">47%</td><td align=\"left\">57% *</td><td align=\"left\">35%</td></tr><tr><td align=\"left\">Percentage with medium or high education</td><td align=\"left\">36%</td><td align=\"left\">34%</td><td align=\"left\">38%</td></tr><tr><td align=\"left\">Percentage with good to excellent health status</td><td align=\"left\">55%</td><td align=\"left\">66% *</td><td align=\"left\">41%</td></tr><tr><td align=\"left\">Mean sum score on patient enablement (PEI)</td><td align=\"left\">8.7 (2.9)</td><td align=\"left\">8.4 (3.0)</td><td align=\"left\">9.1 (2.7)</td></tr><tr><td align=\"left\">Percentage of patients who evaluated clinical performance as 'excellent' (Europep)</td><td align=\"left\">57%</td><td align=\"left\">60%</td><td align=\"left\">54%</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T2\"><label>Table 2</label><caption><p>Descriptive information on PACIC items</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"left\">Item non-response in total study population<break/>(n = 165)</td><td align=\"left\" colspan=\"2\">Floor and ceiling effects in total study population<break/>(n = 165)</td><td align=\"left\" colspan=\"2\">% of responders reporting mostly/always present</td></tr></thead><tbody><tr><td/><td/><td align=\"left\">% of responders in lowest response category (absence)</td><td align=\"left\">% of responders in highest response category (presence)</td><td align=\"left\">Diabetes patients<break/>(n = 88)</td><td align=\"left\">COPD patients<break/>(n = 77)</td></tr><tr><td colspan=\"6\"><hr/></td></tr><tr><td align=\"left\"><bold>Patient activation</bold></td><td/><td/><td/><td/><td/></tr><tr><td align=\"left\">1 Asked about my ideas when we made a treatment plan</td><td align=\"left\">24</td><td align=\"left\">21</td><td align=\"left\">21</td><td align=\"left\">59</td><td align=\"left\">40</td></tr><tr><td align=\"left\">2 Given choices about treatment to think about</td><td align=\"left\">26</td><td align=\"left\">25</td><td align=\"left\">20</td><td align=\"left\">54</td><td align=\"left\">40</td></tr><tr><td align=\"left\">3 Asked to talk about any problems with my medicines or their effects</td><td align=\"left\">24</td><td align=\"left\">20</td><td align=\"left\">28</td><td align=\"left\">54</td><td align=\"left\">52</td></tr><tr><td align=\"left\"><bold>Delivery system/practice design</bold></td><td/><td/><td/><td/><td/></tr><tr><td align=\"left\">4 Given a written list of things I should do to improve my health</td><td align=\"left\">23</td><td align=\"left\">39</td><td align=\"left\">24</td><td align=\"left\">54</td><td align=\"left\">15</td></tr><tr><td align=\"left\">5 Satisfied that my care was well organized</td><td align=\"left\">23</td><td align=\"left\">7</td><td align=\"left\">54</td><td align=\"left\">88</td><td align=\"left\">75</td></tr><tr><td align=\"left\">6 Shown how what I did to talke care of my illness influenced my condition</td><td align=\"left\">25</td><td align=\"left\">18</td><td align=\"left\">46</td><td align=\"left\">72</td><td align=\"left\">50</td></tr><tr><td align=\"left\"><bold>Goal setting/tailoring</bold></td><td/><td/><td/><td/><td/></tr><tr><td align=\"left\">7 Asked to talk about my goals in caring for my illness</td><td align=\"left\">26</td><td align=\"left\">30</td><td align=\"left\">16</td><td align=\"left\">48</td><td align=\"left\">25</td></tr><tr><td align=\"left\">8 Helped to set specific goals to improve my eating or exercise</td><td align=\"left\">22</td><td align=\"left\">19</td><td align=\"left\">35</td><td align=\"left\">73</td><td align=\"left\">27</td></tr><tr><td align=\"left\">9 Given a copy of my treatment plan</td><td align=\"left\">26</td><td align=\"left\">61</td><td align=\"left\">21</td><td align=\"left\">36</td><td align=\"left\">10 *</td></tr><tr><td align=\"left\">10 Encouraged to go to a specific group or class to help me cope with my chronic illness</td><td align=\"left\">27</td><td align=\"left\">76</td><td align=\"left\">10</td><td align=\"left\">21</td><td align=\"left\">2</td></tr><tr><td align=\"left\">11 Asked questions, either directly or on a survey, about my health habits</td><td align=\"left\">27</td><td align=\"left\">53</td><td align=\"left\">18</td><td align=\"left\">40</td><td align=\"left\">12</td></tr><tr><td align=\"left\"><bold>Problem solving/contextual</bold></td><td/><td/><td/><td/><td/></tr><tr><td align=\"left\">12 Sure that my doctor or nurse thought about my values and my traditions when they recommended treatments to me</td><td align=\"left\">27</td><td align=\"left\">29</td><td align=\"left\">32</td><td align=\"left\">63</td><td align=\"left\">51</td></tr><tr><td align=\"left\">13 Help to make a treatment plan that I could do in my daily life</td><td align=\"left\">27</td><td align=\"left\">40</td><td align=\"left\">29</td><td align=\"left\">60</td><td align=\"left\">29</td></tr><tr><td align=\"left\">14 Helped to plan ahead so I could take care of my illness even in hard times</td><td align=\"left\">28</td><td align=\"left\">38</td><td align=\"left\">26</td><td align=\"left\">58</td><td align=\"left\">31</td></tr><tr><td align=\"left\">15 Asked how my chronic illness affects my life</td><td align=\"left\">30</td><td align=\"left\">38</td><td align=\"left\">23</td><td align=\"left\">43</td><td align=\"left\">29</td></tr><tr><td align=\"left\"><bold>Follow-up/coordination</bold></td><td/><td/><td/><td/><td/></tr><tr><td align=\"left\">16 Contacted after a visit to see how things were going</td><td align=\"left\">26</td><td align=\"left\">52</td><td align=\"left\">16</td><td align=\"left\">32</td><td align=\"left\">19</td></tr><tr><td align=\"left\">17 Encouraged to attend programs in the community that could help me</td><td align=\"left\">30</td><td align=\"left\">78</td><td align=\"left\">10</td><td align=\"left\">19</td><td align=\"left\">4</td></tr><tr><td align=\"left\">18 Referred to a dietician, health educator, or counselor</td><td align=\"left\">26</td><td align=\"left\">40</td><td align=\"left\">45</td><td align=\"left\">75</td><td align=\"left\">13</td></tr><tr><td align=\"left\">19 Told how my visits with other types of doctors, like consultant or surgeon, helped my treatment</td><td align=\"left\">23</td><td align=\"left\">28</td><td align=\"left\">43</td><td align=\"left\">68</td><td align=\"left\">41</td></tr><tr><td align=\"left\">20 Asked how my visits with other doctors were going</td><td align=\"left\">35</td><td align=\"left\">29</td><td align=\"left\">20</td><td align=\"left\">46</td><td align=\"left\">27</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T3\"><label>Table 3</label><caption><p>Factor loadings in rotated factor solution</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Items</bold></td><td align=\"left\">1</td><td align=\"left\">2</td><td align=\"left\">3</td><td align=\"left\">4</td><td align=\"left\">5</td></tr></thead><tbody><tr><td align=\"left\">1 Asked about ideas</td><td align=\"left\">0.159</td><td align=\"left\">0.697</td><td align=\"left\">0.255</td><td align=\"left\">0.324</td><td align=\"left\">0.072</td></tr><tr><td align=\"left\">2 Given choices</td><td align=\"left\">0.145</td><td align=\"left\">0.767</td><td align=\"left\">0.150</td><td align=\"left\">0.116</td><td align=\"left\">-0.005</td></tr><tr><td align=\"left\">3 Talk about problems</td><td align=\"left\">0.170</td><td align=\"left\">0.770</td><td align=\"left\">0.221</td><td align=\"left\">-0.051</td><td align=\"left\">0.188</td></tr><tr><td align=\"left\">4 Given written list</td><td align=\"left\">-0.043</td><td align=\"left\">0.284</td><td align=\"left\">0.475</td><td align=\"left\">0.553</td><td align=\"left\">0.250</td></tr><tr><td align=\"left\">5 Care well organized</td><td align=\"left\">0.140</td><td align=\"left\">0.206</td><td align=\"left\">0.783</td><td align=\"left\">-0.022</td><td align=\"left\">0.033</td></tr><tr><td align=\"left\">6 Influence my condition</td><td align=\"left\">0.368</td><td align=\"left\">0.283</td><td align=\"left\">0.698</td><td align=\"left\">0.149</td><td align=\"left\">0.046</td></tr><tr><td align=\"left\">7 Talk about goals</td><td align=\"left\">0.364</td><td align=\"left\">0.442</td><td align=\"left\">0.305</td><td align=\"left\">0.379</td><td align=\"left\">-0.076</td></tr><tr><td align=\"left\">8 Set goals</td><td align=\"left\">0.425</td><td align=\"left\">-0.002</td><td align=\"left\">0.526</td><td align=\"left\">0.443</td><td align=\"left\">0.240</td></tr><tr><td align=\"left\">9 Given treatment plan</td><td align=\"left\">0.277</td><td align=\"left\">0.246</td><td align=\"left\">0.106</td><td align=\"left\">0.675</td><td align=\"left\">-0.097</td></tr><tr><td align=\"left\">10 Go to group or class</td><td align=\"left\">0.341</td><td align=\"left\">0.033</td><td align=\"left\">-0.047</td><td align=\"left\">0.133</td><td align=\"left\">0.798</td></tr><tr><td align=\"left\">11 Questions health habits</td><td align=\"left\">0.637</td><td align=\"left\">0.103</td><td align=\"left\">0.065</td><td align=\"left\">0.360</td><td align=\"left\">0.043</td></tr><tr><td align=\"left\">12 Values and traditions</td><td align=\"left\">0.706</td><td align=\"left\">0.255</td><td align=\"left\">0.099</td><td align=\"left\">0.021</td><td align=\"left\">0.054</td></tr><tr><td align=\"left\">13 Could do in daily life</td><td align=\"left\">0.774</td><td align=\"left\">0.122</td><td align=\"left\">0.326</td><td align=\"left\">0.194</td><td align=\"left\">0.072</td></tr><tr><td align=\"left\">14 Helped to plan ahead</td><td align=\"left\">0.642</td><td align=\"left\">0.322</td><td align=\"left\">0.292</td><td align=\"left\">0.074</td><td align=\"left\">0.219</td></tr><tr><td align=\"left\">15 How illness affects life</td><td align=\"left\">0.385</td><td align=\"left\">0.593</td><td align=\"left\">0.033</td><td align=\"left\">0.197</td><td align=\"left\">0.166</td></tr><tr><td align=\"left\">16 Contact after visit</td><td align=\"left\">0.455</td><td align=\"left\">0.173</td><td align=\"left\">0.224</td><td align=\"left\">0.110</td><td align=\"left\">0.187</td></tr><tr><td align=\"left\">17 Attend programmes</td><td align=\"left\">0.024</td><td align=\"left\">0.219</td><td align=\"left\">0.227</td><td align=\"left\">0.105</td><td align=\"left\">0.812</td></tr><tr><td align=\"left\">18 Referred</td><td align=\"left\">0.225</td><td align=\"left\">0.010</td><td align=\"left\">-0.045</td><td align=\"left\">0.702</td><td align=\"left\">0.293</td></tr><tr><td align=\"left\">19 Other doctors</td><td align=\"left\">0.684</td><td align=\"left\">0.166</td><td align=\"left\">0.020</td><td align=\"left\">0.192</td><td align=\"left\">0.150</td></tr><tr><td align=\"left\">20 Asked about visits</td><td align=\"left\">0.388</td><td align=\"left\">0.487</td><td align=\"left\">0.003</td><td align=\"left\">-0.001</td><td align=\"left\">0.380</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T4\"><label>Table 4</label><caption><p>Information on the PACIC domains and overall PACIC score</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"left\">Overall <break/>PACIC<break/>score</td><td align=\"left\">Patient <break/>activation<break/></td><td align=\"left\">Delivery <break/>system/practice<break/>design</td><td align=\"left\">Goal setting/<break/>tailoring<break/></td><td align=\"left\">Problem <break/>solving/<break/>contextual</td><td align=\"left\">Follow-up/<break/>coordination<break/></td></tr></thead><tbody><tr><td align=\"left\">Number of items in the domain</td><td align=\"left\">20</td><td align=\"left\">3</td><td align=\"left\">3</td><td align=\"left\">5</td><td align=\"left\">4</td><td align=\"left\">5</td></tr><tr><td align=\"left\">Available sample for data-analysis</td><td align=\"left\">114</td><td align=\"left\">130</td><td align=\"left\">132</td><td align=\"left\">123</td><td align=\"left\">118</td><td align=\"left\">124</td></tr><tr><td align=\"left\">Patients with missing scores on more than one third of the items <break/>(% of total number of patients)</td><td align=\"left\">31%<break/></td><td align=\"left\">21%<break/></td><td align=\"left\">20%<break/></td><td align=\"left\">25%<break/></td><td align=\"left\">28%<break/></td><td align=\"left\">25%<break/></td></tr><tr><td align=\"left\">Mean value (SD) for all responders</td><td align=\"left\">2.9 (1.0)</td><td align=\"left\">3.2 (1.3)</td><td align=\"left\">3.5 (1.2)</td><td align=\"left\">2.5 (1.1)</td><td align=\"left\">3.3 (1.4)</td><td align=\"left\">3.1 (1.1)</td></tr><tr><td align=\"left\">Mean value (SD) for diabetes patients</td><td align=\"left\">3.2 (1.0)</td><td align=\"left\">3.4 (1.2)</td><td align=\"left\">3.9 (1.1)</td><td align=\"left\">2.9 (1.1)</td><td align=\"left\">2.5 (1.3)</td><td align=\"left\">2.0 (0.8)</td></tr><tr><td align=\"left\">Mean value (SD) for COPD patients</td><td align=\"left\">2.3 (0.8)</td><td align=\"left\">3.0 (1.3)</td><td align=\"left\">3.0 (1.2)</td><td align=\"left\">1.8 (0.8)</td><td align=\"left\">3.0 (1.4)</td><td align=\"left\">2.7 (1/1)</td></tr><tr><td align=\"left\">Effect of aggregated Europep score (b coefficient, p-value)<break/></td><td align=\"left\">0.72 <break/>(p < 0.004)</td><td align=\"left\">0.88 <break/>(p < 0.003)</td><td align=\"left\">0.88 <break/>(p < 0.002)</td><td align=\"left\">0.50 <break/>(p < 0.064)</td><td align=\"left\">0.87 <break/>(p < 0.011)</td><td align=\"left\">0.74 <break/>(p < 0.009)</td></tr><tr><td align=\"left\">Effect of aggregated enablement score (b coefficient, SD)<break/></td><td align=\"left\">-1.13 <break/>(p < 0.000)</td><td align=\"left\">-0.06 <break/>(p < 0.801)</td><td align=\"left\">-0.15 <break/>(p < 0.000)</td><td align=\"left\">-1.13 <break/>(p < 0.001)</td><td align=\"left\">-0.20 <break/>(p < 0.000)</td><td align=\"left\">-0.08 <break/>(p < 0.030)</td></tr><tr><td align=\"left\">Cronbach's alpha for internal consistency</td><td align=\"left\">0.93</td><td align=\"left\">0.85</td><td align=\"left\">0.75</td><td align=\"left\">0.81</td><td align=\"left\">0.87</td><td align=\"left\">0.71</td></tr><tr><td align=\"left\">Intra class coefficient (absolute agreement)</td><td align=\"left\">0.91</td><td align=\"left\">0.85</td><td align=\"left\">0.66</td><td align=\"left\">0.76</td><td align=\"left\">0.86</td><td align=\"left\">0.66</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Patient characteristics (n = 165)</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td/><td align=\\\"left\\\">Total population<break/></td><td align=\\\"left\\\">Diabetes patients <break/>(n = 88)</td><td align=\\\"left\\\">COPD patients <break/>(n = 77)</td></tr></thead><tbody><tr><td align=\\\"left\\\">Mean age (SD)</td><td align=\\\"left\\\">68.0 (10.3)</td><td align=\\\"left\\\">68.8 (8.9)</td><td align=\\\"left\\\">67.2 (11.7)</td></tr><tr><td align=\\\"left\\\">Percentage women</td><td align=\\\"left\\\">47%</td><td align=\\\"left\\\">57% *</td><td align=\\\"left\\\">35%</td></tr><tr><td align=\\\"left\\\">Percentage with medium or high education</td><td align=\\\"left\\\">36%</td><td align=\\\"left\\\">34%</td><td align=\\\"left\\\">38%</td></tr><tr><td align=\\\"left\\\">Percentage with good to excellent health status</td><td align=\\\"left\\\">55%</td><td align=\\\"left\\\">66% *</td><td align=\\\"left\\\">41%</td></tr><tr><td align=\\\"left\\\">Mean sum score on patient enablement (PEI)</td><td align=\\\"left\\\">8.7 (2.9)</td><td align=\\\"left\\\">8.4 (3.0)</td><td align=\\\"left\\\">9.1 (2.7)</td></tr><tr><td align=\\\"left\\\">Percentage of patients who evaluated clinical performance as 'excellent' (Europep)</td><td align=\\\"left\\\">57%</td><td align=\\\"left\\\">60%</td><td align=\\\"left\\\">54%</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T2\\\"><label>Table 2</label><caption><p>Descriptive information on PACIC items</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td/><td align=\\\"left\\\">Item non-response in total study population<break/>(n = 165)</td><td align=\\\"left\\\" colspan=\\\"2\\\">Floor and ceiling effects in total study population<break/>(n = 165)</td><td align=\\\"left\\\" colspan=\\\"2\\\">% of responders reporting mostly/always present</td></tr></thead><tbody><tr><td/><td/><td align=\\\"left\\\">% of responders in lowest response category (absence)</td><td align=\\\"left\\\">% of responders in highest response category (presence)</td><td align=\\\"left\\\">Diabetes patients<break/>(n = 88)</td><td align=\\\"left\\\">COPD patients<break/>(n = 77)</td></tr><tr><td colspan=\\\"6\\\"><hr/></td></tr><tr><td align=\\\"left\\\"><bold>Patient activation</bold></td><td/><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\">1 Asked about my ideas when we made a treatment plan</td><td align=\\\"left\\\">24</td><td align=\\\"left\\\">21</td><td align=\\\"left\\\">21</td><td align=\\\"left\\\">59</td><td align=\\\"left\\\">40</td></tr><tr><td align=\\\"left\\\">2 Given choices about treatment to think about</td><td align=\\\"left\\\">26</td><td align=\\\"left\\\">25</td><td align=\\\"left\\\">20</td><td align=\\\"left\\\">54</td><td align=\\\"left\\\">40</td></tr><tr><td align=\\\"left\\\">3 Asked to talk about any problems with my medicines or their effects</td><td align=\\\"left\\\">24</td><td align=\\\"left\\\">20</td><td align=\\\"left\\\">28</td><td align=\\\"left\\\">54</td><td align=\\\"left\\\">52</td></tr><tr><td align=\\\"left\\\"><bold>Delivery system/practice design</bold></td><td/><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\">4 Given a written list of things I should do to improve my health</td><td align=\\\"left\\\">23</td><td align=\\\"left\\\">39</td><td align=\\\"left\\\">24</td><td align=\\\"left\\\">54</td><td align=\\\"left\\\">15</td></tr><tr><td align=\\\"left\\\">5 Satisfied that my care was well organized</td><td align=\\\"left\\\">23</td><td align=\\\"left\\\">7</td><td align=\\\"left\\\">54</td><td align=\\\"left\\\">88</td><td align=\\\"left\\\">75</td></tr><tr><td align=\\\"left\\\">6 Shown how what I did to talke care of my illness influenced my condition</td><td align=\\\"left\\\">25</td><td align=\\\"left\\\">18</td><td align=\\\"left\\\">46</td><td align=\\\"left\\\">72</td><td align=\\\"left\\\">50</td></tr><tr><td align=\\\"left\\\"><bold>Goal setting/tailoring</bold></td><td/><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\">7 Asked to talk about my goals in caring for my illness</td><td align=\\\"left\\\">26</td><td align=\\\"left\\\">30</td><td align=\\\"left\\\">16</td><td align=\\\"left\\\">48</td><td align=\\\"left\\\">25</td></tr><tr><td align=\\\"left\\\">8 Helped to set specific goals to improve my eating or exercise</td><td align=\\\"left\\\">22</td><td align=\\\"left\\\">19</td><td align=\\\"left\\\">35</td><td align=\\\"left\\\">73</td><td align=\\\"left\\\">27</td></tr><tr><td align=\\\"left\\\">9 Given a copy of my treatment plan</td><td align=\\\"left\\\">26</td><td align=\\\"left\\\">61</td><td align=\\\"left\\\">21</td><td align=\\\"left\\\">36</td><td align=\\\"left\\\">10 *</td></tr><tr><td align=\\\"left\\\">10 Encouraged to go to a specific group or class to help me cope with my chronic illness</td><td align=\\\"left\\\">27</td><td align=\\\"left\\\">76</td><td align=\\\"left\\\">10</td><td align=\\\"left\\\">21</td><td align=\\\"left\\\">2</td></tr><tr><td align=\\\"left\\\">11 Asked questions, either directly or on a survey, about my health habits</td><td align=\\\"left\\\">27</td><td align=\\\"left\\\">53</td><td align=\\\"left\\\">18</td><td align=\\\"left\\\">40</td><td align=\\\"left\\\">12</td></tr><tr><td align=\\\"left\\\"><bold>Problem solving/contextual</bold></td><td/><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\">12 Sure that my doctor or nurse thought about my values and my traditions when they recommended treatments to me</td><td align=\\\"left\\\">27</td><td align=\\\"left\\\">29</td><td align=\\\"left\\\">32</td><td align=\\\"left\\\">63</td><td align=\\\"left\\\">51</td></tr><tr><td align=\\\"left\\\">13 Help to make a treatment plan that I could do in my daily life</td><td align=\\\"left\\\">27</td><td align=\\\"left\\\">40</td><td align=\\\"left\\\">29</td><td align=\\\"left\\\">60</td><td align=\\\"left\\\">29</td></tr><tr><td align=\\\"left\\\">14 Helped to plan ahead so I could take care of my illness even in hard times</td><td align=\\\"left\\\">28</td><td align=\\\"left\\\">38</td><td align=\\\"left\\\">26</td><td align=\\\"left\\\">58</td><td align=\\\"left\\\">31</td></tr><tr><td align=\\\"left\\\">15 Asked how my chronic illness affects my life</td><td align=\\\"left\\\">30</td><td align=\\\"left\\\">38</td><td align=\\\"left\\\">23</td><td align=\\\"left\\\">43</td><td align=\\\"left\\\">29</td></tr><tr><td align=\\\"left\\\"><bold>Follow-up/coordination</bold></td><td/><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\">16 Contacted after a visit to see how things were going</td><td align=\\\"left\\\">26</td><td align=\\\"left\\\">52</td><td align=\\\"left\\\">16</td><td align=\\\"left\\\">32</td><td align=\\\"left\\\">19</td></tr><tr><td align=\\\"left\\\">17 Encouraged to attend programs in the community that could help me</td><td align=\\\"left\\\">30</td><td align=\\\"left\\\">78</td><td align=\\\"left\\\">10</td><td align=\\\"left\\\">19</td><td align=\\\"left\\\">4</td></tr><tr><td align=\\\"left\\\">18 Referred to a dietician, health educator, or counselor</td><td align=\\\"left\\\">26</td><td align=\\\"left\\\">40</td><td align=\\\"left\\\">45</td><td align=\\\"left\\\">75</td><td align=\\\"left\\\">13</td></tr><tr><td align=\\\"left\\\">19 Told how my visits with other types of doctors, like consultant or surgeon, helped my treatment</td><td align=\\\"left\\\">23</td><td align=\\\"left\\\">28</td><td align=\\\"left\\\">43</td><td align=\\\"left\\\">68</td><td align=\\\"left\\\">41</td></tr><tr><td align=\\\"left\\\">20 Asked how my visits with other doctors were going</td><td align=\\\"left\\\">35</td><td align=\\\"left\\\">29</td><td align=\\\"left\\\">20</td><td align=\\\"left\\\">46</td><td align=\\\"left\\\">27</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T3\\\"><label>Table 3</label><caption><p>Factor loadings in rotated factor solution</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\"><bold>Items</bold></td><td align=\\\"left\\\">1</td><td align=\\\"left\\\">2</td><td align=\\\"left\\\">3</td><td align=\\\"left\\\">4</td><td align=\\\"left\\\">5</td></tr></thead><tbody><tr><td align=\\\"left\\\">1 Asked about ideas</td><td align=\\\"left\\\">0.159</td><td align=\\\"left\\\">0.697</td><td align=\\\"left\\\">0.255</td><td align=\\\"left\\\">0.324</td><td align=\\\"left\\\">0.072</td></tr><tr><td align=\\\"left\\\">2 Given choices</td><td align=\\\"left\\\">0.145</td><td align=\\\"left\\\">0.767</td><td align=\\\"left\\\">0.150</td><td align=\\\"left\\\">0.116</td><td align=\\\"left\\\">-0.005</td></tr><tr><td align=\\\"left\\\">3 Talk about problems</td><td align=\\\"left\\\">0.170</td><td align=\\\"left\\\">0.770</td><td align=\\\"left\\\">0.221</td><td align=\\\"left\\\">-0.051</td><td align=\\\"left\\\">0.188</td></tr><tr><td align=\\\"left\\\">4 Given written list</td><td align=\\\"left\\\">-0.043</td><td align=\\\"left\\\">0.284</td><td align=\\\"left\\\">0.475</td><td align=\\\"left\\\">0.553</td><td align=\\\"left\\\">0.250</td></tr><tr><td align=\\\"left\\\">5 Care well organized</td><td align=\\\"left\\\">0.140</td><td align=\\\"left\\\">0.206</td><td align=\\\"left\\\">0.783</td><td align=\\\"left\\\">-0.022</td><td align=\\\"left\\\">0.033</td></tr><tr><td align=\\\"left\\\">6 Influence my condition</td><td align=\\\"left\\\">0.368</td><td align=\\\"left\\\">0.283</td><td align=\\\"left\\\">0.698</td><td align=\\\"left\\\">0.149</td><td align=\\\"left\\\">0.046</td></tr><tr><td align=\\\"left\\\">7 Talk about goals</td><td align=\\\"left\\\">0.364</td><td align=\\\"left\\\">0.442</td><td align=\\\"left\\\">0.305</td><td align=\\\"left\\\">0.379</td><td align=\\\"left\\\">-0.076</td></tr><tr><td align=\\\"left\\\">8 Set goals</td><td align=\\\"left\\\">0.425</td><td align=\\\"left\\\">-0.002</td><td align=\\\"left\\\">0.526</td><td align=\\\"left\\\">0.443</td><td align=\\\"left\\\">0.240</td></tr><tr><td align=\\\"left\\\">9 Given treatment plan</td><td align=\\\"left\\\">0.277</td><td align=\\\"left\\\">0.246</td><td align=\\\"left\\\">0.106</td><td align=\\\"left\\\">0.675</td><td align=\\\"left\\\">-0.097</td></tr><tr><td align=\\\"left\\\">10 Go to group or class</td><td align=\\\"left\\\">0.341</td><td align=\\\"left\\\">0.033</td><td align=\\\"left\\\">-0.047</td><td align=\\\"left\\\">0.133</td><td align=\\\"left\\\">0.798</td></tr><tr><td align=\\\"left\\\">11 Questions health habits</td><td align=\\\"left\\\">0.637</td><td align=\\\"left\\\">0.103</td><td align=\\\"left\\\">0.065</td><td align=\\\"left\\\">0.360</td><td align=\\\"left\\\">0.043</td></tr><tr><td align=\\\"left\\\">12 Values and traditions</td><td align=\\\"left\\\">0.706</td><td align=\\\"left\\\">0.255</td><td align=\\\"left\\\">0.099</td><td align=\\\"left\\\">0.021</td><td align=\\\"left\\\">0.054</td></tr><tr><td align=\\\"left\\\">13 Could do in daily life</td><td align=\\\"left\\\">0.774</td><td align=\\\"left\\\">0.122</td><td align=\\\"left\\\">0.326</td><td align=\\\"left\\\">0.194</td><td align=\\\"left\\\">0.072</td></tr><tr><td align=\\\"left\\\">14 Helped to plan ahead</td><td align=\\\"left\\\">0.642</td><td align=\\\"left\\\">0.322</td><td align=\\\"left\\\">0.292</td><td align=\\\"left\\\">0.074</td><td align=\\\"left\\\">0.219</td></tr><tr><td align=\\\"left\\\">15 How illness affects life</td><td align=\\\"left\\\">0.385</td><td align=\\\"left\\\">0.593</td><td align=\\\"left\\\">0.033</td><td align=\\\"left\\\">0.197</td><td align=\\\"left\\\">0.166</td></tr><tr><td align=\\\"left\\\">16 Contact after visit</td><td align=\\\"left\\\">0.455</td><td align=\\\"left\\\">0.173</td><td align=\\\"left\\\">0.224</td><td align=\\\"left\\\">0.110</td><td align=\\\"left\\\">0.187</td></tr><tr><td align=\\\"left\\\">17 Attend programmes</td><td align=\\\"left\\\">0.024</td><td align=\\\"left\\\">0.219</td><td align=\\\"left\\\">0.227</td><td align=\\\"left\\\">0.105</td><td align=\\\"left\\\">0.812</td></tr><tr><td align=\\\"left\\\">18 Referred</td><td align=\\\"left\\\">0.225</td><td align=\\\"left\\\">0.010</td><td align=\\\"left\\\">-0.045</td><td align=\\\"left\\\">0.702</td><td align=\\\"left\\\">0.293</td></tr><tr><td align=\\\"left\\\">19 Other doctors</td><td align=\\\"left\\\">0.684</td><td align=\\\"left\\\">0.166</td><td align=\\\"left\\\">0.020</td><td align=\\\"left\\\">0.192</td><td align=\\\"left\\\">0.150</td></tr><tr><td align=\\\"left\\\">20 Asked about visits</td><td align=\\\"left\\\">0.388</td><td align=\\\"left\\\">0.487</td><td align=\\\"left\\\">0.003</td><td align=\\\"left\\\">-0.001</td><td align=\\\"left\\\">0.380</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T4\\\"><label>Table 4</label><caption><p>Information on the PACIC domains and overall PACIC score</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td/><td align=\\\"left\\\">Overall <break/>PACIC<break/>score</td><td align=\\\"left\\\">Patient <break/>activation<break/></td><td align=\\\"left\\\">Delivery <break/>system/practice<break/>design</td><td align=\\\"left\\\">Goal setting/<break/>tailoring<break/></td><td align=\\\"left\\\">Problem <break/>solving/<break/>contextual</td><td align=\\\"left\\\">Follow-up/<break/>coordination<break/></td></tr></thead><tbody><tr><td align=\\\"left\\\">Number of items in the domain</td><td align=\\\"left\\\">20</td><td align=\\\"left\\\">3</td><td align=\\\"left\\\">3</td><td align=\\\"left\\\">5</td><td align=\\\"left\\\">4</td><td align=\\\"left\\\">5</td></tr><tr><td align=\\\"left\\\">Available sample for data-analysis</td><td align=\\\"left\\\">114</td><td align=\\\"left\\\">130</td><td align=\\\"left\\\">132</td><td align=\\\"left\\\">123</td><td align=\\\"left\\\">118</td><td align=\\\"left\\\">124</td></tr><tr><td align=\\\"left\\\">Patients with missing scores on more than one third of the items <break/>(% of total number of patients)</td><td align=\\\"left\\\">31%<break/></td><td align=\\\"left\\\">21%<break/></td><td align=\\\"left\\\">20%<break/></td><td align=\\\"left\\\">25%<break/></td><td align=\\\"left\\\">28%<break/></td><td align=\\\"left\\\">25%<break/></td></tr><tr><td align=\\\"left\\\">Mean value (SD) for all responders</td><td align=\\\"left\\\">2.9 (1.0)</td><td align=\\\"left\\\">3.2 (1.3)</td><td align=\\\"left\\\">3.5 (1.2)</td><td align=\\\"left\\\">2.5 (1.1)</td><td align=\\\"left\\\">3.3 (1.4)</td><td align=\\\"left\\\">3.1 (1.1)</td></tr><tr><td align=\\\"left\\\">Mean value (SD) for diabetes patients</td><td align=\\\"left\\\">3.2 (1.0)</td><td align=\\\"left\\\">3.4 (1.2)</td><td align=\\\"left\\\">3.9 (1.1)</td><td align=\\\"left\\\">2.9 (1.1)</td><td align=\\\"left\\\">2.5 (1.3)</td><td align=\\\"left\\\">2.0 (0.8)</td></tr><tr><td align=\\\"left\\\">Mean value (SD) for COPD patients</td><td align=\\\"left\\\">2.3 (0.8)</td><td align=\\\"left\\\">3.0 (1.3)</td><td align=\\\"left\\\">3.0 (1.2)</td><td align=\\\"left\\\">1.8 (0.8)</td><td align=\\\"left\\\">3.0 (1.4)</td><td align=\\\"left\\\">2.7 (1/1)</td></tr><tr><td align=\\\"left\\\">Effect of aggregated Europep score (b coefficient, p-value)<break/></td><td align=\\\"left\\\">0.72 <break/>(p < 0.004)</td><td align=\\\"left\\\">0.88 <break/>(p < 0.003)</td><td align=\\\"left\\\">0.88 <break/>(p < 0.002)</td><td align=\\\"left\\\">0.50 <break/>(p < 0.064)</td><td align=\\\"left\\\">0.87 <break/>(p < 0.011)</td><td align=\\\"left\\\">0.74 <break/>(p < 0.009)</td></tr><tr><td align=\\\"left\\\">Effect of aggregated enablement score (b coefficient, SD)<break/></td><td align=\\\"left\\\">-1.13 <break/>(p < 0.000)</td><td align=\\\"left\\\">-0.06 <break/>(p < 0.801)</td><td align=\\\"left\\\">-0.15 <break/>(p < 0.000)</td><td align=\\\"left\\\">-1.13 <break/>(p < 0.001)</td><td align=\\\"left\\\">-0.20 <break/>(p < 0.000)</td><td align=\\\"left\\\">-0.08 <break/>(p < 0.030)</td></tr><tr><td align=\\\"left\\\">Cronbach's alpha for internal consistency</td><td align=\\\"left\\\">0.93</td><td align=\\\"left\\\">0.85</td><td align=\\\"left\\\">0.75</td><td align=\\\"left\\\">0.81</td><td align=\\\"left\\\">0.87</td><td align=\\\"left\\\">0.71</td></tr><tr><td align=\\\"left\\\">Intra class coefficient (absolute agreement)</td><td align=\\\"left\\\">0.91</td><td align=\\\"left\\\">0.85</td><td align=\\\"left\\\">0.66</td><td align=\\\"left\\\">0.76</td><td align=\\\"left\\\">0.86</td><td align=\\\"left\\\">0.66</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":["<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Dutch version of the PACIC. The PACIC questionnaire in Dutch language, which we have used in our study.</p></caption></supplementary-material>"],"string":"[\n \"<supplementary-material content-type=\\\"local-data\\\" id=\\\"S1\\\"><caption><title>Additional file 1</title><p>Dutch version of the PACIC. The PACIC questionnaire in Dutch language, which we have used in our study.</p></caption></supplementary-material>\"\n]","isConversational":false},"footnote":{"kind":"list like","value":["<table-wrap-foot><p>* P < 0.05 of difference between diabetes patients and COPD patients.</p></table-wrap-foot>"],"string":"[\n \"<table-wrap-foot><p>* P < 0.05 of difference between diabetes patients and COPD patients.</p></table-wrap-foot>\"\n]","isConversational":false},"graphic":{"kind":"list like","value":[],"string":"[]","isConversational":false},"media":{"kind":"list like","value":["<media xlink:href=\"1472-6963-8-182-S1.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>"],"string":"[\n \"<media xlink:href=\\\"1472-6963-8-182-S1.doc\\\" mimetype=\\\"application\\\" mime-subtype=\\\"msword\\\"><caption><p>Click here for file</p></caption></media>\"\n]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Wagner\", \"Austin\", \"Von Korff\"], \"given-names\": [\"EH\", \"BT\", \"M\"], \"article-title\": [\"Organizing care for patients with chronic illness\"], \"source\": [\"Milb Quat\"], \"year\": [\"1996\"], \"volume\": [\"34\"], \"fpage\": [\"511\"], \"lpage\": [\"544\"], \"pub-id\": [\"10.2307/3350391\"]}, {\"surname\": [\"Kim\", \"Mueller\"], \"given-names\": [\"JO\", \"CW\"], \"source\": [\"Factor analysis. Statistical methods and practical issues\"], \"year\": [\"1976\"], \"publisher-name\": [\"Beverley Hills and London: Sage\"]}, {\"surname\": [\"Berry\", \"Feldman\"], \"given-names\": [\"WD\", \"S\"], \"source\": [\"Multiple regression in practice\"], \"year\": [\"1985\"], \"publisher-name\": [\"Beverley Hills and London: Sage\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":9,"string":"9"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:37"},"citation":{"kind":"string","value":"BMC Health Serv Res. 2008 Sep 1; 8:182"},"package_file":{"kind":"string","value":"oa_package/e6/9f/PMC2538520.tar.gz"}}},{"rowIdx":119685,"cells":{"accession_id":{"kind":"string","value":"PMC2538521"},"pmid":{"kind":"string","value":"18691428"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>There is an increasing trend in the utilization of complementary or alternative medicine (CAM) worldwide [##REF##8688771##1##]. According to the estimation of the World Health Organization, the usage of CAM ranges from 9 to 65% in different countries [##REF##10743298##2##]. In the United States, CAM utilization increased from 34% in 1990 to 42% in 1997 [##REF##8418405##3##,##REF##9820257##4##]. CAM is also very popular in Europe [##REF##8038643##5##], Canada [##REF##9260354##6##], and Australia [##REF##8596318##7##]. Patients choosing CAM are not necessarily dissatisfied with conventional medical care. They are seeking more effective ways to improve their health and well-being and to relieve symptoms associated with chronic, even terminal, illnesses or the side effects of conventional treatments for them [##REF##9605899##8##].</p>","<p>Among different forms of CAM, Chinese medicine (CM) is well known for the medicinal formulas and acupuncture, and is one of the most popular alternative medicines in many countries. In Singapore, CM is the most popular form of CAM and has been employed by 88% of the CAM users [##UREF##0##9##]. Moreover, CM accounts for 40% of the health care in China [##UREF##1##10##]. Although CM is commonly used in the countries of East Asia, this system of medical service is also growing in popularity and offers an important alternative or complement to biomedical care in the Western countries [##UREF##2##11##].</p>","<p>In Taiwan, one distinguishing feature of the national health-care insurance system is the co-existence of the modern Western medicine (WM) and CM. In addition, the social health-care insurance system covers CM since 1975. Although only bone fractures and dislocations were included in the initial coverage of the Labor Medical Insurance, the therapeutic items were then expanded to internal medicine, gynecology, and acupuncture in 1983. In 1988, the Public Employee Medical Insurance Program started to reimburse CM [##REF##9210775##12##]. After the implementation of the National Health Insurance (NHI) Program in March 1995, all citizens who have established a registered domicile in Taiwan are mandated to join the program. In June 2003, more than 99% of the 23-million population has benefited from this universal health insurance program. However, CM has only 5% of the total expenditure in the NHI coverage. The health care items covered physician consultation for diagnosis, drug prescription, acupuncture, and muscle strain therapy [##UREF##3##13##].</p>","<p>Although information on different aspects of CM in Taiwan is available [##REF##9210775##12##,##REF##7920095##14##, ####REF##8913003##15##, ##REF##11458756##16##, ##REF##15786515##17##, ##UREF##4##18####4##18##], these reports were based on small samples [##REF##9210775##12##,##REF##7920095##14##, ####REF##8913003##15##, ##REF##11458756##16####11458756##16##] or limited to one component of CM [##REF##15786515##17##,##UREF##4##18##]. Moreover, some of these studies were conducted before the establishment of the NHI program [##REF##9210775##12##,##REF##7920095##14##,##REF##8913003##15##]. Recently, a study on the use frequencies, characteristics of users, and the disease categories treated by CM in Taiwan was conducted based on the complete datasets of CM outpatient reimbursement claims from 1996 to 2001 [##UREF##5##19##]. However, except sex and age, other user characteristics were not analyzed and the utilization pattern of WM was only slightly explored. The purpose of this study is to gain a more complete picture of utilization of CM in the national health insurance system with dual medical systems (Western and Chinese medical services) by determining the extent of CM utilization from 1997 to 2003 using WM as a reference and the demographic factors and primary indications that predict the choice of the type of medical service.</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>There is an increasing trend in the utilization of complementary or alternative medicine (CAM) worldwide [##REF##8688771##1##]. According to the estimation of the World Health Organization, the usage of CAM ranges from 9 to 65% in different countries [##REF##10743298##2##]. In the United States, CAM utilization increased from 34% in 1990 to 42% in 1997 [##REF##8418405##3##,##REF##9820257##4##]. CAM is also very popular in Europe [##REF##8038643##5##], Canada [##REF##9260354##6##], and Australia [##REF##8596318##7##]. Patients choosing CAM are not necessarily dissatisfied with conventional medical care. They are seeking more effective ways to improve their health and well-being and to relieve symptoms associated with chronic, even terminal, illnesses or the side effects of conventional treatments for them [##REF##9605899##8##].</p>\",\n \"<p>Among different forms of CAM, Chinese medicine (CM) is well known for the medicinal formulas and acupuncture, and is one of the most popular alternative medicines in many countries. In Singapore, CM is the most popular form of CAM and has been employed by 88% of the CAM users [##UREF##0##9##]. Moreover, CM accounts for 40% of the health care in China [##UREF##1##10##]. Although CM is commonly used in the countries of East Asia, this system of medical service is also growing in popularity and offers an important alternative or complement to biomedical care in the Western countries [##UREF##2##11##].</p>\",\n \"<p>In Taiwan, one distinguishing feature of the national health-care insurance system is the co-existence of the modern Western medicine (WM) and CM. In addition, the social health-care insurance system covers CM since 1975. Although only bone fractures and dislocations were included in the initial coverage of the Labor Medical Insurance, the therapeutic items were then expanded to internal medicine, gynecology, and acupuncture in 1983. In 1988, the Public Employee Medical Insurance Program started to reimburse CM [##REF##9210775##12##]. After the implementation of the National Health Insurance (NHI) Program in March 1995, all citizens who have established a registered domicile in Taiwan are mandated to join the program. In June 2003, more than 99% of the 23-million population has benefited from this universal health insurance program. However, CM has only 5% of the total expenditure in the NHI coverage. The health care items covered physician consultation for diagnosis, drug prescription, acupuncture, and muscle strain therapy [##UREF##3##13##].</p>\",\n \"<p>Although information on different aspects of CM in Taiwan is available [##REF##9210775##12##,##REF##7920095##14##, ####REF##8913003##15##, ##REF##11458756##16##, ##REF##15786515##17##, ##UREF##4##18####4##18##], these reports were based on small samples [##REF##9210775##12##,##REF##7920095##14##, ####REF##8913003##15##, ##REF##11458756##16####11458756##16##] or limited to one component of CM [##REF##15786515##17##,##UREF##4##18##]. Moreover, some of these studies were conducted before the establishment of the NHI program [##REF##9210775##12##,##REF##7920095##14##,##REF##8913003##15##]. Recently, a study on the use frequencies, characteristics of users, and the disease categories treated by CM in Taiwan was conducted based on the complete datasets of CM outpatient reimbursement claims from 1996 to 2001 [##UREF##5##19##]. However, except sex and age, other user characteristics were not analyzed and the utilization pattern of WM was only slightly explored. The purpose of this study is to gain a more complete picture of utilization of CM in the national health insurance system with dual medical systems (Western and Chinese medical services) by determining the extent of CM utilization from 1997 to 2003 using WM as a reference and the demographic factors and primary indications that predict the choice of the type of medical service.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<title>Data Resource</title>","<p>Since all citizens in Taiwan who have established a registered domicile should be enrolled in the NHI Program, the NHI Bureau has accumulated 23.75 million administrative and claims records, forming the largest such collection in the world. The NHI research database was established under the cooperation of National Health Research Institutes (NHRI) and the NHI Bureau [##UREF##3##13##]. The NHRI safeguards the privacy and confidentiality of the subjects [##UREF##6##20##]. The database includes the NHI claims data and data from the enrolment and provider files. In addition to birth date and sex of each patient, the NHI claims data also record diagnosis, date of service, drugs prescribed and filed, dispensing method and anonymous identifiers for the patient, the hospital/clinic and the physician providing the service. All the individuals included in the entire claims database (the general population) were given different random numbers by using a random number function. Simple random sampling of about 50,000 people at a time was performed in 2000. This sampling database consisted of four simple randomly sampled subsets and finally included 200,432 enrolees and represents 1% of the total NHI beneficiaries. [##UREF##6##20##,##REF##15946761##21##].</p>","<title>Study Sample</title>","<p>In this study, a nationally representative sample of 200,432 NHI enrollees was used. To construct a fixed cohort, we excluded those who were newborns aged below 2 years (5.0%) in 1997, died during the study period (3.4%), were foreigners (4.1%), had incomplete data (1.0%), and had no continuous enrollment information from 1997 to 2003 (18.2%) sequentially. The final fixed cohort consisted of 136,720 individuals. These individuals were observed to investigate the longitudinal utilization patterns of CM and WM from 1997 to 2003.</p>","<title>Study variables</title>","<p>In order to understand the common factors affecting the utilization of CM and WM, we selected the demographic factors according to previous studies [##REF##9210775##12##,##REF##17030829##22##,##REF##17405675##23##]. In addition to gender, ages were categorized into eight groups: 2–7, 8–14, 15–24, 25–34, 35–44, 45–54, 55–64 and 65 years or older. For the socio-economic status (SES), we classified those with a well-defined monthly wage into three categories: ≥ US$1,280, US$640–1,279 and < US$640. Those people without a well-defined monthly wage were categorized into two groups: farmers and fishermen, and others, which include veterans, low-income people and individuals enrolled in the NHI through local government offices. Severe diseases were defined according to the Illness and Injury Severity Score and the NHI has an official list of major diseases including cancer, acquired immune deficiency syndrome, major psychiatric disorder, and so on [##UREF##3##13##]. Remote areas were defined officially according to mountainous geographic environment and traffic conditions. There are 30 mountainous regions proclaimed remote areas [##REF##15946761##21##]. In addition, offshore islands include Lanyu Isles, Green Island, and Penghu Islands. These remote areas have been under-served with insufficient medical services.</p>","<title>Definition of CM</title>","<p>In this study, CM is used pragmatically to refer to diagnostic and therapeutic practices, including primarily herbal medication, acupuncture, and muscle strain therapy. Muscle strain therapy includes professional massage and osteopathy manual therapy. In this study, we also considered dislocation treatment as one component of the muscle strain therapy. These three components of CM are also modalities of CAM defined in the Western countries [##REF##8418405##3##]. In addition to these three main components, CM users may also consult the physician only for physical examination or suggestion of management of the health care problems but without treatment. Consultation services were also covered by the NHI Program.</p>","<title>Statistical analysis</title>","<p>The unit of observation was each individual in the study sample. The usage, frequency of services, and primary indications for CM and WM were evaluated. The classification of primary indications was according to the International Classification of Diseases Ninth Clinical Modification (ICD-9-CM) [##UREF##8##25##]. The statistical software SAS 9.13 [##UREF##9##26##] was used for data management and analyses. A logistic regression model was used to analyze the data, and generalized estimating equations were used to account for correlation among the repeated measurements [##UREF##10##27##,##UREF##11##28##]. Based on the correlation matrices of CM and WM utilizations over time, an unstructured working correlation was selected. In addition, sensitivity analyses were conducted for autoregressive, independent and compound symmetry, and the results remained robust. A significance level of α = 0.05 was selected.</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<title>Data Resource</title>\",\n \"<p>Since all citizens in Taiwan who have established a registered domicile should be enrolled in the NHI Program, the NHI Bureau has accumulated 23.75 million administrative and claims records, forming the largest such collection in the world. The NHI research database was established under the cooperation of National Health Research Institutes (NHRI) and the NHI Bureau [##UREF##3##13##]. The NHRI safeguards the privacy and confidentiality of the subjects [##UREF##6##20##]. The database includes the NHI claims data and data from the enrolment and provider files. In addition to birth date and sex of each patient, the NHI claims data also record diagnosis, date of service, drugs prescribed and filed, dispensing method and anonymous identifiers for the patient, the hospital/clinic and the physician providing the service. All the individuals included in the entire claims database (the general population) were given different random numbers by using a random number function. Simple random sampling of about 50,000 people at a time was performed in 2000. This sampling database consisted of four simple randomly sampled subsets and finally included 200,432 enrolees and represents 1% of the total NHI beneficiaries. [##UREF##6##20##,##REF##15946761##21##].</p>\",\n \"<title>Study Sample</title>\",\n \"<p>In this study, a nationally representative sample of 200,432 NHI enrollees was used. To construct a fixed cohort, we excluded those who were newborns aged below 2 years (5.0%) in 1997, died during the study period (3.4%), were foreigners (4.1%), had incomplete data (1.0%), and had no continuous enrollment information from 1997 to 2003 (18.2%) sequentially. The final fixed cohort consisted of 136,720 individuals. These individuals were observed to investigate the longitudinal utilization patterns of CM and WM from 1997 to 2003.</p>\",\n \"<title>Study variables</title>\",\n \"<p>In order to understand the common factors affecting the utilization of CM and WM, we selected the demographic factors according to previous studies [##REF##9210775##12##,##REF##17030829##22##,##REF##17405675##23##]. In addition to gender, ages were categorized into eight groups: 2–7, 8–14, 15–24, 25–34, 35–44, 45–54, 55–64 and 65 years or older. For the socio-economic status (SES), we classified those with a well-defined monthly wage into three categories: ≥ US$1,280, US$640–1,279 and < US$640. Those people without a well-defined monthly wage were categorized into two groups: farmers and fishermen, and others, which include veterans, low-income people and individuals enrolled in the NHI through local government offices. Severe diseases were defined according to the Illness and Injury Severity Score and the NHI has an official list of major diseases including cancer, acquired immune deficiency syndrome, major psychiatric disorder, and so on [##UREF##3##13##]. Remote areas were defined officially according to mountainous geographic environment and traffic conditions. There are 30 mountainous regions proclaimed remote areas [##REF##15946761##21##]. In addition, offshore islands include Lanyu Isles, Green Island, and Penghu Islands. These remote areas have been under-served with insufficient medical services.</p>\",\n \"<title>Definition of CM</title>\",\n \"<p>In this study, CM is used pragmatically to refer to diagnostic and therapeutic practices, including primarily herbal medication, acupuncture, and muscle strain therapy. Muscle strain therapy includes professional massage and osteopathy manual therapy. In this study, we also considered dislocation treatment as one component of the muscle strain therapy. These three components of CM are also modalities of CAM defined in the Western countries [##REF##8418405##3##]. In addition to these three main components, CM users may also consult the physician only for physical examination or suggestion of management of the health care problems but without treatment. Consultation services were also covered by the NHI Program.</p>\",\n \"<title>Statistical analysis</title>\",\n \"<p>The unit of observation was each individual in the study sample. The usage, frequency of services, and primary indications for CM and WM were evaluated. The classification of primary indications was according to the International Classification of Diseases Ninth Clinical Modification (ICD-9-CM) [##UREF##8##25##]. The statistical software SAS 9.13 [##UREF##9##26##] was used for data management and analyses. A logistic regression model was used to analyze the data, and generalized estimating equations were used to account for correlation among the repeated measurements [##UREF##10##27##,##UREF##11##28##]. Based on the correlation matrices of CM and WM utilizations over time, an unstructured working correlation was selected. In addition, sensitivity analyses were conducted for autoregressive, independent and compound symmetry, and the results remained robust. A significance level of α = 0.05 was selected.</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<p>Table ##TAB##0##1## shows the demographic characteristics of the studied cohort. Adjusted ORs and 95% confidence intervals (95% CIs) resulting from the logistic regression model are displayed in Table ##TAB##1##2##. The odds of using CM (OR 1.48) and WM (OR 1.74) were higher for females than for males (OR 1.00). Compared with the youngest age group (OR 1.00), the odds of CM increased with age to a peak in the 45–54-year-group (OR 1.75) whereas those of WM became relatively high only in the elderly subjects (≥ 65 years) (OR 1.09).</p>","<p>The odds of CM (OR 1.05) and WM (OR 1.00) in the group with a monthly wage US$640-1,279 were higher than those in the low-income group (< US$640) (CM: OR 1.04; WM: OR 0.98), farmers and fishermen (CM: OR: 0.90; WM: OR 0.97) and the other group (CM: OR 0.86; WM: OR: 0.77). Although the odds of CM were similar in the groups with (OR 1.00) and without (OR 1.00) severe diseases, the odds of WM in the people with severe diseases (OR 2.40) was higher than those without these diseases (OR 1.00) (Table ##TAB##1##2##).</p>","<p>The odds of CM were higher among people in Central (OR 1.65), Southern (OR 1.18), and Kaohsiung and Pingtung (OR 1.09) than those in Eastern Taiwan (OR 1.00), Northern Taiwan (OR 0.96), and Taipei (OR 0.91). However, those of WM were higher among people in Taipei (OR 1.03), Northern Taiwan (OR 1.08), Central Taiwan (OR 1.15), Southern Taiwan (OR 1.20), and Kaohsiung and Pingtung (OR 1.21) than Eastern Taiwan (OR 1.00). The odds of CM in the general population (OR 1.00) was higher than those in the mountainous regions (OR 0.57) and offshore islands (OR 0.78) whereas those of WM were higher in mountainous regions (OR 1.03) and offshore islands (OR 1.21) than the general population (OR 1.00) (Table ##TAB##1##2##).</p>","<p>Table ##TAB##1##2## also shows a steady increasing trend in the odds of CM from 1997 (OR 1.00) to 2003 (OR 1.15). Moreover, the odds WM utilization also increased from 1997 (OR 1.00) to 2002 (OR 1.28) but decreased in 2003 (OR 1.17). Of all seasons, the odds of either CM or WM were the highest in winter.</p>","<p>The crude utilizations of CM and WM are shown in Table ##TAB##2##3##. The number of CM users increased from 36,372 in 1997 to 41,823 in 2003. However, the number of WM users from 115,833 in 1997 to 121,605 in 2002 and decreased to 120,926 in 2003. The average number of patients who had used any CM service in one year and the number of visits to CM providers were 39,562 and 191,612, respectively. The corresponding figures for WM were 119,915 and 1,542,342. Most of the patients had one ambulatory visit a year. However, the utilization frequency of WM (mean = 12.55–13.34, median = 8–9) was higher than that of CM (mean = 4.63–5.03, median = 2–3). Most of the ambulatory CM service was provided by clinics (93.4–96.1%) and only 3.9–6.6% was provided by hospitals. Moreover, the frequency of ambulatory visits in hospitals steadily increased from 3.9% in 1997 to 6.6% in 2002. On the other hand, clinics provided about two-thirds (60.5–67.8%) of the ambulatory WM service, outpatient department of the hospitals took the remaining one-third (32.2–39.5%) of ambulatory service.</p>","<p>Diseases of the respiratory system (CM 22.1%, WM 35.6%) and the musculoskeletal system and connective tissue (CM 18.1%, WM 7.5%) were the top two primary indications in the ambulatory health care of both CM and WM. In CM, the remaining common primary indications were injury and poisoning (16.2%), diseases of signs, symptoms and ill-defined conditions (14.2%), and diseases of the digestive system (11.4%). In WM, diseases of the genitourinary system (7.2%), diseases of the digestive system (7.2%), and diseases of sense organs (7.1%) were also common primary indications (Table ##TAB##3##4##).</p>","<p>Herbal medication was the most important component of CM. This component accounted for more than two-thirds of the ambulatory visits (68.4–72.7%). The utilization rate decreased from 70.8% in 1997 to 68.7% in 2003. The other two major components were muscle strain therapy (including dislocation therapy) and acupuncture. Muscle strain therapy accounted for 15.6–17.5% and acupuncture for 9.2–13.0% of the ambulatory visits. These two components showed increasing utilization trends: muscle strain therapy increased from 16.4% in 1997 to 17.2% in 2003 and acupuncture from 9.4% in 1997 to 13.0% in 2003. In addition to these main components of CM, general consultation services accounted for 3.4% in 1997. However, the utilization of these consultation only services decreased to 1.1% in 2003 (Table ##TAB##4##5##).</p>"],"string":"[\n \"<title>Results</title>\",\n \"<p>Table ##TAB##0##1## shows the demographic characteristics of the studied cohort. Adjusted ORs and 95% confidence intervals (95% CIs) resulting from the logistic regression model are displayed in Table ##TAB##1##2##. The odds of using CM (OR 1.48) and WM (OR 1.74) were higher for females than for males (OR 1.00). Compared with the youngest age group (OR 1.00), the odds of CM increased with age to a peak in the 45–54-year-group (OR 1.75) whereas those of WM became relatively high only in the elderly subjects (≥ 65 years) (OR 1.09).</p>\",\n \"<p>The odds of CM (OR 1.05) and WM (OR 1.00) in the group with a monthly wage US$640-1,279 were higher than those in the low-income group (< US$640) (CM: OR 1.04; WM: OR 0.98), farmers and fishermen (CM: OR: 0.90; WM: OR 0.97) and the other group (CM: OR 0.86; WM: OR: 0.77). Although the odds of CM were similar in the groups with (OR 1.00) and without (OR 1.00) severe diseases, the odds of WM in the people with severe diseases (OR 2.40) was higher than those without these diseases (OR 1.00) (Table ##TAB##1##2##).</p>\",\n \"<p>The odds of CM were higher among people in Central (OR 1.65), Southern (OR 1.18), and Kaohsiung and Pingtung (OR 1.09) than those in Eastern Taiwan (OR 1.00), Northern Taiwan (OR 0.96), and Taipei (OR 0.91). However, those of WM were higher among people in Taipei (OR 1.03), Northern Taiwan (OR 1.08), Central Taiwan (OR 1.15), Southern Taiwan (OR 1.20), and Kaohsiung and Pingtung (OR 1.21) than Eastern Taiwan (OR 1.00). The odds of CM in the general population (OR 1.00) was higher than those in the mountainous regions (OR 0.57) and offshore islands (OR 0.78) whereas those of WM were higher in mountainous regions (OR 1.03) and offshore islands (OR 1.21) than the general population (OR 1.00) (Table ##TAB##1##2##).</p>\",\n \"<p>Table ##TAB##1##2## also shows a steady increasing trend in the odds of CM from 1997 (OR 1.00) to 2003 (OR 1.15). Moreover, the odds WM utilization also increased from 1997 (OR 1.00) to 2002 (OR 1.28) but decreased in 2003 (OR 1.17). Of all seasons, the odds of either CM or WM were the highest in winter.</p>\",\n \"<p>The crude utilizations of CM and WM are shown in Table ##TAB##2##3##. The number of CM users increased from 36,372 in 1997 to 41,823 in 2003. However, the number of WM users from 115,833 in 1997 to 121,605 in 2002 and decreased to 120,926 in 2003. The average number of patients who had used any CM service in one year and the number of visits to CM providers were 39,562 and 191,612, respectively. The corresponding figures for WM were 119,915 and 1,542,342. Most of the patients had one ambulatory visit a year. However, the utilization frequency of WM (mean = 12.55–13.34, median = 8–9) was higher than that of CM (mean = 4.63–5.03, median = 2–3). Most of the ambulatory CM service was provided by clinics (93.4–96.1%) and only 3.9–6.6% was provided by hospitals. Moreover, the frequency of ambulatory visits in hospitals steadily increased from 3.9% in 1997 to 6.6% in 2002. On the other hand, clinics provided about two-thirds (60.5–67.8%) of the ambulatory WM service, outpatient department of the hospitals took the remaining one-third (32.2–39.5%) of ambulatory service.</p>\",\n \"<p>Diseases of the respiratory system (CM 22.1%, WM 35.6%) and the musculoskeletal system and connective tissue (CM 18.1%, WM 7.5%) were the top two primary indications in the ambulatory health care of both CM and WM. In CM, the remaining common primary indications were injury and poisoning (16.2%), diseases of signs, symptoms and ill-defined conditions (14.2%), and diseases of the digestive system (11.4%). In WM, diseases of the genitourinary system (7.2%), diseases of the digestive system (7.2%), and diseases of sense organs (7.1%) were also common primary indications (Table ##TAB##3##4##).</p>\",\n \"<p>Herbal medication was the most important component of CM. This component accounted for more than two-thirds of the ambulatory visits (68.4–72.7%). The utilization rate decreased from 70.8% in 1997 to 68.7% in 2003. The other two major components were muscle strain therapy (including dislocation therapy) and acupuncture. Muscle strain therapy accounted for 15.6–17.5% and acupuncture for 9.2–13.0% of the ambulatory visits. These two components showed increasing utilization trends: muscle strain therapy increased from 16.4% in 1997 to 17.2% in 2003 and acupuncture from 9.4% in 1997 to 13.0% in 2003. In addition to these main components of CM, general consultation services accounted for 3.4% in 1997. However, the utilization of these consultation only services decreased to 1.1% in 2003 (Table ##TAB##4##5##).</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>In this study, the logistic regression method was used to identify patient characteristics associated with the utilization patterns of CM and WM over time. Females used both health care services more than males. The higher utilization of CM in females has also been reported in Singapore [##UREF##0##9##] and the Western countries [##UREF##2##11##,##REF##11822920##29##, ####UREF##12##30##, ##REF##10517718##31##, ##UREF##13##32####13##32##] as well as in Taiwan [##REF##9210775##12##,##REF##7920095##14##,##REF##11458756##16##,##UREF##5##19##]. In practice, CAM has been used to treat postpartum conditions, menopause, and chronic diseases among women [##REF##11458756##16##,##UREF##5##19##,##REF##11822920##29##,##UREF##13##32##, ####UREF##14##33##, ##REF##12801496##34##, ##REF##10798505##35####10798505##35##]. Moreover, the age distribution of CM utilization peaked at 45–54 years. This finding is similar to those reported previously [##UREF##2##11##,##REF##9210775##12##,##REF##11458756##16##,##UREF##5##19##,##REF##11822920##29##, ####UREF##12##30##, ##REF##10517718##31##, ##UREF##13##32####13##32##]. Since WM provides health-care services such as vaccinations for the children [##UREF##15##36##], the utilization was revealed to increase with age and peak in youngest group (2–7 years). Moreover, WM utilization was highest in the elderly people (≥ 65 years).</p>","<p>The utilization of CM was higher in the regular salary income group than the low-income group, farmers and fishermen and the other group. These results are similar to the previous findings that CAM users are those with higher education and in the middle to upper socioeconomic status [##REF##8418405##3##,##REF##9820257##4##,##UREF##16##37##,##UREF##17##38##]. WM was more frequently used by patients with severe diseases. These diseases require long-term supportive treatment and may not be suitable for CM. Although CM usage was more prevalent in the central and southern parts of Taiwan, CM was not frequently used in mountainous areas and offshore islands. One possible explanation for this phenomenon is the uneven distribution of CM providers, since there are only 6 CM hospitals and 24 CM clinics in eastern Taiwan [##UREF##3##13##].</p>","<p>In a previous study, 62.5% of the valid beneficiaries in the NHI Program have been reported to use CM at least once from 1996 to 2001 [##UREF##5##19##]. By controlling the co-variant factors, we found an increasing trend in the utilization of CM and WM. Moreover, 39,562 patients used CM services in each year whereas the corresponding figures for WM were 119,915. Most of patients had a single ambulatory visit annually. However, the mean utilization frequency of WM (12.55–13.34) was higher than that of CM (4.63–5.03). The numbers reported in this study may seem higher than those reported previously [##UREF##5##19##] because these values were based on only users, not total population. In addition, we revealed that over 90% of the CM services were provided by clinics whereas clinics only provided about two-thirds (60.5–67.8%) of the ambulatory WM services. These findings were consistent with those reported previously [##REF##8913003##15##,##UREF##5##19##,##REF##16672073##39##]. Under the NHI Program, copayments vary with the provider type. They are highest for ambulatory health care at medical centres and lowest for clinics [##REF##12757273##40##]. Moreover, the copayments in CM are lower than WM. Therefore, more than 90% of the CM users visited clinics and less than 10% CM hospitals.</p>","<p>Based on the ICD-9-CM code, we found that diseases of the respiratory system, diseases of the musculoskeletal system and connective tissue, injury and poisoning, signs, symptoms and ill-defined conditions, and diseases of the digestive system were the primary indications in CM. Similar patterns have been reported previously [##REF##9210775##12##,##REF##7920095##14##]. However, the top two primary indications were also the same as those in WM. We have also found that the utilization of these two health-care services was higher in winter than in the remaining seasons. These findings may be due to the fact that diseases of the respiratory system occurs more frequency in winter. These findings indicate that CM may be a feasible complementary choice for the patients with respiratory diseases.</p>","<p>Herbal medication is the major component of CM accounting for more than two-thirds of the ambulatory visits. In the United States, herbal products have an annual market of US$5.1 billion [##REF##11511141##41##] and 38.2 million adults have used herbs and supplements [##REF##16368456##42##]. The herbal prescriptions in the Western countries are usually with a single herb whereas the majority of prescriptions in Taiwan are composed of 3–6 herbs and are often prescribed for three times a day [##REF##15786515##17##]. Under the NHI program, herbal formulas were provided as standard pharmaceutical products in standard powder forms. This strategy not only can control the quality of the prescriptions but also enable the standardization of herbal formulas. Acupuncture is another popular form of CAM [##REF##8418405##3##, ####REF##9820257##4##, ##REF##8038643##5##, ##REF##9260354##6##, ##REF##8596318##7####8596318##7##]. It is mainly employed in the treatment of neurologic and musculoskeletal diseases [##UREF##4##18##,##UREF##18##43##,##REF##15253864##44##]. In Taiwan, about 23% of people used acupuncture from 1996 to 2002 [##UREF##4##18##]. We obtained similar results in this study. In addition to an increasing trend in the utilization of acupuncture, the prevalence of muscle strain therapy was also increased in recent years. This increase may be due to the increase in the number of providers [##UREF##3##13##]. However, further investigations are needed to confirm this suggestion.</p>","<p>This study is the first population-based investigation to determine the utilization patterns of CM and WM in Taiwan under the NHI Program. Since we obtained the data from a sufficiently large national representative sample from the NHI sample files, some of the common shortcomings in interview or questionnaire surveys may be avoided. The large sample size and the comprehensive datasets allow us to study a wide array of factors in the general population. However, we have excluded enrolees who were newborns aged below 2 years in 1997, those died in the study period, aliens, those with incomplete data, and those without continuous enrolment information. This manipulation of the data may lead to some selection bias. Since we used only the NHI claims data, we are unable to determine the utilization of CM services not covered by the NHI program. Therefore, the utilization of CM in Taiwan might be underestimated.</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>In this study, the logistic regression method was used to identify patient characteristics associated with the utilization patterns of CM and WM over time. Females used both health care services more than males. The higher utilization of CM in females has also been reported in Singapore [##UREF##0##9##] and the Western countries [##UREF##2##11##,##REF##11822920##29##, ####UREF##12##30##, ##REF##10517718##31##, ##UREF##13##32####13##32##] as well as in Taiwan [##REF##9210775##12##,##REF##7920095##14##,##REF##11458756##16##,##UREF##5##19##]. In practice, CAM has been used to treat postpartum conditions, menopause, and chronic diseases among women [##REF##11458756##16##,##UREF##5##19##,##REF##11822920##29##,##UREF##13##32##, ####UREF##14##33##, ##REF##12801496##34##, ##REF##10798505##35####10798505##35##]. Moreover, the age distribution of CM utilization peaked at 45–54 years. This finding is similar to those reported previously [##UREF##2##11##,##REF##9210775##12##,##REF##11458756##16##,##UREF##5##19##,##REF##11822920##29##, ####UREF##12##30##, ##REF##10517718##31##, ##UREF##13##32####13##32##]. Since WM provides health-care services such as vaccinations for the children [##UREF##15##36##], the utilization was revealed to increase with age and peak in youngest group (2–7 years). Moreover, WM utilization was highest in the elderly people (≥ 65 years).</p>\",\n \"<p>The utilization of CM was higher in the regular salary income group than the low-income group, farmers and fishermen and the other group. These results are similar to the previous findings that CAM users are those with higher education and in the middle to upper socioeconomic status [##REF##8418405##3##,##REF##9820257##4##,##UREF##16##37##,##UREF##17##38##]. WM was more frequently used by patients with severe diseases. These diseases require long-term supportive treatment and may not be suitable for CM. Although CM usage was more prevalent in the central and southern parts of Taiwan, CM was not frequently used in mountainous areas and offshore islands. One possible explanation for this phenomenon is the uneven distribution of CM providers, since there are only 6 CM hospitals and 24 CM clinics in eastern Taiwan [##UREF##3##13##].</p>\",\n \"<p>In a previous study, 62.5% of the valid beneficiaries in the NHI Program have been reported to use CM at least once from 1996 to 2001 [##UREF##5##19##]. By controlling the co-variant factors, we found an increasing trend in the utilization of CM and WM. Moreover, 39,562 patients used CM services in each year whereas the corresponding figures for WM were 119,915. Most of patients had a single ambulatory visit annually. However, the mean utilization frequency of WM (12.55–13.34) was higher than that of CM (4.63–5.03). The numbers reported in this study may seem higher than those reported previously [##UREF##5##19##] because these values were based on only users, not total population. In addition, we revealed that over 90% of the CM services were provided by clinics whereas clinics only provided about two-thirds (60.5–67.8%) of the ambulatory WM services. These findings were consistent with those reported previously [##REF##8913003##15##,##UREF##5##19##,##REF##16672073##39##]. Under the NHI Program, copayments vary with the provider type. They are highest for ambulatory health care at medical centres and lowest for clinics [##REF##12757273##40##]. Moreover, the copayments in CM are lower than WM. Therefore, more than 90% of the CM users visited clinics and less than 10% CM hospitals.</p>\",\n \"<p>Based on the ICD-9-CM code, we found that diseases of the respiratory system, diseases of the musculoskeletal system and connective tissue, injury and poisoning, signs, symptoms and ill-defined conditions, and diseases of the digestive system were the primary indications in CM. Similar patterns have been reported previously [##REF##9210775##12##,##REF##7920095##14##]. However, the top two primary indications were also the same as those in WM. We have also found that the utilization of these two health-care services was higher in winter than in the remaining seasons. These findings may be due to the fact that diseases of the respiratory system occurs more frequency in winter. These findings indicate that CM may be a feasible complementary choice for the patients with respiratory diseases.</p>\",\n \"<p>Herbal medication is the major component of CM accounting for more than two-thirds of the ambulatory visits. In the United States, herbal products have an annual market of US$5.1 billion [##REF##11511141##41##] and 38.2 million adults have used herbs and supplements [##REF##16368456##42##]. The herbal prescriptions in the Western countries are usually with a single herb whereas the majority of prescriptions in Taiwan are composed of 3–6 herbs and are often prescribed for three times a day [##REF##15786515##17##]. Under the NHI program, herbal formulas were provided as standard pharmaceutical products in standard powder forms. This strategy not only can control the quality of the prescriptions but also enable the standardization of herbal formulas. Acupuncture is another popular form of CAM [##REF##8418405##3##, ####REF##9820257##4##, ##REF##8038643##5##, ##REF##9260354##6##, ##REF##8596318##7####8596318##7##]. It is mainly employed in the treatment of neurologic and musculoskeletal diseases [##UREF##4##18##,##UREF##18##43##,##REF##15253864##44##]. In Taiwan, about 23% of people used acupuncture from 1996 to 2002 [##UREF##4##18##]. We obtained similar results in this study. In addition to an increasing trend in the utilization of acupuncture, the prevalence of muscle strain therapy was also increased in recent years. This increase may be due to the increase in the number of providers [##UREF##3##13##]. However, further investigations are needed to confirm this suggestion.</p>\",\n \"<p>This study is the first population-based investigation to determine the utilization patterns of CM and WM in Taiwan under the NHI Program. Since we obtained the data from a sufficiently large national representative sample from the NHI sample files, some of the common shortcomings in interview or questionnaire surveys may be avoided. The large sample size and the comprehensive datasets allow us to study a wide array of factors in the general population. However, we have excluded enrolees who were newborns aged below 2 years in 1997, those died in the study period, aliens, those with incomplete data, and those without continuous enrolment information. This manipulation of the data may lead to some selection bias. Since we used only the NHI claims data, we are unable to determine the utilization of CM services not covered by the NHI program. Therefore, the utilization of CM in Taiwan might be underestimated.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>The utilization of CAM has rapidly increased in many countries during the last two decades [##REF##9820257##4##, ####REF##8038643##5##, ##REF##9260354##6##, ##REF##8596318##7####8596318##7##]. CAM is rarely covered in national health systems. However, 75% of the Dutch population wanted hospitals to provide CAM [##UREF##19##45##] and 74% of the people in UK felt that complementary therapies should be available on the national health system [##UREF##20##46##]. In Taiwan, the NHI Program is a comprehensive and universal health insurance program. This program not only covers conventional WM services, but also traditional CM services. Moreover, CM is popular and more than 60% of all beneficiaries of this health insurance system had used CM at least once a year [##UREF##5##19##]. In this study, we found that the rate of increase in the use of CM was smaller than that in WM (Table ##TAB##1##2##) and that the increase was not apparently shown in the number of visits per user. Taiwan's experience of covering CM services under its national health insurance system may serve as an important reference to other countries. This strategy offers people another choice for medical care services with mandated coverage.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>The utilization of CAM has rapidly increased in many countries during the last two decades [##REF##9820257##4##, ####REF##8038643##5##, ##REF##9260354##6##, ##REF##8596318##7####8596318##7##]. CAM is rarely covered in national health systems. However, 75% of the Dutch population wanted hospitals to provide CAM [##UREF##19##45##] and 74% of the people in UK felt that complementary therapies should be available on the national health system [##UREF##20##46##]. In Taiwan, the NHI Program is a comprehensive and universal health insurance program. This program not only covers conventional WM services, but also traditional CM services. Moreover, CM is popular and more than 60% of all beneficiaries of this health insurance system had used CM at least once a year [##UREF##5##19##]. In this study, we found that the rate of increase in the use of CM was smaller than that in WM (Table ##TAB##1##2##) and that the increase was not apparently shown in the number of visits per user. Taiwan's experience of covering CM services under its national health insurance system may serve as an important reference to other countries. This strategy offers people another choice for medical care services with mandated coverage.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>In 1995, Taiwan has launched a national health-care system (the National Health Insurance Program, NHI) covering the use of both Western medicine (WM) and Chinese medicine (CM). This population-based study was conducted to understand the role of CM in this dual medical system by determining the utilization patterns of CM and WM and to analyze the demographic characteristics and primary indications influencing the choice of the medical services for the development of strategies to enhance the appropriate use and reduce unnecessary use of CM.</p>","<title>Methods</title>","<p>This study used the NHI sample files from 1997 to 2003 consisting of comprehensive utilization and enrolment information for a random sample of 200,432 NHI beneficiaries of the total enrolees from 1995 to 2000. A total of 136,720 subjects with valid and complete enrolment and utilization data were included in this study. The logistic regression method was employed to estimate the odds ratios (ORs) for utilization of CM and WM. The usage, frequency of services, and primary indications for CM and WM were evaluated. A significance level of α = 0.05 was selected.</p>","<title>Results</title>","<p>Compared with WM, the odds of CM increased from 1997 to 2003. The odds of using CM (OR = 1.48; 95% CI: 1.45–1.50; p < 0.001) and WM (OR = 1.74; 95% CI: 1.72–1.77; p < 0.001) were higher in females and that of CM increased with age to a peak in the 45–54-year-group (OR = 1.75; 95% CI: 1.68–1.82; p < 0.001) and WM (OR = 1.09; 95% CI: 1.05–1.13; p < 0.001) in the elderly subjects (≥ 65 years). The odds of CM and WM were similar in all income groups. However, those of CM were higher in Central (OR = 1.65; 95% CI: 1.56–1.74; p < 0.001) and Southern Taiwan (OR = 1.18; 95% CI: 1.12–1.25; p < 0.001) and lower in the remote areas (OR = 0.57; 95% CI: 0.52–0.63; p < 0.001). Most of the patients had one ambulatory visit of both medical services annually. However, the utilization of WM predominated over CM. Over 90% of CM service was provided by clinics, whereas over 60% of WM service by hospitals. Diseases of the respiratory system was the most frequent primary indication in CM and WM. Herbal medication was the most commonly used form of CM (68.4–72.7%).</p>","<title>Conclusion</title>","<p>In recent years, there is an increasing trend in the utilization of CM in Taiwan. This increasing trend may be due to the covering of CM in the national health insurance system.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>In 1995, Taiwan has launched a national health-care system (the National Health Insurance Program, NHI) covering the use of both Western medicine (WM) and Chinese medicine (CM). This population-based study was conducted to understand the role of CM in this dual medical system by determining the utilization patterns of CM and WM and to analyze the demographic characteristics and primary indications influencing the choice of the medical services for the development of strategies to enhance the appropriate use and reduce unnecessary use of CM.</p>\",\n \"<title>Methods</title>\",\n \"<p>This study used the NHI sample files from 1997 to 2003 consisting of comprehensive utilization and enrolment information for a random sample of 200,432 NHI beneficiaries of the total enrolees from 1995 to 2000. A total of 136,720 subjects with valid and complete enrolment and utilization data were included in this study. The logistic regression method was employed to estimate the odds ratios (ORs) for utilization of CM and WM. The usage, frequency of services, and primary indications for CM and WM were evaluated. A significance level of α = 0.05 was selected.</p>\",\n \"<title>Results</title>\",\n \"<p>Compared with WM, the odds of CM increased from 1997 to 2003. The odds of using CM (OR = 1.48; 95% CI: 1.45–1.50; p < 0.001) and WM (OR = 1.74; 95% CI: 1.72–1.77; p < 0.001) were higher in females and that of CM increased with age to a peak in the 45–54-year-group (OR = 1.75; 95% CI: 1.68–1.82; p < 0.001) and WM (OR = 1.09; 95% CI: 1.05–1.13; p < 0.001) in the elderly subjects (≥ 65 years). The odds of CM and WM were similar in all income groups. However, those of CM were higher in Central (OR = 1.65; 95% CI: 1.56–1.74; p < 0.001) and Southern Taiwan (OR = 1.18; 95% CI: 1.12–1.25; p < 0.001) and lower in the remote areas (OR = 0.57; 95% CI: 0.52–0.63; p < 0.001). Most of the patients had one ambulatory visit of both medical services annually. However, the utilization of WM predominated over CM. Over 90% of CM service was provided by clinics, whereas over 60% of WM service by hospitals. Diseases of the respiratory system was the most frequent primary indication in CM and WM. Herbal medication was the most commonly used form of CM (68.4–72.7%).</p>\",\n \"<title>Conclusion</title>\",\n \"<p>In recent years, there is an increasing trend in the utilization of CM in Taiwan. This increasing trend may be due to the covering of CM in the national health insurance system.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>LCC, NH, YJC, CHL and YTH contributed equally to this paper. FYK carried out the analysis. LCC, NH, YJC, CHL, FYK and HYT pictured the idea and drafted the manuscript. All authors have read and approved the final manuscript.</p>","<title>Pre-publication history</title>","<p>The pre-publication history for this paper can be accessed here:</p>","<p><ext-link ext-link-type=\"uri\" xlink:href=\"http://www.biomedcentral.com/1472-6963/8/170/prepub\"/></p>"],"string":"[\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>LCC, NH, YJC, CHL and YTH contributed equally to this paper. FYK carried out the analysis. LCC, NH, YJC, CHL, FYK and HYT pictured the idea and drafted the manuscript. All authors have read and approved the final manuscript.</p>\",\n \"<title>Pre-publication history</title>\",\n \"<p>The pre-publication history for this paper can be accessed here:</p>\",\n \"<p><ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www.biomedcentral.com/1472-6963/8/170/prepub\\\"/></p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>This study is based on the data from the National Health Insurance Research Database provided by the Bureau of National Health Insurance and managed by the National Health Research Institutes in Taiwan. The interpretations and conclusions do not represent those of Bureau of National Health Insurance or National Health Research Institutes.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>This study is based on the data from the National Health Insurance Research Database provided by the Bureau of National Health Insurance and managed by the National Health Research Institutes in Taiwan. The interpretations and conclusions do not represent those of Bureau of National Health Insurance or National Health Research Institutes.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":[],"string":"[]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Demographic characteristics of the studied cohort (<italic>n </italic>= 136,720)</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Characteristic*</td><td align=\"center\">No. of subjects</td><td align=\"center\">%</td></tr></thead><tbody><tr><td align=\"left\">Gender</td><td/><td/></tr><tr><td align=\"left\"> Male</td><td align=\"center\">68,135</td><td align=\"center\">49.8</td></tr><tr><td align=\"left\"> Female</td><td align=\"center\">68,585</td><td align=\"center\">50.2</td></tr><tr><td align=\"left\">Age (years)</td><td/><td/></tr><tr><td align=\"left\"> 2–7</td><td align=\"center\">9,648</td><td align=\"center\">7.1</td></tr><tr><td align=\"left\"> 8–14</td><td align=\"center\">11,933</td><td align=\"center\">8.7</td></tr><tr><td align=\"left\"> 15–24</td><td align=\"center\">23,244</td><td align=\"center\">17.0</td></tr><tr><td align=\"left\"> 25–34</td><td align=\"center\">26,903</td><td align=\"center\">19.7</td></tr><tr><td align=\"left\"> 35–44</td><td align=\"center\">27,307</td><td align=\"center\">20.0</td></tr><tr><td align=\"left\"> 45–54</td><td align=\"center\">17,273</td><td align=\"center\">12.6</td></tr><tr><td align=\"left\"> 55–64</td><td align=\"center\">9,986</td><td align=\"center\">7.3</td></tr><tr><td align=\"left\"> ≥ 65</td><td align=\"center\">10,426</td><td align=\"center\">7.6</td></tr><tr><td align=\"left\">Socio-economic status</td><td/><td/></tr><tr><td align=\"left\"> < US$640</td><td align=\"center\">54,729</td><td align=\"center\">40.0</td></tr><tr><td align=\"left\"> US$640-1279</td><td align=\"center\">29,788</td><td align=\"center\">21.8</td></tr><tr><td align=\"left\"> ≥ US$1280</td><td align=\"center\">11,137</td><td align=\"center\">8.1</td></tr><tr><td align=\"left\"> Farmers and fishermen</td><td align=\"center\">21,568</td><td align=\"center\">15.8</td></tr><tr><td align=\"left\"> Others</td><td align=\"center\">19,498</td><td align=\"center\">14.3</td></tr><tr><td align=\"left\">Severe disease</td><td/><td/></tr><tr><td align=\"left\"> Without</td><td align=\"center\">132,835</td><td align=\"center\">97.2</td></tr><tr><td align=\"left\"> With</td><td align=\"center\">3,885</td><td align=\"center\">2.8</td></tr><tr><td align=\"left\">Region</td><td/><td/></tr><tr><td align=\"left\"> Taipei</td><td align=\"center\">43,392</td><td align=\"center\">31.7</td></tr><tr><td align=\"left\"> Northern Taiwan</td><td align=\"center\">18,830</td><td align=\"center\">13.8</td></tr><tr><td align=\"left\"> Central Taiwan</td><td align=\"center\">26,732</td><td align=\"center\">19.6</td></tr><tr><td align=\"left\"> Southern Taiwan</td><td align=\"center\">21,241</td><td align=\"center\">15.5</td></tr><tr><td align=\"left\"> Kaohsiung and Pingtung</td><td align=\"center\">22,848</td><td align=\"center\">16.7</td></tr><tr><td align=\"left\"> East Taiwan</td><td align=\"center\">3,677</td><td align=\"center\">2.7</td></tr><tr><td align=\"left\">Remote Area</td><td/><td/></tr><tr><td align=\"left\"> Mountainous regions</td><td align=\"center\">1,159</td><td align=\"center\">0.9</td></tr><tr><td align=\"left\"> Offshore islands</td><td align=\"center\">1,156</td><td align=\"center\">0.9</td></tr><tr><td align=\"left\"> General Population</td><td align=\"center\">134,405</td><td align=\"center\">98.2</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T2\"><label>Table 2</label><caption><p>Adjusted odds ratios and 95% confidence intervals for characteristics associated with the utilization of Chinese medicine and Western medicine (<italic>n </italic>= 136,720)</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Characteristic</td><td align=\"left\">Chinese medicine</td><td align=\"left\"><italic>p </italic>value</td><td align=\"left\">Western medicine</td><td align=\"left\"><italic>p </italic>value</td></tr></thead><tbody><tr><td align=\"left\">Gender</td><td/><td/><td/><td/></tr><tr><td align=\"left\"> Male</td><td align=\"left\">1.00</td><td/><td align=\"left\">1.00</td><td/></tr><tr><td align=\"left\"> Female</td><td align=\"left\">1.48 (1.45–1.50)*</td><td align=\"left\">< 0.001</td><td align=\"left\">1.74 (1.72–1.77)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\">Age (years)</td><td/><td/><td/><td/></tr><tr><td align=\"left\"> 2–7</td><td align=\"left\">1.00</td><td/><td align=\"left\">1.00</td><td/></tr><tr><td align=\"left\"> 8–14</td><td align=\"left\">1.14 (1.10–1.18)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.50 (0.49–0.51)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> 15–24</td><td align=\"left\">1.38 (1.33–1.44)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.36 (0.36–0.37)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> 25–34</td><td align=\"left\">1.58 (1.52–1.64)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.38 (0.37–0.38)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> 35–44</td><td align=\"left\">1.74 (1.67–1.81)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.39 (0.38–0.40)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> 45–54</td><td align=\"left\">1.75 (1.68–1.82)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.45 (0.44–0.46)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> 55–64</td><td align=\"left\">1.63 (1.56–1.71)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.64 (0.63–0.66)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> ≥ 65</td><td align=\"left\">1.51 (1.44–1.58)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.09 (1.05–1.13)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\">Socioeconomic status</td><td/><td/><td/><td/></tr><tr><td align=\"left\"> ≥ US$1,280</td><td align=\"left\">1.00</td><td/><td align=\"left\">1.00</td><td/></tr><tr><td align=\"left\"> US$640-1,279</td><td align=\"left\">1.05 (1.03–1.07)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.00 (0.98–1.01)</td><td align=\"left\">0.473</td></tr><tr><td align=\"left\"> < US$640</td><td align=\"left\">1.04 (1.02–1.06)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.98 (0.96–0.99)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> Farmers and fishermen</td><td align=\"left\">0.90 (0.87–0.92)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.97 (0.95–0.99)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> Others</td><td align=\"left\">0.86 (0.84–0.88)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.77 (0.76–0.78)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\">Severe disease</td><td/><td/><td/><td/></tr><tr><td align=\"left\"> Without</td><td align=\"left\">1.00</td><td/><td align=\"left\">1.00</td><td/></tr><tr><td align=\"left\"> With</td><td align=\"left\">1.00 (0.95–1.05)</td><td align=\"left\">0.900</td><td align=\"left\">2.40 (2.29–2.52)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\">Region</td><td/><td/><td/><td/></tr><tr><td align=\"left\"> Eastern Taiwan</td><td align=\"left\">1.00</td><td/><td align=\"left\">1.00</td><td/></tr><tr><td align=\"left\"> Taipei</td><td align=\"left\">0.91 (0.86–0.96)</td><td align=\"left\">0.001</td><td align=\"left\">1.03 (0.99–1.07)</td><td align=\"left\">0.117</td></tr><tr><td align=\"left\"> Northern Taiwan</td><td align=\"left\">0.96 (0.90–1.01)</td><td align=\"left\">0.123</td><td align=\"left\">1.08 (1.04–1.13)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> Central Taiwan</td><td align=\"left\">1.65 (1.56–1.74)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.15 (1.11–1.20)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> Southern Taiwan</td><td align=\"left\">1.18 (1.12–1.25)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.20 (1.15–1.25)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> Kaohsiung and Pingtung</td><td align=\"left\">1.09 (1.03–1.16)</td><td align=\"left\">0.002</td><td align=\"left\">1.21 (1.16–1.26)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\">Remote Area</td><td/><td/><td/><td/></tr><tr><td align=\"left\"> General Population</td><td align=\"left\">1.00</td><td/><td align=\"left\">1.00</td><td/></tr><tr><td align=\"left\"> Mountainous regions</td><td align=\"left\">0.57 (0.52–0.63)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.03 (0.96–1.11)</td><td align=\"left\">0.356</td></tr><tr><td align=\"left\"> Offshore islands</td><td align=\"left\">0.78 (0.70–0.86)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.21 (1.13–1.30)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\">Season</td><td/><td/><td/><td/></tr><tr><td align=\"left\"> Winter (December – February)</td><td align=\"left\">1.00</td><td/><td align=\"left\">1.00</td><td/></tr><tr><td align=\"left\"> Spring (March – May)</td><td align=\"left\">0.95 (0.95–0.96)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.88 (0.88–0.89)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> Summer (June – August)</td><td align=\"left\">0.90 (0.89–0.90)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.79 (0.79–0.80)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> Autumn (September – November)</td><td align=\"left\">0.93 (0.93–0.94)</td><td align=\"left\">< 0.001</td><td align=\"left\">0.86 (0.85–0.86)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\">Year</td><td/><td/><td/><td/></tr><tr><td align=\"left\"> 1997</td><td align=\"left\">1.00</td><td/><td align=\"left\">1.00</td><td/></tr><tr><td align=\"left\"> 1998</td><td align=\"left\">1.05 (1.03–1.06)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.10 (1.10–1.11)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> 1999</td><td align=\"left\">1.10 (1.09–1.12)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.21 (1.20–1.22)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> 2000</td><td align=\"left\">1.10 (1.09–1.11)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.26 (1.25–1.27)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> 2001</td><td align=\"left\">1.11 (1.09–1.12)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.27 (1.26–1.28)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> 2002</td><td align=\"left\">1.12 (1.10–1.13)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.28 (1.26–1.29)</td><td align=\"left\">< 0.001</td></tr><tr><td align=\"left\"> 2003</td><td align=\"left\">1.15 (1.14–1.17)</td><td align=\"left\">< 0.001</td><td align=\"left\">1.17 (1.16–1.19)</td><td align=\"left\">< 0.001</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T3\"><label>Table 3</label><caption><p>Crude utilizations of Chinese and Western medicine under the NHI program, 1997–2003 (total population = 136,720)</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td/><td/><td align=\"center\" colspan=\"3\">Frequency of utilization</td><td align=\"center\" colspan=\"2\">Provider</td></tr><tr><td/><td/><td/><td colspan=\"3\"><hr/></td><td colspan=\"2\"><hr/></td></tr><tr><td align=\"center\">Year</td><td align=\"center\">No. of users</td><td align=\"center\">No. of visits</td><td align=\"center\">Mean ± SD</td><td align=\"center\">Median</td><td align=\"center\">Mode</td><td align=\"center\">Hospital (%)</td><td align=\"center\">Clinic (%)</td></tr></thead><tbody><tr><td align=\"center\" colspan=\"8\">Chinese medicine</td></tr><tr><td align=\"center\">1997</td><td align=\"center\">36,372</td><td align=\"center\">181,109</td><td align=\"center\">4.98 ± 6.59</td><td align=\"center\">3</td><td align=\"center\">1</td><td align=\"center\">7,060 (3.9)</td><td align=\"center\">174,049 (96.1)</td></tr><tr><td align=\"center\">1998</td><td align=\"center\">37,622</td><td align=\"center\">189,330</td><td align=\"center\">5.03 ± 6.60</td><td align=\"center\">3</td><td align=\"center\">1</td><td align=\"center\">7,709 (4.1)</td><td align=\"center\">181,621 (95.9)</td></tr><tr><td align=\"center\">1999</td><td align=\"center\">39,635</td><td align=\"center\">196,908</td><td align=\"center\">4.97 ± 6.36</td><td align=\"center\">3</td><td align=\"center\">1</td><td align=\"center\">9,461 (4.8)</td><td align=\"center\">187,447 (95.2)</td></tr><tr><td align=\"center\">2000</td><td align=\"center\">40,227</td><td align=\"center\">188,713</td><td align=\"center\">4.69 ± 5.81</td><td align=\"center\">2</td><td align=\"center\">1</td><td align=\"center\">10,330 (5.5)</td><td align=\"center\">178,383 (94.5)</td></tr><tr><td align=\"center\">2001</td><td align=\"center\">40,425</td><td align=\"center\">187,198</td><td align=\"center\">4.63 ± 5.73</td><td align=\"center\">3</td><td align=\"center\">1</td><td align=\"center\">10,865 (5.8)</td><td align=\"center\">176,333 (94.2)</td></tr><tr><td align=\"center\">2002</td><td align=\"center\">40,833</td><td align=\"center\">191,251</td><td align=\"center\">4.68 ± 5.82</td><td align=\"center\">3</td><td align=\"center\">1</td><td align=\"center\">12,617 (6.6)</td><td align=\"center\">178,634 (93.4)</td></tr><tr><td align=\"center\">2003</td><td align=\"center\">41,823</td><td align=\"center\">206,777</td><td align=\"center\">4.94 ± 6.45</td><td align=\"center\">3</td><td align=\"center\">1</td><td align=\"center\">11,497 (5.6)</td><td align=\"center\">195,280 (94.4)</td></tr><tr><td align=\"center\" colspan=\"8\">Western medicine</td></tr><tr><td align=\"center\">1997</td><td align=\"center\">115,833</td><td align=\"center\">1,486,570</td><td align=\"center\">12.83 ± 13.82</td><td align=\"center\">8</td><td align=\"center\">1</td><td align=\"center\">478,493 (32.2)</td><td align=\"center\">1,008,077 (67.8)</td></tr><tr><td align=\"center\">1998</td><td align=\"center\">118,504</td><td align=\"center\">1,553,383</td><td align=\"center\">13.11 ± 14.07</td><td align=\"center\">9</td><td align=\"center\">1</td><td align=\"center\">509,743 (32.8)</td><td align=\"center\">1,043,640 (67.2)</td></tr><tr><td align=\"center\">1999</td><td align=\"center\">120,362</td><td align=\"center\">1,606,111</td><td align=\"center\">13.34 ± 13.85</td><td align=\"center\">9</td><td align=\"center\">1</td><td align=\"center\">549,420 (34.2)</td><td align=\"center\">1,056,691 (65.8)</td></tr><tr><td align=\"center\">2000</td><td align=\"center\">120,982</td><td align=\"center\">1,552,771</td><td align=\"center\">12.83 ± 12.92</td><td align=\"center\">9</td><td align=\"center\">1</td><td align=\"center\">554,656 (35.7)</td><td align=\"center\">998,115 (64.3)</td></tr><tr><td align=\"center\">2001</td><td align=\"center\">121,190</td><td align=\"center\">1,533,878</td><td align=\"center\">12.66 ± 12.97</td><td align=\"center\">9</td><td align=\"center\">1</td><td align=\"center\">583,055 (38.0)</td><td align=\"center\">950,823 (62.0)</td></tr><tr><td align=\"center\">2002</td><td align=\"center\">121,605</td><td align=\"center\">1,545,956</td><td align=\"center\">12.71 ± 13.23</td><td align=\"center\">9</td><td align=\"center\">1</td><td align=\"center\">610,399 (39.5)</td><td align=\"center\">935,557 (60.5)</td></tr><tr><td align=\"center\">2003</td><td align=\"center\">120,926</td><td align=\"center\">1,517,722</td><td align=\"center\">12.55 ± 13.69</td><td align=\"center\">8</td><td align=\"center\">1</td><td align=\"center\">568,128 (37.4)</td><td align=\"center\">949,594 (62.6)</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T4\"><label>Table 4</label><caption><p>Primary indications in ambulatory visits of Chinese and Western medicine under the National Health Insurance Program in Taiwan from 1997 to 2003</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><break/>Primary indication (ICD-9-CM code)</td><td align=\"center\">Chinese medicine <break/>(<italic>n</italic>=1,341,286)</td><td align=\"center\">Western medicine<break/>(<italic>n</italic>=10,796,391)</td></tr></thead><tbody><tr><td align=\"left\">1 Infectious and parasitic diseases</td><td align=\"center\">0.5*</td><td align=\"center\">2.3</td></tr><tr><td align=\"left\">2 Malignant neoplasms</td><td align=\"center\">0.2</td><td align=\"center\">0.7</td></tr><tr><td align=\"left\">3 Other neoplasms</td><td align=\"center\">0.1</td><td align=\"center\">0.7</td></tr><tr><td align=\"left\">4 Endocrine, nutritional and metabolic diseases and immunity disorders</td><td align=\"center\">1.3</td><td align=\"center\">3.8</td></tr><tr><td align=\"left\">5 Mental disorders</td><td align=\"center\">0.6</td><td align=\"center\">2.0</td></tr><tr><td align=\"left\">6 Diseases of the nervous system</td><td align=\"center\">1.6</td><td align=\"center\">1.3</td></tr><tr><td align=\"left\">7 Diseases of the sense organs</td><td align=\"center\">1.2</td><td align=\"center\">7.1</td></tr><tr><td align=\"left\">8 Diseases of the circulatory system</td><td align=\"center\">1.8</td><td align=\"center\">6.3</td></tr><tr><td align=\"left\">9 Diseases of the respiratory system</td><td align=\"center\">22.1</td><td align=\"center\">35.6</td></tr><tr><td align=\"left\">10 Diseases of the digestive system</td><td align=\"center\">11.4</td><td align=\"center\">7.2</td></tr><tr><td align=\"left\">11 Diseases of the genitourinary system</td><td align=\"center\">7.2</td><td align=\"center\">7.2</td></tr><tr><td align=\"left\">12 Complications of pregnancy, childbirth and the puerperium</td><td align=\"center\">0.1</td><td align=\"center\">0.4</td></tr><tr><td align=\"left\">13 Diseases of skin and subcutaneous tissue</td><td align=\"center\">3.1</td><td align=\"center\">6.2</td></tr><tr><td align=\"left\">14 Diseases of the musculoskeletal system and connective tissue</td><td align=\"center\">18.1</td><td align=\"center\">7.5</td></tr><tr><td align=\"left\">15 Congenital anomalies</td><td align=\"center\">0.1</td><td align=\"center\">0.1</td></tr><tr><td align=\"left\">16 Certain conditions originating in the perinatal period</td><td align=\"center\">0.0</td><td align=\"center\">0.0</td></tr><tr><td align=\"left\">17 Signs, symptoms and ill-defined conditions</td><td align=\"center\">14.2</td><td align=\"center\">3.7</td></tr><tr><td align=\"left\">18 Injury and poisoning</td><td align=\"center\">16.2</td><td align=\"center\">4.5</td></tr><tr><td align=\"left\">19 Accidents and self inflicted injury</td><td align=\"center\">0.0</td><td align=\"center\">0.1</td></tr><tr><td align=\"left\">20 Other reasons for contact with health services</td><td align=\"center\">0.2</td><td align=\"center\">3.3</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T5\"><label>Table 5</label><caption><p>Percentage distribution of ambulatory visits for different components of Chinese medicine under the National Health Insurance Program in Taiwan from 1997 to 2003</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\" colspan=\"7\">Year</td></tr><tr><td/><td colspan=\"7\"><hr/></td></tr><tr><td align=\"left\">Component*</td><td align=\"center\">1997</td><td align=\"center\">1998</td><td align=\"center\">1999</td><td align=\"center\">2000</td><td align=\"center\">2001</td><td align=\"center\">2002</td><td align=\"center\">2003</td></tr></thead><tbody><tr><td align=\"left\">Herbal medication</td><td align=\"center\">70.8</td><td align=\"center\">72.7</td><td align=\"center\">71.8</td><td align=\"center\">70.5</td><td align=\"center\">69.3</td><td align=\"center\">68.4</td><td align=\"center\">68.7</td></tr><tr><td align=\"left\">Muscle strain therapy (Including dislocation therapy)</td><td align=\"center\">16.4</td><td align=\"center\">15.6</td><td align=\"center\">15.6</td><td align=\"center\">16.0</td><td align=\"center\">16.6</td><td align=\"center\">17.5</td><td align=\"center\">17.2</td></tr><tr><td align=\"left\">Acupuncture</td><td align=\"center\">9.4</td><td align=\"center\">9.2</td><td align=\"center\">10.0</td><td align=\"center\">11.5</td><td align=\"center\">12.1</td><td align=\"center\">12.9</td><td align=\"center\">13.0</td></tr><tr><td align=\"left\">Consultation only and others</td><td align=\"center\">3.4</td><td align=\"center\">2.5</td><td align=\"center\">2.6</td><td align=\"center\">2.0</td><td align=\"center\">2.0</td><td align=\"center\">1.2</td><td align=\"center\">1.1</td></tr><tr><td colspan=\"8\"><hr/></td></tr><tr><td align=\"left\">Total</td><td align=\"center\">179,464</td><td align=\"center\">205,637</td><td align=\"center\">221,440</td><td align=\"center\">206,108</td><td align=\"center\">208,487</td><td align=\"center\">210,720</td><td align=\"center\">225,705</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Demographic characteristics of the studied cohort (<italic>n </italic>= 136,720)</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\">Characteristic*</td><td align=\\\"center\\\">No. of subjects</td><td align=\\\"center\\\">%</td></tr></thead><tbody><tr><td align=\\\"left\\\">Gender</td><td/><td/></tr><tr><td align=\\\"left\\\"> Male</td><td align=\\\"center\\\">68,135</td><td align=\\\"center\\\">49.8</td></tr><tr><td align=\\\"left\\\"> Female</td><td align=\\\"center\\\">68,585</td><td align=\\\"center\\\">50.2</td></tr><tr><td align=\\\"left\\\">Age (years)</td><td/><td/></tr><tr><td align=\\\"left\\\"> 2–7</td><td align=\\\"center\\\">9,648</td><td align=\\\"center\\\">7.1</td></tr><tr><td align=\\\"left\\\"> 8–14</td><td align=\\\"center\\\">11,933</td><td align=\\\"center\\\">8.7</td></tr><tr><td align=\\\"left\\\"> 15–24</td><td align=\\\"center\\\">23,244</td><td align=\\\"center\\\">17.0</td></tr><tr><td align=\\\"left\\\"> 25–34</td><td align=\\\"center\\\">26,903</td><td align=\\\"center\\\">19.7</td></tr><tr><td align=\\\"left\\\"> 35–44</td><td align=\\\"center\\\">27,307</td><td align=\\\"center\\\">20.0</td></tr><tr><td align=\\\"left\\\"> 45–54</td><td align=\\\"center\\\">17,273</td><td align=\\\"center\\\">12.6</td></tr><tr><td align=\\\"left\\\"> 55–64</td><td align=\\\"center\\\">9,986</td><td align=\\\"center\\\">7.3</td></tr><tr><td align=\\\"left\\\"> ≥ 65</td><td align=\\\"center\\\">10,426</td><td align=\\\"center\\\">7.6</td></tr><tr><td align=\\\"left\\\">Socio-economic status</td><td/><td/></tr><tr><td align=\\\"left\\\"> < US$640</td><td align=\\\"center\\\">54,729</td><td align=\\\"center\\\">40.0</td></tr><tr><td align=\\\"left\\\"> US$640-1279</td><td align=\\\"center\\\">29,788</td><td align=\\\"center\\\">21.8</td></tr><tr><td align=\\\"left\\\"> ≥ US$1280</td><td align=\\\"center\\\">11,137</td><td align=\\\"center\\\">8.1</td></tr><tr><td align=\\\"left\\\"> Farmers and fishermen</td><td align=\\\"center\\\">21,568</td><td align=\\\"center\\\">15.8</td></tr><tr><td align=\\\"left\\\"> Others</td><td align=\\\"center\\\">19,498</td><td align=\\\"center\\\">14.3</td></tr><tr><td align=\\\"left\\\">Severe disease</td><td/><td/></tr><tr><td align=\\\"left\\\"> Without</td><td align=\\\"center\\\">132,835</td><td align=\\\"center\\\">97.2</td></tr><tr><td align=\\\"left\\\"> With</td><td align=\\\"center\\\">3,885</td><td align=\\\"center\\\">2.8</td></tr><tr><td align=\\\"left\\\">Region</td><td/><td/></tr><tr><td align=\\\"left\\\"> Taipei</td><td align=\\\"center\\\">43,392</td><td align=\\\"center\\\">31.7</td></tr><tr><td align=\\\"left\\\"> Northern Taiwan</td><td align=\\\"center\\\">18,830</td><td align=\\\"center\\\">13.8</td></tr><tr><td align=\\\"left\\\"> Central Taiwan</td><td align=\\\"center\\\">26,732</td><td align=\\\"center\\\">19.6</td></tr><tr><td align=\\\"left\\\"> Southern Taiwan</td><td align=\\\"center\\\">21,241</td><td align=\\\"center\\\">15.5</td></tr><tr><td align=\\\"left\\\"> Kaohsiung and Pingtung</td><td align=\\\"center\\\">22,848</td><td align=\\\"center\\\">16.7</td></tr><tr><td align=\\\"left\\\"> East Taiwan</td><td align=\\\"center\\\">3,677</td><td align=\\\"center\\\">2.7</td></tr><tr><td align=\\\"left\\\">Remote Area</td><td/><td/></tr><tr><td align=\\\"left\\\"> Mountainous regions</td><td align=\\\"center\\\">1,159</td><td align=\\\"center\\\">0.9</td></tr><tr><td align=\\\"left\\\"> Offshore islands</td><td align=\\\"center\\\">1,156</td><td align=\\\"center\\\">0.9</td></tr><tr><td align=\\\"left\\\"> General Population</td><td align=\\\"center\\\">134,405</td><td align=\\\"center\\\">98.2</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T2\\\"><label>Table 2</label><caption><p>Adjusted odds ratios and 95% confidence intervals for characteristics associated with the utilization of Chinese medicine and Western medicine (<italic>n </italic>= 136,720)</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\">Characteristic</td><td align=\\\"left\\\">Chinese medicine</td><td align=\\\"left\\\"><italic>p </italic>value</td><td align=\\\"left\\\">Western medicine</td><td align=\\\"left\\\"><italic>p </italic>value</td></tr></thead><tbody><tr><td align=\\\"left\\\">Gender</td><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\"> Male</td><td align=\\\"left\\\">1.00</td><td/><td align=\\\"left\\\">1.00</td><td/></tr><tr><td align=\\\"left\\\"> Female</td><td align=\\\"left\\\">1.48 (1.45–1.50)*</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.74 (1.72–1.77)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\">Age (years)</td><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\"> 2–7</td><td align=\\\"left\\\">1.00</td><td/><td align=\\\"left\\\">1.00</td><td/></tr><tr><td align=\\\"left\\\"> 8–14</td><td align=\\\"left\\\">1.14 (1.10–1.18)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.50 (0.49–0.51)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> 15–24</td><td align=\\\"left\\\">1.38 (1.33–1.44)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.36 (0.36–0.37)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> 25–34</td><td align=\\\"left\\\">1.58 (1.52–1.64)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.38 (0.37–0.38)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> 35–44</td><td align=\\\"left\\\">1.74 (1.67–1.81)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.39 (0.38–0.40)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> 45–54</td><td align=\\\"left\\\">1.75 (1.68–1.82)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.45 (0.44–0.46)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> 55–64</td><td align=\\\"left\\\">1.63 (1.56–1.71)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.64 (0.63–0.66)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> ≥ 65</td><td align=\\\"left\\\">1.51 (1.44–1.58)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.09 (1.05–1.13)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\">Socioeconomic status</td><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\"> ≥ US$1,280</td><td align=\\\"left\\\">1.00</td><td/><td align=\\\"left\\\">1.00</td><td/></tr><tr><td align=\\\"left\\\"> US$640-1,279</td><td align=\\\"left\\\">1.05 (1.03–1.07)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.00 (0.98–1.01)</td><td align=\\\"left\\\">0.473</td></tr><tr><td align=\\\"left\\\"> < US$640</td><td align=\\\"left\\\">1.04 (1.02–1.06)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.98 (0.96–0.99)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> Farmers and fishermen</td><td align=\\\"left\\\">0.90 (0.87–0.92)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.97 (0.95–0.99)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> Others</td><td align=\\\"left\\\">0.86 (0.84–0.88)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.77 (0.76–0.78)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\">Severe disease</td><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\"> Without</td><td align=\\\"left\\\">1.00</td><td/><td align=\\\"left\\\">1.00</td><td/></tr><tr><td align=\\\"left\\\"> With</td><td align=\\\"left\\\">1.00 (0.95–1.05)</td><td align=\\\"left\\\">0.900</td><td align=\\\"left\\\">2.40 (2.29–2.52)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\">Region</td><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\"> Eastern Taiwan</td><td align=\\\"left\\\">1.00</td><td/><td align=\\\"left\\\">1.00</td><td/></tr><tr><td align=\\\"left\\\"> Taipei</td><td align=\\\"left\\\">0.91 (0.86–0.96)</td><td align=\\\"left\\\">0.001</td><td align=\\\"left\\\">1.03 (0.99–1.07)</td><td align=\\\"left\\\">0.117</td></tr><tr><td align=\\\"left\\\"> Northern Taiwan</td><td align=\\\"left\\\">0.96 (0.90–1.01)</td><td align=\\\"left\\\">0.123</td><td align=\\\"left\\\">1.08 (1.04–1.13)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> Central Taiwan</td><td align=\\\"left\\\">1.65 (1.56–1.74)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.15 (1.11–1.20)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> Southern Taiwan</td><td align=\\\"left\\\">1.18 (1.12–1.25)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.20 (1.15–1.25)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> Kaohsiung and Pingtung</td><td align=\\\"left\\\">1.09 (1.03–1.16)</td><td align=\\\"left\\\">0.002</td><td align=\\\"left\\\">1.21 (1.16–1.26)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\">Remote Area</td><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\"> General Population</td><td align=\\\"left\\\">1.00</td><td/><td align=\\\"left\\\">1.00</td><td/></tr><tr><td align=\\\"left\\\"> Mountainous regions</td><td align=\\\"left\\\">0.57 (0.52–0.63)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.03 (0.96–1.11)</td><td align=\\\"left\\\">0.356</td></tr><tr><td align=\\\"left\\\"> Offshore islands</td><td align=\\\"left\\\">0.78 (0.70–0.86)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.21 (1.13–1.30)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\">Season</td><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\"> Winter (December – February)</td><td align=\\\"left\\\">1.00</td><td/><td align=\\\"left\\\">1.00</td><td/></tr><tr><td align=\\\"left\\\"> Spring (March – May)</td><td align=\\\"left\\\">0.95 (0.95–0.96)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.88 (0.88–0.89)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> Summer (June – August)</td><td align=\\\"left\\\">0.90 (0.89–0.90)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.79 (0.79–0.80)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> Autumn (September – November)</td><td align=\\\"left\\\">0.93 (0.93–0.94)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.86 (0.85–0.86)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\">Year</td><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\"> 1997</td><td align=\\\"left\\\">1.00</td><td/><td align=\\\"left\\\">1.00</td><td/></tr><tr><td align=\\\"left\\\"> 1998</td><td align=\\\"left\\\">1.05 (1.03–1.06)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.10 (1.10–1.11)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> 1999</td><td align=\\\"left\\\">1.10 (1.09–1.12)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.21 (1.20–1.22)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> 2000</td><td align=\\\"left\\\">1.10 (1.09–1.11)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.26 (1.25–1.27)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> 2001</td><td align=\\\"left\\\">1.11 (1.09–1.12)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.27 (1.26–1.28)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> 2002</td><td align=\\\"left\\\">1.12 (1.10–1.13)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.28 (1.26–1.29)</td><td align=\\\"left\\\">< 0.001</td></tr><tr><td align=\\\"left\\\"> 2003</td><td align=\\\"left\\\">1.15 (1.14–1.17)</td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.17 (1.16–1.19)</td><td align=\\\"left\\\">< 0.001</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T3\\\"><label>Table 3</label><caption><p>Crude utilizations of Chinese and Western medicine under the NHI program, 1997–2003 (total population = 136,720)</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td/><td/><td/><td align=\\\"center\\\" colspan=\\\"3\\\">Frequency of utilization</td><td align=\\\"center\\\" colspan=\\\"2\\\">Provider</td></tr><tr><td/><td/><td/><td colspan=\\\"3\\\"><hr/></td><td colspan=\\\"2\\\"><hr/></td></tr><tr><td align=\\\"center\\\">Year</td><td align=\\\"center\\\">No. of users</td><td align=\\\"center\\\">No. of visits</td><td align=\\\"center\\\">Mean ± SD</td><td align=\\\"center\\\">Median</td><td align=\\\"center\\\">Mode</td><td align=\\\"center\\\">Hospital (%)</td><td align=\\\"center\\\">Clinic (%)</td></tr></thead><tbody><tr><td align=\\\"center\\\" colspan=\\\"8\\\">Chinese medicine</td></tr><tr><td align=\\\"center\\\">1997</td><td align=\\\"center\\\">36,372</td><td align=\\\"center\\\">181,109</td><td align=\\\"center\\\">4.98 ± 6.59</td><td align=\\\"center\\\">3</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">7,060 (3.9)</td><td align=\\\"center\\\">174,049 (96.1)</td></tr><tr><td align=\\\"center\\\">1998</td><td align=\\\"center\\\">37,622</td><td align=\\\"center\\\">189,330</td><td align=\\\"center\\\">5.03 ± 6.60</td><td align=\\\"center\\\">3</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">7,709 (4.1)</td><td align=\\\"center\\\">181,621 (95.9)</td></tr><tr><td align=\\\"center\\\">1999</td><td align=\\\"center\\\">39,635</td><td align=\\\"center\\\">196,908</td><td align=\\\"center\\\">4.97 ± 6.36</td><td align=\\\"center\\\">3</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">9,461 (4.8)</td><td align=\\\"center\\\">187,447 (95.2)</td></tr><tr><td align=\\\"center\\\">2000</td><td align=\\\"center\\\">40,227</td><td align=\\\"center\\\">188,713</td><td align=\\\"center\\\">4.69 ± 5.81</td><td align=\\\"center\\\">2</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">10,330 (5.5)</td><td align=\\\"center\\\">178,383 (94.5)</td></tr><tr><td align=\\\"center\\\">2001</td><td align=\\\"center\\\">40,425</td><td align=\\\"center\\\">187,198</td><td align=\\\"center\\\">4.63 ± 5.73</td><td align=\\\"center\\\">3</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">10,865 (5.8)</td><td align=\\\"center\\\">176,333 (94.2)</td></tr><tr><td align=\\\"center\\\">2002</td><td align=\\\"center\\\">40,833</td><td align=\\\"center\\\">191,251</td><td align=\\\"center\\\">4.68 ± 5.82</td><td align=\\\"center\\\">3</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">12,617 (6.6)</td><td align=\\\"center\\\">178,634 (93.4)</td></tr><tr><td align=\\\"center\\\">2003</td><td align=\\\"center\\\">41,823</td><td align=\\\"center\\\">206,777</td><td align=\\\"center\\\">4.94 ± 6.45</td><td align=\\\"center\\\">3</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">11,497 (5.6)</td><td align=\\\"center\\\">195,280 (94.4)</td></tr><tr><td align=\\\"center\\\" colspan=\\\"8\\\">Western medicine</td></tr><tr><td align=\\\"center\\\">1997</td><td align=\\\"center\\\">115,833</td><td align=\\\"center\\\">1,486,570</td><td align=\\\"center\\\">12.83 ± 13.82</td><td align=\\\"center\\\">8</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">478,493 (32.2)</td><td align=\\\"center\\\">1,008,077 (67.8)</td></tr><tr><td align=\\\"center\\\">1998</td><td align=\\\"center\\\">118,504</td><td align=\\\"center\\\">1,553,383</td><td align=\\\"center\\\">13.11 ± 14.07</td><td align=\\\"center\\\">9</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">509,743 (32.8)</td><td align=\\\"center\\\">1,043,640 (67.2)</td></tr><tr><td align=\\\"center\\\">1999</td><td align=\\\"center\\\">120,362</td><td align=\\\"center\\\">1,606,111</td><td align=\\\"center\\\">13.34 ± 13.85</td><td align=\\\"center\\\">9</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">549,420 (34.2)</td><td align=\\\"center\\\">1,056,691 (65.8)</td></tr><tr><td align=\\\"center\\\">2000</td><td align=\\\"center\\\">120,982</td><td align=\\\"center\\\">1,552,771</td><td align=\\\"center\\\">12.83 ± 12.92</td><td align=\\\"center\\\">9</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">554,656 (35.7)</td><td align=\\\"center\\\">998,115 (64.3)</td></tr><tr><td align=\\\"center\\\">2001</td><td align=\\\"center\\\">121,190</td><td align=\\\"center\\\">1,533,878</td><td align=\\\"center\\\">12.66 ± 12.97</td><td align=\\\"center\\\">9</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">583,055 (38.0)</td><td align=\\\"center\\\">950,823 (62.0)</td></tr><tr><td align=\\\"center\\\">2002</td><td align=\\\"center\\\">121,605</td><td align=\\\"center\\\">1,545,956</td><td align=\\\"center\\\">12.71 ± 13.23</td><td align=\\\"center\\\">9</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">610,399 (39.5)</td><td align=\\\"center\\\">935,557 (60.5)</td></tr><tr><td align=\\\"center\\\">2003</td><td align=\\\"center\\\">120,926</td><td align=\\\"center\\\">1,517,722</td><td align=\\\"center\\\">12.55 ± 13.69</td><td align=\\\"center\\\">8</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">568,128 (37.4)</td><td align=\\\"center\\\">949,594 (62.6)</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T4\\\"><label>Table 4</label><caption><p>Primary indications in ambulatory visits of Chinese and Western medicine under the National Health Insurance Program in Taiwan from 1997 to 2003</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\"><break/>Primary indication (ICD-9-CM code)</td><td align=\\\"center\\\">Chinese medicine <break/>(<italic>n</italic>=1,341,286)</td><td align=\\\"center\\\">Western medicine<break/>(<italic>n</italic>=10,796,391)</td></tr></thead><tbody><tr><td align=\\\"left\\\">1 Infectious and parasitic diseases</td><td align=\\\"center\\\">0.5*</td><td align=\\\"center\\\">2.3</td></tr><tr><td align=\\\"left\\\">2 Malignant neoplasms</td><td align=\\\"center\\\">0.2</td><td align=\\\"center\\\">0.7</td></tr><tr><td align=\\\"left\\\">3 Other neoplasms</td><td align=\\\"center\\\">0.1</td><td align=\\\"center\\\">0.7</td></tr><tr><td align=\\\"left\\\">4 Endocrine, nutritional and metabolic diseases and immunity disorders</td><td align=\\\"center\\\">1.3</td><td align=\\\"center\\\">3.8</td></tr><tr><td align=\\\"left\\\">5 Mental disorders</td><td align=\\\"center\\\">0.6</td><td align=\\\"center\\\">2.0</td></tr><tr><td align=\\\"left\\\">6 Diseases of the nervous system</td><td align=\\\"center\\\">1.6</td><td align=\\\"center\\\">1.3</td></tr><tr><td align=\\\"left\\\">7 Diseases of the sense organs</td><td align=\\\"center\\\">1.2</td><td align=\\\"center\\\">7.1</td></tr><tr><td align=\\\"left\\\">8 Diseases of the circulatory system</td><td align=\\\"center\\\">1.8</td><td align=\\\"center\\\">6.3</td></tr><tr><td align=\\\"left\\\">9 Diseases of the respiratory system</td><td align=\\\"center\\\">22.1</td><td align=\\\"center\\\">35.6</td></tr><tr><td align=\\\"left\\\">10 Diseases of the digestive system</td><td align=\\\"center\\\">11.4</td><td align=\\\"center\\\">7.2</td></tr><tr><td align=\\\"left\\\">11 Diseases of the genitourinary system</td><td align=\\\"center\\\">7.2</td><td align=\\\"center\\\">7.2</td></tr><tr><td align=\\\"left\\\">12 Complications of pregnancy, childbirth and the puerperium</td><td align=\\\"center\\\">0.1</td><td align=\\\"center\\\">0.4</td></tr><tr><td align=\\\"left\\\">13 Diseases of skin and subcutaneous tissue</td><td align=\\\"center\\\">3.1</td><td align=\\\"center\\\">6.2</td></tr><tr><td align=\\\"left\\\">14 Diseases of the musculoskeletal system and connective tissue</td><td align=\\\"center\\\">18.1</td><td align=\\\"center\\\">7.5</td></tr><tr><td align=\\\"left\\\">15 Congenital anomalies</td><td align=\\\"center\\\">0.1</td><td align=\\\"center\\\">0.1</td></tr><tr><td align=\\\"left\\\">16 Certain conditions originating in the perinatal period</td><td align=\\\"center\\\">0.0</td><td align=\\\"center\\\">0.0</td></tr><tr><td align=\\\"left\\\">17 Signs, symptoms and ill-defined conditions</td><td align=\\\"center\\\">14.2</td><td align=\\\"center\\\">3.7</td></tr><tr><td align=\\\"left\\\">18 Injury and poisoning</td><td align=\\\"center\\\">16.2</td><td align=\\\"center\\\">4.5</td></tr><tr><td align=\\\"left\\\">19 Accidents and self inflicted injury</td><td align=\\\"center\\\">0.0</td><td align=\\\"center\\\">0.1</td></tr><tr><td align=\\\"left\\\">20 Other reasons for contact with health services</td><td align=\\\"center\\\">0.2</td><td align=\\\"center\\\">3.3</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T5\\\"><label>Table 5</label><caption><p>Percentage distribution of ambulatory visits for different components of Chinese medicine under the National Health Insurance Program in Taiwan from 1997 to 2003</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td/><td align=\\\"center\\\" colspan=\\\"7\\\">Year</td></tr><tr><td/><td colspan=\\\"7\\\"><hr/></td></tr><tr><td align=\\\"left\\\">Component*</td><td align=\\\"center\\\">1997</td><td align=\\\"center\\\">1998</td><td align=\\\"center\\\">1999</td><td align=\\\"center\\\">2000</td><td align=\\\"center\\\">2001</td><td align=\\\"center\\\">2002</td><td align=\\\"center\\\">2003</td></tr></thead><tbody><tr><td align=\\\"left\\\">Herbal medication</td><td align=\\\"center\\\">70.8</td><td align=\\\"center\\\">72.7</td><td align=\\\"center\\\">71.8</td><td align=\\\"center\\\">70.5</td><td align=\\\"center\\\">69.3</td><td align=\\\"center\\\">68.4</td><td align=\\\"center\\\">68.7</td></tr><tr><td align=\\\"left\\\">Muscle strain therapy (Including dislocation therapy)</td><td align=\\\"center\\\">16.4</td><td align=\\\"center\\\">15.6</td><td align=\\\"center\\\">15.6</td><td align=\\\"center\\\">16.0</td><td align=\\\"center\\\">16.6</td><td align=\\\"center\\\">17.5</td><td align=\\\"center\\\">17.2</td></tr><tr><td align=\\\"left\\\">Acupuncture</td><td align=\\\"center\\\">9.4</td><td align=\\\"center\\\">9.2</td><td align=\\\"center\\\">10.0</td><td align=\\\"center\\\">11.5</td><td align=\\\"center\\\">12.1</td><td align=\\\"center\\\">12.9</td><td align=\\\"center\\\">13.0</td></tr><tr><td align=\\\"left\\\">Consultation only and others</td><td align=\\\"center\\\">3.4</td><td align=\\\"center\\\">2.5</td><td align=\\\"center\\\">2.6</td><td align=\\\"center\\\">2.0</td><td align=\\\"center\\\">2.0</td><td align=\\\"center\\\">1.2</td><td align=\\\"center\\\">1.1</td></tr><tr><td colspan=\\\"8\\\"><hr/></td></tr><tr><td align=\\\"left\\\">Total</td><td align=\\\"center\\\">179,464</td><td align=\\\"center\\\">205,637</td><td align=\\\"center\\\">221,440</td><td align=\\\"center\\\">206,108</td><td align=\\\"center\\\">208,487</td><td align=\\\"center\\\">210,720</td><td align=\\\"center\\\">225,705</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":["<table-wrap-foot><p>*Determined from 1997 prospectively.</p></table-wrap-foot>","<table-wrap-foot><p>*Odds ratio (95% confidence interval).</p></table-wrap-foot>","<table-wrap-foot><p>*%.</p></table-wrap-foot>","<table-wrap-foot><p>*More than one component may be provided in each visit.</p></table-wrap-foot>"],"string":"[\n \"<table-wrap-foot><p>*Determined from 1997 prospectively.</p></table-wrap-foot>\",\n \"<table-wrap-foot><p>*Odds ratio (95% confidence interval).</p></table-wrap-foot>\",\n \"<table-wrap-foot><p>*%.</p></table-wrap-foot>\",\n \"<table-wrap-foot><p>*More than one component may be provided in each visit.</p></table-wrap-foot>\"\n]","isConversational":false},"graphic":{"kind":"list like","value":[],"string":"[]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Lim\", \"Sadarangani\", \"Chan\", \"Heng\"], \"given-names\": [\"MK\", \"P\", \"HL\", \"JY\"], \"article-title\": [\"Complementary and alternative medicine use in multiracial Singapore\"], \"source\": [\"Compl Therap Med\"], \"year\": [\"2005\"], \"volume\": [\"13\"], \"fpage\": [\"16\"], \"lpage\": [\"24\"], \"pub-id\": [\"10.1016/j.ctim.2004.11.002\"]}, {\"collab\": [\"World Health Organisation\"], \"source\": [\"Regional Strategy for Traditional Medicine in Western Pacific\"], \"year\": [\"2002\"], \"publisher-name\": [\"World Health Organization Western Pacific Manila\"]}, {\"surname\": [\"Cassidy\"], \"given-names\": [\"CM\"], \"article-title\": [\"Chinese medicine users in the United States. Part I: Utilization, satisfaction, medical plurality\"], \"source\": [\"J Altern Compl Med\"], \"year\": [\"1998\"], \"volume\": [\"4\"], \"fpage\": [\"17\"], \"lpage\": [\"27\"], \"pub-id\": [\"10.1089/acm.1998.4.1-17\"]}, {\"collab\": [\"Bureau of National Health Insurance, Taiwan\"], \"source\": [\"National Health Insurance Profile, Taipei (last accessed 27 June 2008)\"], \"year\": [\"2004\"]}, {\"surname\": [\"Chen\", \"Kung\", \"Chen\", \"Hwang\"], \"given-names\": [\"FP\", \"YY\", \"TJ\", \"SJ\"], \"article-title\": [\"Demographics and patterns of acupuncture use in the Chinese population: the Taiwan experience\"], \"source\": [\"J Compl Altern Med\"], \"year\": [\"2006\"], \"volume\": [\"12\"], \"fpage\": [\"379\"], \"lpage\": [\"387\"], \"pub-id\": [\"10.1089/acm.2006.12.379\"]}, {\"surname\": [\"Chen\", \"Chen\", \"Kung\", \"Chen\", \"Chou\", \"Chen\", \"Hwang\"], \"given-names\": [\"FP\", \"TJ\", \"YY\", \"YC\", \"LF\", \"FJ\", \"SJ\"], \"article-title\": [\"Use frequency of traditional Chinese medicine in Taiwan\"], \"source\": [\"BMC Health Services Res\"], \"year\": [\"2007\"], \"volume\": [\"7\"], \"fpage\": [\"26\"], \"lpage\": [\"36\"], \"pub-id\": [\"10.1186/1472-6963-7-26\"]}, {\"article-title\": [\"National Health Insurance Research Database\"], \"comment\": [\"(last accessed 27 June 2008)\"]}, {\"collab\": [\"Department of Health, Taiwan\"], \"article-title\": [\"The list of Taiwan's mountainous and island townships Taipei\"], \"source\": [\"(last accessed 27 June 2008)\"], \"year\": [\"2002\"]}, {\"collab\": [\"Bureau of National Health Insurance, Taiwan\"], \"source\": [\"2001 National Health Insurance Annual Statistical Report Taipei\"], \"year\": [\"2002\"]}, {\"collab\": [\"SAS Institute Inc\"], \"source\": [\"SAS\\u00ae 913 Language Reference: Dictionary\"], \"year\": [\"2006\"], \"volume\": [\"1\\u20134\"], \"edition\": [\"5\"], \"publisher-name\": [\"Cary: SAS Institute Inc\"]}, {\"surname\": [\"Hedeker\", \"Gibbons\"], \"given-names\": [\"D\", \"RD\"], \"source\": [\"Longitudinal Data Analysis\"], \"year\": [\"2006\"], \"publisher-name\": [\"Hoboken: Wiley\"]}, {\"surname\": [\"Diggle\", \"Heagerty\", \"Liang\", \"Zeger\"], \"given-names\": [\"P\", \"P\", \"KY\", \"SL\"], \"source\": [\"Analysis of Longitudinal Data\"], \"year\": [\"2002\"], \"edition\": [\"2\"], \"publisher-name\": [\"Oxford: Oxford University Press\"]}, {\"surname\": [\"Ma\"], \"given-names\": [\"GX\"], \"article-title\": [\"Between two worlds: the use of traditional and Western health services by Chinese immigrants\"], \"source\": [\"J Commun Health\"], \"year\": [\"1999\"], \"volume\": [\"24\"], \"fpage\": [\"421\"], \"lpage\": [\"437\"], \"pub-id\": [\"10.1023/A:1018742505785\"]}, {\"surname\": [\"Cleary-Guida\", \"Okvat\", \"Oz\", \"Ting\"], \"given-names\": [\"MB\", \"HA\", \"MC\", \"W\"], \"article-title\": [\"A regional survey of health insurance coverage for complementary and alternative medicine: Current status and future ramifications\"], \"source\": [\"J Altern Complem Med\"], \"year\": [\"2001\"], \"volume\": [\"7\"], \"fpage\": [\"269\"], \"lpage\": [\"273\"], \"pub-id\": [\"10.1089/107555301300328142\"]}, {\"surname\": [\"Paramore\"], \"given-names\": [\"LC\"], \"article-title\": [\"Use of alternative therapies: Estimates from the 1994 Robert Wood Johnson Foundation National Access to Care Survey\"], \"source\": [\"J Pain Symptom Manag\"], \"year\": [\"1997\"], \"volume\": [\"13\"], \"fpage\": [\"83\"], \"lpage\": [\"89\"], \"pub-id\": [\"10.1016/S0885-3924(96)00299-0\"]}, {\"surname\": [\"Chen\", \"Yang\", \"Lee\", \"Chang\", \"Yeh\"], \"given-names\": [\"L\", \"WS\", \"SD\", \"HC\", \"CL\"], \"article-title\": [\"Utilization of well-baby care visits provided by Taiwan's National Health Insurance Program\"], \"source\": [\"Social Sci Med\"], \"year\": [\"2004\"], \"volume\": [\"59\"], \"fpage\": [\"1647\"], \"lpage\": [\"1659\"], \"pub-id\": [\"10.1016/j.socscimed.2004.02.008\"]}, {\"surname\": [\"Wiles\", \"Rosenberg\"], \"given-names\": [\"J\", \"M\"], \"article-title\": [\"\\\"Gentle caring experience\\\": Seeking alternative health care in Canada\"], \"source\": [\"Health Place\"], \"year\": [\"2001\"], \"volume\": [\"7\"], \"fpage\": [\"2209\"], \"lpage\": [\"2224\"], \"pub-id\": [\"10.1016/S1353-8292(01)00011-9\"]}, {\"surname\": [\"D'Crus\", \"Wilkinson\"], \"given-names\": [\"A\", \"JM\"], \"article-title\": [\"Reasons for choosing and complying with complementary health care: an in-house study on a South Australian clinic\"], \"source\": [\"J Altern Complment Med\"], \"year\": [\"2005\"], \"volume\": [\"11\"], \"fpage\": [\"1107\"], \"lpage\": [\"1112\"], \"pub-id\": [\"10.1089/acm.2005.11.1107\"]}, {\"surname\": [\"Yamashita\", \"Tsukayama\", \"Sugishita\"], \"given-names\": [\"H\", \"H\", \"C\"], \"article-title\": [\"Popularity of complementary and alternative medicine in Japan. A telephone survey\"], \"source\": [\"Compl Ther Med\"], \"year\": [\"2002\"], \"volume\": [\"10\"], \"fpage\": [\"84\"], \"lpage\": [\"93\"], \"pub-id\": [\"10.1054/ctim.2002.0519\"]}, {\"surname\": [\"Oskam\"], \"given-names\": [\"N\"], \"source\": [\"Alternative Medicine: Care or Blessing\"], \"year\": [\"1988\"], \"publisher-name\": [\"Amsterdam: NIPO\"]}, {\"surname\": [\"Thomas\", \"Fall\", \"Parry\", \"Nicholl\"], \"given-names\": [\"K\", \"M\", \"C\", \"J\"], \"source\": [\"National Survey of Access to Complementary Healthcare via General Practice\"], \"year\": [\"1995\"], \"publisher-name\": [\"Sheffield: Medical Care Research Unit of the University of Sheffield\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":46,"string":"46"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:37"},"citation":{"kind":"string","value":"BMC Health Serv Res. 2008 Aug 9; 8:170"},"package_file":{"kind":"string","value":"oa_package/36/25/PMC2538521.tar.gz"}}},{"rowIdx":119686,"cells":{"accession_id":{"kind":"string","value":"PMC2538522"},"pmid":{"kind":"string","value":"18700041"},"introduction":{"kind":"list like","value":["<title>Introduction</title>","<p>Cystic adventitial disease (CyAD) is a rare non-atherosclerotic condition which results in intermittent claudication due to peripheral vascular insufficiency caused by compression of the arterial lumen by a cystic collection of mucinous material containing varying combination of mucopolysaccharides and mucoproteins within the adventitial layer of the artery. The disease predominantly affects the popliteal artery (85% of cases), typically in young to middle-aged men with a male-to-female ratio of 15:1 [##REF##426549##1##]. The etiology of CyAD remains controversial [##REF##426549##1##]. Recent advances in cross-sectional imaging have made possible non-invasive diagnosis of this disease using computer tomography (CT) or cardiovascular magnetic resonance (CMR) [##REF##17643224##2##,##REF##16228854##3##].</p>"],"string":"[\n \"<title>Introduction</title>\",\n \"<p>Cystic adventitial disease (CyAD) is a rare non-atherosclerotic condition which results in intermittent claudication due to peripheral vascular insufficiency caused by compression of the arterial lumen by a cystic collection of mucinous material containing varying combination of mucopolysaccharides and mucoproteins within the adventitial layer of the artery. The disease predominantly affects the popliteal artery (85% of cases), typically in young to middle-aged men with a male-to-female ratio of 15:1 [##REF##426549##1##]. The etiology of CyAD remains controversial [##REF##426549##1##]. Recent advances in cross-sectional imaging have made possible non-invasive diagnosis of this disease using computer tomography (CT) or cardiovascular magnetic resonance (CMR) [##REF##17643224##2##,##REF##16228854##3##].</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":[],"string":"[]","isConversational":false},"results":{"kind":"list like","value":[],"string":"[]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>The most common non-atherosclerotic diseases of the popliteal artery include thrombosed aneurysm, embolism, entrapment syndrome, and CyAD [##REF##8281006##4##]. The incidence of CyAD is estimated to be 1 in 1200 cases of claudication [##REF##426549##1##], with cases described involving external iliac, femoral, popliteal, radial, and ulnar arteries and veins [##REF##17643224##2##, ####REF##16228854##3##, ##REF##8281006##4##, ##REF##16398823##5####16398823##5##]. The symptoms usually include progressive claudication of the lower extremities with no significant evidence of atherosclerotic disease, and although CyAD usually presents in middle-aged patients [##REF##426549##1##], a few reports exist featuring this condition in other ages [##UREF##0##6##,##REF##4722715##7##]. The etiology of CyAD is unclear, and the proposed hypotheses include repetitive trauma to the adventitia caused by flexion injuries leading to cystic degeneration, embryological origin, direct communication with the herniated synovial structures of the adjacent joint, and CyAD as a part of a connective tissue disease [##REF##12124556##8##]. Slow progression of CyAD over a period of several years accounts for masslike appearance and large size of the most lesions [##REF##8281006##4##].</p>","<p>As an inexpensive and readily available diagnostic modality, ultrasound demonstrates anechoic or hypoechoic cystic lesions on gray-scale images, and intra-arterial sonogram reveals adventitial origin of the lesion [##REF##16228854##3##]. Although regarded as the gold standard, conventional angiography has disadvantages such as invasiveness, and exposure to radiation and nephrotoxic contrast agents, and is only diagnostic when characteristic findings such as scimitar (eccentric compression) or hourglass (concentric compression) signs are present [##REF##16228854##3##]. CT and CMR are excellent non-invasive diagnostic modalities for accurate characterization of the cystic lesions and their anatomical relationship to vascular structures [##REF##17643224##2##,##REF##16228854##3##,##REF##12591663##9##]. Contrast enhanced CT may demonstrate CyAD as a non-enhancing cystic mass extrinsically compressing the enhancing crescentic arterial lumen [##REF##9929550##10##].</p>","<p>The introduction of 3T MR systems, with higher inherent signal-to-noise ratio compared to lower field strength scanners, has resulted in improved spatial resolution and faster data acquisition, and with the heightened signal sensitivity to gadolinium-based contrast agents at 3T, high resolution CE-MRA can be performed with low dose contrast protocols, further improving non-invasive assessment of vascular diseases.</p>","<p>The CMR features of CyAD are quite characteristic, and the anatomical extent of the arterial intramural cystic lesions are demonstrated using multi-planar data acquisitions. Individual cysts typically show homogeneous low signal intensity on T1-weighted Spin-echo, and high signal intensity on T2-weighted Turbo Spin-echo images [##REF##12591663##9##], as described in our case. On post-contrast T1-weighted GRE images the non-enhancing hypo-intense intramural cysts with smooth extrinsic compression of the adjacent arterial lumen are clearly depicted. However, since the underlying pathophysiology leads to myxoid degeneration [##REF##426549##1##], lesions may demonstrate enhancement as seen in other myxoid processes. High resolution CE-MRA at 3T is a robust technique for accurate assessment of degree and length of the arterial stenosis or occlusion while depicting lack of significant atherosclerotic process in other arteries of the extremities in CyAD, and may alleviate the need for invasive catheter angiography. Since CyAD may be bilateral, it is important to image both legs. Follow up imaging with CE-MRA or high resolution ultrasound may be performed to look for recurrence or any residual disease.</p>","<p>Surgical treatment options to restore popliteal arterial flow include resection of the affected artery and interposition grafting [##REF##9719314##11##], aspiration of cystic contents [##REF##3196654##12##], and resectional adventitial cystotomy [##REF##16228854##3##].</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>The most common non-atherosclerotic diseases of the popliteal artery include thrombosed aneurysm, embolism, entrapment syndrome, and CyAD [##REF##8281006##4##]. The incidence of CyAD is estimated to be 1 in 1200 cases of claudication [##REF##426549##1##], with cases described involving external iliac, femoral, popliteal, radial, and ulnar arteries and veins [##REF##17643224##2##, ####REF##16228854##3##, ##REF##8281006##4##, ##REF##16398823##5####16398823##5##]. The symptoms usually include progressive claudication of the lower extremities with no significant evidence of atherosclerotic disease, and although CyAD usually presents in middle-aged patients [##REF##426549##1##], a few reports exist featuring this condition in other ages [##UREF##0##6##,##REF##4722715##7##]. The etiology of CyAD is unclear, and the proposed hypotheses include repetitive trauma to the adventitia caused by flexion injuries leading to cystic degeneration, embryological origin, direct communication with the herniated synovial structures of the adjacent joint, and CyAD as a part of a connective tissue disease [##REF##12124556##8##]. Slow progression of CyAD over a period of several years accounts for masslike appearance and large size of the most lesions [##REF##8281006##4##].</p>\",\n \"<p>As an inexpensive and readily available diagnostic modality, ultrasound demonstrates anechoic or hypoechoic cystic lesions on gray-scale images, and intra-arterial sonogram reveals adventitial origin of the lesion [##REF##16228854##3##]. Although regarded as the gold standard, conventional angiography has disadvantages such as invasiveness, and exposure to radiation and nephrotoxic contrast agents, and is only diagnostic when characteristic findings such as scimitar (eccentric compression) or hourglass (concentric compression) signs are present [##REF##16228854##3##]. CT and CMR are excellent non-invasive diagnostic modalities for accurate characterization of the cystic lesions and their anatomical relationship to vascular structures [##REF##17643224##2##,##REF##16228854##3##,##REF##12591663##9##]. Contrast enhanced CT may demonstrate CyAD as a non-enhancing cystic mass extrinsically compressing the enhancing crescentic arterial lumen [##REF##9929550##10##].</p>\",\n \"<p>The introduction of 3T MR systems, with higher inherent signal-to-noise ratio compared to lower field strength scanners, has resulted in improved spatial resolution and faster data acquisition, and with the heightened signal sensitivity to gadolinium-based contrast agents at 3T, high resolution CE-MRA can be performed with low dose contrast protocols, further improving non-invasive assessment of vascular diseases.</p>\",\n \"<p>The CMR features of CyAD are quite characteristic, and the anatomical extent of the arterial intramural cystic lesions are demonstrated using multi-planar data acquisitions. Individual cysts typically show homogeneous low signal intensity on T1-weighted Spin-echo, and high signal intensity on T2-weighted Turbo Spin-echo images [##REF##12591663##9##], as described in our case. On post-contrast T1-weighted GRE images the non-enhancing hypo-intense intramural cysts with smooth extrinsic compression of the adjacent arterial lumen are clearly depicted. However, since the underlying pathophysiology leads to myxoid degeneration [##REF##426549##1##], lesions may demonstrate enhancement as seen in other myxoid processes. High resolution CE-MRA at 3T is a robust technique for accurate assessment of degree and length of the arterial stenosis or occlusion while depicting lack of significant atherosclerotic process in other arteries of the extremities in CyAD, and may alleviate the need for invasive catheter angiography. Since CyAD may be bilateral, it is important to image both legs. Follow up imaging with CE-MRA or high resolution ultrasound may be performed to look for recurrence or any residual disease.</p>\",\n \"<p>Surgical treatment options to restore popliteal arterial flow include resection of the affected artery and interposition grafting [##REF##9719314##11##], aspiration of cystic contents [##REF##3196654##12##], and resectional adventitial cystotomy [##REF##16228854##3##].</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>Utilizing various high resolution image acquisition sequences in multiple orientations combined with CE-MRA at 3T, CMR has an important role for non-invasive morphological assessment, tissue characterization, and vascular evaluation in cystic adventitial disease.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>Utilizing various high resolution image acquisition sequences in multiple orientations combined with CE-MRA at 3T, CMR has an important role for non-invasive morphological assessment, tissue characterization, and vascular evaluation in cystic adventitial disease.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<p>Cystic adventitial disease (CAD) of the popliteal artery is a rare vascular disease of unknown etiology in which a mucin-containing cyst develops in the adventitial layer of the artery. We report the case of a 26-year-old male with CAD of the right popliteal artery diagnosed non-invasively with 3 Tesla cardiovascular magnetic resonance and confirmed on post-operative histopathology.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<p>Cystic adventitial disease (CAD) of the popliteal artery is a rare vascular disease of unknown etiology in which a mucin-containing cyst develops in the adventitial layer of the artery. We report the case of a 26-year-old male with CAD of the right popliteal artery diagnosed non-invasively with 3 Tesla cardiovascular magnetic resonance and confirmed on post-operative histopathology.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Case report</title>","<p>A 26-year old male presented with a 15-month history of progressive right calf intermittent claudication which was more severe on stairs. The maximum walking distance was approximately 50 meters at the time of presentation. The patient had no risk factors for vascular disease such as hypertension, diabetes mellitus, hyperlipidemia, and smoking. Physical examination revealed mild tenderness at the superio-medial aspect of the right calf, normal femoral, popliteal, posterior tibial, and diminished dorsalis pedis pulses, and no neurologic deficit in the right lower extremity. Based on history and physical examination, patient was referred for CMR and high resolution contrast enhanced MR angiography (CE-MRA) of the lower extremity to assess popliteal artery entrapment syndrome. CMR was performed on a 3 Tesla MR system (Magnetom Tim Trio, Siemens Medical Solutions, Erlangen, Germany) (Table ##TAB##0##1##). Pre-contrast T1-weighted Spin-echo and T2-weighted Turbo Spin-echo images demonstrated a multilobulated cystic lesion within the wall of the popliteal artery smoothly compressing the adjacent arterial lumen with homogeneous low- and high-signal intensities on T1- and T2-weighted images, respectively (Figure ##FIG##0##1##). In addition, T1-weighted post-contrast GRE images showed no evidence of peripheral or central enhancement of the well-defined hypo-intense cystic mass (Figure ##FIG##1##2##). CE-MRA (at rest and with plantar/dorsi-flexion) showed extrinsic compression of the right popliteal artery with resultant near occlusion over a distance of 4 cm below the knee joint (Figure ##FIG##2##3##). Distal to this lesion the popliteal artery was reconstituted by collaterals. The findings favored the diagnosis of CyAD of the popliteal artery. There was no evidence of popliteal entrapment syndrome or deep vein thrombosis.</p>","<p>The patient underwent open resectional cystotomy two weeks later. The popliteal artery was exposed from a posterior approach through a longitudinal incision. A 4-cm length of the artery was observed to be grossly enlarged. The cyst was punctured and after evacuating the clear gelatinous fluid, the wall was resected with Potts scissors. With release of the cyst compression, arterial pulse distal to the lesion improved immediately. Histopathology confirmed cystic adventitial disease as evidenced by dense fibrous adventitial tissue of the intramural cyst wall and the mucoproteinaceous contents (Figure ##FIG##3##4##).</p>","<p>The patient returned to full activity in one week, and remained asymptomatic during the 20-month follow-up period.</p>","<title>Consent</title>","<p>Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.</p>","<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>AT, C.L, JPF, HG, MSK Data acquisition, or analysis and interpretation, AT, CL, JPF, HG, MSK Critical revision for important intellectual content, AT, MSK Manuscript drafting, AT, CL, JPF, HG, MSK Final approval of the manuscript, HG Surgical procedure.</p>"],"string":"[\n \"<title>Case report</title>\",\n \"<p>A 26-year old male presented with a 15-month history of progressive right calf intermittent claudication which was more severe on stairs. The maximum walking distance was approximately 50 meters at the time of presentation. The patient had no risk factors for vascular disease such as hypertension, diabetes mellitus, hyperlipidemia, and smoking. Physical examination revealed mild tenderness at the superio-medial aspect of the right calf, normal femoral, popliteal, posterior tibial, and diminished dorsalis pedis pulses, and no neurologic deficit in the right lower extremity. Based on history and physical examination, patient was referred for CMR and high resolution contrast enhanced MR angiography (CE-MRA) of the lower extremity to assess popliteal artery entrapment syndrome. CMR was performed on a 3 Tesla MR system (Magnetom Tim Trio, Siemens Medical Solutions, Erlangen, Germany) (Table ##TAB##0##1##). Pre-contrast T1-weighted Spin-echo and T2-weighted Turbo Spin-echo images demonstrated a multilobulated cystic lesion within the wall of the popliteal artery smoothly compressing the adjacent arterial lumen with homogeneous low- and high-signal intensities on T1- and T2-weighted images, respectively (Figure ##FIG##0##1##). In addition, T1-weighted post-contrast GRE images showed no evidence of peripheral or central enhancement of the well-defined hypo-intense cystic mass (Figure ##FIG##1##2##). CE-MRA (at rest and with plantar/dorsi-flexion) showed extrinsic compression of the right popliteal artery with resultant near occlusion over a distance of 4 cm below the knee joint (Figure ##FIG##2##3##). Distal to this lesion the popliteal artery was reconstituted by collaterals. The findings favored the diagnosis of CyAD of the popliteal artery. There was no evidence of popliteal entrapment syndrome or deep vein thrombosis.</p>\",\n \"<p>The patient underwent open resectional cystotomy two weeks later. The popliteal artery was exposed from a posterior approach through a longitudinal incision. A 4-cm length of the artery was observed to be grossly enlarged. The cyst was punctured and after evacuating the clear gelatinous fluid, the wall was resected with Potts scissors. With release of the cyst compression, arterial pulse distal to the lesion improved immediately. Histopathology confirmed cystic adventitial disease as evidenced by dense fibrous adventitial tissue of the intramural cyst wall and the mucoproteinaceous contents (Figure ##FIG##3##4##).</p>\",\n \"<p>The patient returned to full activity in one week, and remained asymptomatic during the 20-month follow-up period.</p>\",\n \"<title>Consent</title>\",\n \"<p>Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.</p>\",\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>AT, C.L, JPF, HG, MSK Data acquisition, or analysis and interpretation, AT, CL, JPF, HG, MSK Critical revision for important intellectual content, AT, MSK Manuscript drafting, AT, CL, JPF, HG, MSK Final approval of the manuscript, HG Surgical procedure.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":[],"string":"[]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Axial T2-weighted fat saturated turbo spin echo images demonstrate a well defined, homogeneously hyper-intense multi-lobulated cystic lesion in the right popliteal fossa (Figure 1a and 1b, arrows).</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Axial and coronal T1-weighted post-contrast fat saturated gradient echo (GRE) images show no evidence of contrast enhancement of the well defined hypo-intense cystic mass.</bold> Compression of the popliteal arterial lumen (figure 2a and 2b, arrows), and normal enhancement of the popliteal vein (figure 2a, arrowhead) are noted.</p></caption></fig>","<fig position=\"float\" id=\"F3\"><label>Figure 3</label><caption><p><bold>Maximal intensity projection (MIP) reconstruction image from high spatial resolution contrast enhanced MR angiography reveals a long segment focal near occlusion of the right popliteal artery (arrow)</bold>. Note is made of high take-off of the bilateral posterior tibial arteries (arrowheads).</p></caption></fig>","<fig position=\"float\" id=\"F4\"><label>Figure 4</label><caption><p><bold>(a) </bold><bold>The cyst wall is comprised of dense, fibrous tissue, which is consistent with the adventitia of a blood vessel (H&E stain; 40×, original magnification)</bold>. <bold>(b) </bold>At higher magnification (H&E stain; 100×, original magnification), foci of hemorrhage is seen within the cyst wall (arrows). <bold>(c) </bold>There were also focal areas of chronic inflammation within the cyst wall (circled areas) [H&E stain; 100×, original magnification]. <bold>(d) </bold>The cyst contents consist mostly of proteinaceous debris with rare, scattered degenerated macrophages (arrow) [H&E stain; 400×, original magnification].</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p>Axial T2-weighted fat saturated turbo spin echo images demonstrate a well defined, homogeneously hyper-intense multi-lobulated cystic lesion in the right popliteal fossa (Figure 1a and 1b, arrows).</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p><bold>Axial and coronal T1-weighted post-contrast fat saturated gradient echo (GRE) images show no evidence of contrast enhancement of the well defined hypo-intense cystic mass.</bold> Compression of the popliteal arterial lumen (figure 2a and 2b, arrows), and normal enhancement of the popliteal vein (figure 2a, arrowhead) are noted.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F3\\\"><label>Figure 3</label><caption><p><bold>Maximal intensity projection (MIP) reconstruction image from high spatial resolution contrast enhanced MR angiography reveals a long segment focal near occlusion of the right popliteal artery (arrow)</bold>. Note is made of high take-off of the bilateral posterior tibial arteries (arrowheads).</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F4\\\"><label>Figure 4</label><caption><p><bold>(a) </bold><bold>The cyst wall is comprised of dense, fibrous tissue, which is consistent with the adventitia of a blood vessel (H&E stain; 40×, original magnification)</bold>. <bold>(b) </bold>At higher magnification (H&E stain; 100×, original magnification), foci of hemorrhage is seen within the cyst wall (arrows). <bold>(c) </bold>There were also focal areas of chronic inflammation within the cyst wall (circled areas) [H&E stain; 100×, original magnification]. <bold>(d) </bold>The cyst contents consist mostly of proteinaceous debris with rare, scattered degenerated macrophages (arrow) [H&E stain; 400×, original magnification].</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Imaging Sequences and Parameters for Cardiovascular Magnetic Resonance</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Pulse sequence</bold></td><td align=\"center\"><bold>TE (msec)</bold></td><td align=\"center\"><bold>TR (msec)</bold></td><td align=\"center\"><bold>Slice thickness (mm)</bold></td></tr></thead><tbody><tr><td align=\"left\">T1-weighted Spin-echo (axial plane)</td><td align=\"center\">14</td><td align=\"center\">750</td><td align=\"center\">5</td></tr><tr><td align=\"left\">T2-weighted Turbo Spin-echo (axial plane)</td><td align=\"center\">86</td><td align=\"center\">4000</td><td align=\"center\">4</td></tr><tr><td align=\"left\">T1-weighted post-contrast fat saturated two-dimensional gradient echo (GRE) (axial and coronal planes)</td><td align=\"center\">2.1</td><td align=\"center\">243</td><td align=\"center\">3</td></tr><tr><td align=\"left\">CE-MRA: three dimensional fast GRE*</td><td align=\"center\">1.1</td><td align=\"center\">2.9</td><td align=\"center\">0.8</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Imaging Sequences and Parameters for Cardiovascular Magnetic Resonance</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\"><bold>Pulse sequence</bold></td><td align=\\\"center\\\"><bold>TE (msec)</bold></td><td align=\\\"center\\\"><bold>TR (msec)</bold></td><td align=\\\"center\\\"><bold>Slice thickness (mm)</bold></td></tr></thead><tbody><tr><td align=\\\"left\\\">T1-weighted Spin-echo (axial plane)</td><td align=\\\"center\\\">14</td><td align=\\\"center\\\">750</td><td align=\\\"center\\\">5</td></tr><tr><td align=\\\"left\\\">T2-weighted Turbo Spin-echo (axial plane)</td><td align=\\\"center\\\">86</td><td align=\\\"center\\\">4000</td><td align=\\\"center\\\">4</td></tr><tr><td align=\\\"left\\\">T1-weighted post-contrast fat saturated two-dimensional gradient echo (GRE) (axial and coronal planes)</td><td align=\\\"center\\\">2.1</td><td align=\\\"center\\\">243</td><td align=\\\"center\\\">3</td></tr><tr><td align=\\\"left\\\">CE-MRA: three dimensional fast GRE*</td><td align=\\\"center\\\">1.1</td><td align=\\\"center\\\">2.9</td><td align=\\\"center\\\">0.8</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":["<table-wrap-foot><p>*Generalized Autocalibrating Partially Parallel Acquisition or GRAPPA factor of 4 was applied. CE-MRA was performed following intravenous administration of 15 mL of contrast (Magnevist, Berlex Laboratories, Wayne, New Jersey, USA) at the rate of 1.2 mL/second followed by 30 mL of saline at the same rate.</p></table-wrap-foot>"],"string":"[\n \"<table-wrap-foot><p>*Generalized Autocalibrating Partially Parallel Acquisition or GRAPPA factor of 4 was applied. CE-MRA was performed following intravenous administration of 15 mL of contrast (Magnevist, Berlex Laboratories, Wayne, New Jersey, USA) at the rate of 1.2 mL/second followed by 30 mL of saline at the same rate.</p></table-wrap-foot>\"\n]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1532-429X-10-38-1\"/>","<graphic xlink:href=\"1532-429X-10-38-2\"/>","<graphic xlink:href=\"1532-429X-10-38-3\"/>","<graphic xlink:href=\"1532-429X-10-38-4\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1532-429X-10-38-1\\\"/>\",\n \"<graphic xlink:href=\\\"1532-429X-10-38-2\\\"/>\",\n \"<graphic xlink:href=\\\"1532-429X-10-38-3\\\"/>\",\n \"<graphic xlink:href=\\\"1532-429X-10-38-4\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Lewis\", \"Douglas\", \"Reid\", \"Kennedy J\"], \"given-names\": [\"GJT\", \"DM\", \"W\", \"Watt\"], \"article-title\": [\"Cystic adventitial disease of the popliteal artery\"], \"source\": [\"Br Med J\"], \"year\": [\"1967\"], \"volume\": [\"3\"], \"fpage\": [\"411\"], \"lpage\": [\"415\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":12,"string":"12"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:37"},"citation":{"kind":"string","value":"J Cardiovasc Magn Reson. 2008 Aug 13; 10(1):38"},"package_file":{"kind":"string","value":"oa_package/90/1e/PMC2538522.tar.gz"}}},{"rowIdx":119687,"cells":{"accession_id":{"kind":"string","value":"PMC2538523"},"pmid":{"kind":"string","value":"18759965"},"introduction":{"kind":"list like","value":["<title>Introduction</title>","<p>Breast cancer is one of the leading causes of death in women worldwide. BRCA1 (MIM113705) is a high risk-associated gene responsible for breast cancer of both hereditary and sporadic origin. Although several studies around the world and few studies in Pakistan, have emphasized that germline mutations in BRCA1 are contributory in a significant proportion for the incidence of breast cancer, the expected ratio in relation to overall prevalence of sporadic cancer cases in our local populations has not been properly clarified.</p>","<p>Nationwide Cancer registry records and epidemiological surveillance data regarding the various types of cancers are lacking in Pakistan. However, according to Karachi Cancer Registry report, the incidence rate of breast cancer is 69.1 per 100,000 [##REF##15075010##1##] which is one of the highest in Asian populations, excluding Israel. Estimated prevalence of this gene with respect to familial history is 17% [##REF##16998791##2##].</p>","<p>The estimated ratio of BRCA germline mutations in sporadic breast cancer cases is believed to vary significantly in different local populations of Pakistan, by 4.4 – 11.1% (Rashid, 2004, Liede, 2002). There were limitations in these studies. In case of Leide [##REF##12181777##3##] case selection was irrespective of the age group, while in Rashid et al [##REF##16998791##2##] sample selection was mainly confined to familial breast cancer cases. Moreover both studies were mainly confined to Punjab province.</p>","<p>The present study was designed in order to determine the contribution of germline mutations of BRCA1 to sporadic breast cancer cases from all four provinces of Pakistan. We have selected hot spots of mutation on BRCA1 gene and tried to screen exons involved in ring finger domain formation of BRCA1 protein too.</p>"],"string":"[\n \"<title>Introduction</title>\",\n \"<p>Breast cancer is one of the leading causes of death in women worldwide. BRCA1 (MIM113705) is a high risk-associated gene responsible for breast cancer of both hereditary and sporadic origin. Although several studies around the world and few studies in Pakistan, have emphasized that germline mutations in BRCA1 are contributory in a significant proportion for the incidence of breast cancer, the expected ratio in relation to overall prevalence of sporadic cancer cases in our local populations has not been properly clarified.</p>\",\n \"<p>Nationwide Cancer registry records and epidemiological surveillance data regarding the various types of cancers are lacking in Pakistan. However, according to Karachi Cancer Registry report, the incidence rate of breast cancer is 69.1 per 100,000 [##REF##15075010##1##] which is one of the highest in Asian populations, excluding Israel. Estimated prevalence of this gene with respect to familial history is 17% [##REF##16998791##2##].</p>\",\n \"<p>The estimated ratio of BRCA germline mutations in sporadic breast cancer cases is believed to vary significantly in different local populations of Pakistan, by 4.4 – 11.1% (Rashid, 2004, Liede, 2002). There were limitations in these studies. In case of Leide [##REF##12181777##3##] case selection was irrespective of the age group, while in Rashid et al [##REF##16998791##2##] sample selection was mainly confined to familial breast cancer cases. Moreover both studies were mainly confined to Punjab province.</p>\",\n \"<p>The present study was designed in order to determine the contribution of germline mutations of BRCA1 to sporadic breast cancer cases from all four provinces of Pakistan. We have selected hot spots of mutation on BRCA1 gene and tried to screen exons involved in ring finger domain formation of BRCA1 protein too.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<p>Breast cancer patients were determined from various hospitals and Nuclear Medicine Institute(s) from January 2006 – March 2007. Peripheral blood samples were collected from Nuclear and Oncology Institutes all over the country. Ethical approval was obtained from the respective research committees of these institutes.</p>","<p>Breast cancer cases found suitable, after stringent initial screening (no family history, age of onset of disease, no other family prevailing disorders, no earlier sampling from any other group for any study) were 150 (table ##TAB##0##1## and figure ##FIG##0##1##). They were classified into four main groups, with respect to ethnic and geographic origin: as Punjabi, Pathan, Balochi, and Sindhi. Females free from of haematological disease or malignancy, either in them or their family history, were involved in the study as controls. Blood was drawn with informed consent from patients and these females.</p>","<p>Only female patients were selected for this study, as the incidence of male breast cancer in our population was low, and not adequate to justify the penetration. Sporadic cancer is generally believed to be unilateral but we also observed 8 cases of bilateral origin in this regard (included in this study as a single case).</p>","<title>Sample Collection and Storage</title>","<p>Blood samples from each case were collected in blood vaccutainer having EDTA as anticoagulant. For storage, transportation and preservation, recommended guidelines were followed [##UREF##0##4##]. 100 blood samples from normal individuals exonerated from any disorder were also collected with respective origins, so that mutation or polymorphism of respective origin could be differentiated.</p>","<title>Isolation and estimation of DNA</title>","<p>Genome isolation was carried out following the recommended protocol [##REF##15570097##5##] with minor modifications of ethanol precipitation. DNA isolated was first confirmed by agarose gel electrophoreses, then quantified by using spectrophotometer to use for polymerase chain reaction.</p>","<title>Amplification, Mutation Screening and Sequencing</title>","<p>Primers for exons 2, 3 and 13 were designed from the sequences available on Genebank (113705). Primer designing was done with the aid of Primer # 3' software and intron exon junctions were also included in this study for a better identification of splice sites variation. The primer sequences for the respective exons involved in this study are given in the table ##TAB##1##2##. After optimization, amplification conditions for exons are 95°C for 4 min, 95°C for 30 s, 50°C for 30 s, 72°C for 1 min and 72°C for 45 min. Amplified products were then run on 2% agarose to confirm the chances of non-specificity and yield of the amplified product.</p>","<p>For mutation detection, SSCP technique [##REF##9071892##6##] with few modifications was used and samples were screened for any mobility shift in their banding pattern. This change in mobility shift either predicting any frame shift alterations or base substitution in the specified region was confirmed by running normal controls along with the samples. To check and confirm the findings, sequencing of the respective sample was done by the aid of Big Dye terminator Reaction kit available for ABI310. Bioedit software was use to compare between normal and suspected samples.</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<p>Breast cancer patients were determined from various hospitals and Nuclear Medicine Institute(s) from January 2006 – March 2007. Peripheral blood samples were collected from Nuclear and Oncology Institutes all over the country. Ethical approval was obtained from the respective research committees of these institutes.</p>\",\n \"<p>Breast cancer cases found suitable, after stringent initial screening (no family history, age of onset of disease, no other family prevailing disorders, no earlier sampling from any other group for any study) were 150 (table ##TAB##0##1## and figure ##FIG##0##1##). They were classified into four main groups, with respect to ethnic and geographic origin: as Punjabi, Pathan, Balochi, and Sindhi. Females free from of haematological disease or malignancy, either in them or their family history, were involved in the study as controls. Blood was drawn with informed consent from patients and these females.</p>\",\n \"<p>Only female patients were selected for this study, as the incidence of male breast cancer in our population was low, and not adequate to justify the penetration. Sporadic cancer is generally believed to be unilateral but we also observed 8 cases of bilateral origin in this regard (included in this study as a single case).</p>\",\n \"<title>Sample Collection and Storage</title>\",\n \"<p>Blood samples from each case were collected in blood vaccutainer having EDTA as anticoagulant. For storage, transportation and preservation, recommended guidelines were followed [##UREF##0##4##]. 100 blood samples from normal individuals exonerated from any disorder were also collected with respective origins, so that mutation or polymorphism of respective origin could be differentiated.</p>\",\n \"<title>Isolation and estimation of DNA</title>\",\n \"<p>Genome isolation was carried out following the recommended protocol [##REF##15570097##5##] with minor modifications of ethanol precipitation. DNA isolated was first confirmed by agarose gel electrophoreses, then quantified by using spectrophotometer to use for polymerase chain reaction.</p>\",\n \"<title>Amplification, Mutation Screening and Sequencing</title>\",\n \"<p>Primers for exons 2, 3 and 13 were designed from the sequences available on Genebank (113705). Primer designing was done with the aid of Primer # 3' software and intron exon junctions were also included in this study for a better identification of splice sites variation. The primer sequences for the respective exons involved in this study are given in the table ##TAB##1##2##. After optimization, amplification conditions for exons are 95°C for 4 min, 95°C for 30 s, 50°C for 30 s, 72°C for 1 min and 72°C for 45 min. Amplified products were then run on 2% agarose to confirm the chances of non-specificity and yield of the amplified product.</p>\",\n \"<p>For mutation detection, SSCP technique [##REF##9071892##6##] with few modifications was used and samples were screened for any mobility shift in their banding pattern. This change in mobility shift either predicting any frame shift alterations or base substitution in the specified region was confirmed by running normal controls along with the samples. To check and confirm the findings, sequencing of the respective sample was done by the aid of Big Dye terminator Reaction kit available for ABI310. Bioedit software was use to compare between normal and suspected samples.</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results and discussion</title>","<p>After extensive screening, five samples were found positive showing an altered mobility shift on the exon 13 of BRCA1. No mutation was detected with respect to exon 2 and 3 of BRCA1 gene. Sequencing reveals an evidence of mis-sense variation on 1435 amino acid Ser. of BRCA1 protein. There is novel splice site mutation changing amino acid 1452 from Ala to Gln and is due to del of A' reported leading to splice site truncation which has not been reported in Breast Information Core database as well (figure ##FIG##1##2##). The prevalence of the mutations is summarized in table ##TAB##2##3##.</p>","<p>The present study was undertaken to evaluate the prevalence of germ-line mutations of these genes in sporadic breast cancer patients on following exons; 2, 3 and 13 of BRCA1. Reason of choosing these exons included,</p>","<p>1. Out of 1863 amino acids, ring finger domain has been formed from exons 2 to 5 [##REF##7545954##7##]. Most frequently observed mutation 185 del AG has altered the cell viability as tested in ovarian cancers by Nicole <italic>et al </italic>in 2003 [##REF##12234376##8##].</p>","<p>2. Exon 13 apart from variation study [##UREF##1##9##] was added with a intention to seek for target duplication studies later for those positive variants for geographic relationship as done by The BRCA1 Exon13 Duplication Screening Group.</p>","<p>Genetic linkage analysis identification [##REF##2270482##10##] and refine mapping [##REF##7951316##11##,##REF##8116622##12##] provided the evidence of location of BRCA1 on chromosome 17 of human genome. BRCA1 mutations accounts for 45% in multiple breast cancer familial cases [##REF##8460634##13##]. BRCA contribution in relation to familial cases of breast cancer is strongly established. Its penetrance as having a germline mutation, in most commonly encountered sporadic forms of breast cancer varies among different populations [##REF##8595420##14##, ####REF##8808710##15##, ##REF##8723683##16##, ##REF##9042909##17####9042909##17##]. This contributory variation may be attributed to their different gene pool make and also due to low penetrance genes involvement. In families with no prior history of breast cancer, frequency of BRCA mutation is found significantly low from 0.02% to 10% [##REF##9150148##18##]. In Asia, the prevalence of BRCA1/2 mutations among unselected breast cancer cases was reported 5.1% in Philippines [##REF##11920621##19##], and 2.5%–3.1% in Korea [##REF##17100994##20##, ####REF##15082902##21##, ##UREF##2##22####2##22##].</p>","<p>2% of breast cancer cases in largest breast cancer population based study in UK population showed association with BRCA genes with 0.7% attribution of BRCA1 (Anglian Breast Cancer Study Group, 2000) [##REF##11044354##23##]. In the only population based study of unselected breast cancer cases, BRCA1 mutations were found in 3/211 American patients (1.4%). Several hospital based series of unselected breast cancers implicate BRCA1 and BRCA2 in 2–5% and 0–2% of all cases, respectively [##REF##7545954##7##]. Earlier studies have estimated the prevalence of deleterious mutations as 5.1 and 6.7% variable by ethnicity [##REF##11920621##24##] in Korean population and germline mutations of the BRCA2 gene account for less than 0.5% of all invasive breast cancers [##REF##15635067##25##]. This variation may be attributed to difference on genome level among various ethnic and population heterogeneity. The reason of marginally low penetrance of BRCA1 gerline mutations may be attributed to the polygenic involvement and heterogeneity of samples origin too. As in Asia the overall prevalence of germline mutation varies from 0.8% in Japanese [##REF##9510469##26##] to 8.0% in Signapore region [##REF##10682662##27##] indicating involvement of other genes and population response with respect to various types and origin of cancers.</p>","<p>Moreover inter individual variation does exist among the ethnic groups in association with various risk factor as reported by Peto <italic>et al</italic>., [##REF##10359546##28##] showing mutation prevalence as 3.5% before age 35 yr declining to 0.49% in ≥ 50 yrs.</p>"],"string":"[\n \"<title>Results and discussion</title>\",\n \"<p>After extensive screening, five samples were found positive showing an altered mobility shift on the exon 13 of BRCA1. No mutation was detected with respect to exon 2 and 3 of BRCA1 gene. Sequencing reveals an evidence of mis-sense variation on 1435 amino acid Ser. of BRCA1 protein. There is novel splice site mutation changing amino acid 1452 from Ala to Gln and is due to del of A' reported leading to splice site truncation which has not been reported in Breast Information Core database as well (figure ##FIG##1##2##). The prevalence of the mutations is summarized in table ##TAB##2##3##.</p>\",\n \"<p>The present study was undertaken to evaluate the prevalence of germ-line mutations of these genes in sporadic breast cancer patients on following exons; 2, 3 and 13 of BRCA1. Reason of choosing these exons included,</p>\",\n \"<p>1. Out of 1863 amino acids, ring finger domain has been formed from exons 2 to 5 [##REF##7545954##7##]. Most frequently observed mutation 185 del AG has altered the cell viability as tested in ovarian cancers by Nicole <italic>et al </italic>in 2003 [##REF##12234376##8##].</p>\",\n \"<p>2. Exon 13 apart from variation study [##UREF##1##9##] was added with a intention to seek for target duplication studies later for those positive variants for geographic relationship as done by The BRCA1 Exon13 Duplication Screening Group.</p>\",\n \"<p>Genetic linkage analysis identification [##REF##2270482##10##] and refine mapping [##REF##7951316##11##,##REF##8116622##12##] provided the evidence of location of BRCA1 on chromosome 17 of human genome. BRCA1 mutations accounts for 45% in multiple breast cancer familial cases [##REF##8460634##13##]. BRCA contribution in relation to familial cases of breast cancer is strongly established. Its penetrance as having a germline mutation, in most commonly encountered sporadic forms of breast cancer varies among different populations [##REF##8595420##14##, ####REF##8808710##15##, ##REF##8723683##16##, ##REF##9042909##17####9042909##17##]. This contributory variation may be attributed to their different gene pool make and also due to low penetrance genes involvement. In families with no prior history of breast cancer, frequency of BRCA mutation is found significantly low from 0.02% to 10% [##REF##9150148##18##]. In Asia, the prevalence of BRCA1/2 mutations among unselected breast cancer cases was reported 5.1% in Philippines [##REF##11920621##19##], and 2.5%–3.1% in Korea [##REF##17100994##20##, ####REF##15082902##21##, ##UREF##2##22####2##22##].</p>\",\n \"<p>2% of breast cancer cases in largest breast cancer population based study in UK population showed association with BRCA genes with 0.7% attribution of BRCA1 (Anglian Breast Cancer Study Group, 2000) [##REF##11044354##23##]. In the only population based study of unselected breast cancer cases, BRCA1 mutations were found in 3/211 American patients (1.4%). Several hospital based series of unselected breast cancers implicate BRCA1 and BRCA2 in 2–5% and 0–2% of all cases, respectively [##REF##7545954##7##]. Earlier studies have estimated the prevalence of deleterious mutations as 5.1 and 6.7% variable by ethnicity [##REF##11920621##24##] in Korean population and germline mutations of the BRCA2 gene account for less than 0.5% of all invasive breast cancers [##REF##15635067##25##]. This variation may be attributed to difference on genome level among various ethnic and population heterogeneity. The reason of marginally low penetrance of BRCA1 gerline mutations may be attributed to the polygenic involvement and heterogeneity of samples origin too. As in Asia the overall prevalence of germline mutation varies from 0.8% in Japanese [##REF##9510469##26##] to 8.0% in Signapore region [##REF##10682662##27##] indicating involvement of other genes and population response with respect to various types and origin of cancers.</p>\",\n \"<p>Moreover inter individual variation does exist among the ethnic groups in association with various risk factor as reported by Peto <italic>et al</italic>., [##REF##10359546##28##] showing mutation prevalence as 3.5% before age 35 yr declining to 0.49% in ≥ 50 yrs.</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Results and discussion</title>","<p>After extensive screening, five samples were found positive showing an altered mobility shift on the exon 13 of BRCA1. No mutation was detected with respect to exon 2 and 3 of BRCA1 gene. Sequencing reveals an evidence of mis-sense variation on 1435 amino acid Ser. of BRCA1 protein. There is novel splice site mutation changing amino acid 1452 from Ala to Gln and is due to del of A' reported leading to splice site truncation which has not been reported in Breast Information Core database as well (figure ##FIG##1##2##). The prevalence of the mutations is summarized in table ##TAB##2##3##.</p>","<p>The present study was undertaken to evaluate the prevalence of germ-line mutations of these genes in sporadic breast cancer patients on following exons; 2, 3 and 13 of BRCA1. Reason of choosing these exons included,</p>","<p>1. Out of 1863 amino acids, ring finger domain has been formed from exons 2 to 5 [##REF##7545954##7##]. Most frequently observed mutation 185 del AG has altered the cell viability as tested in ovarian cancers by Nicole <italic>et al </italic>in 2003 [##REF##12234376##8##].</p>","<p>2. Exon 13 apart from variation study [##UREF##1##9##] was added with a intention to seek for target duplication studies later for those positive variants for geographic relationship as done by The BRCA1 Exon13 Duplication Screening Group.</p>","<p>Genetic linkage analysis identification [##REF##2270482##10##] and refine mapping [##REF##7951316##11##,##REF##8116622##12##] provided the evidence of location of BRCA1 on chromosome 17 of human genome. BRCA1 mutations accounts for 45% in multiple breast cancer familial cases [##REF##8460634##13##]. BRCA contribution in relation to familial cases of breast cancer is strongly established. Its penetrance as having a germline mutation, in most commonly encountered sporadic forms of breast cancer varies among different populations [##REF##8595420##14##, ####REF##8808710##15##, ##REF##8723683##16##, ##REF##9042909##17####9042909##17##]. This contributory variation may be attributed to their different gene pool make and also due to low penetrance genes involvement. In families with no prior history of breast cancer, frequency of BRCA mutation is found significantly low from 0.02% to 10% [##REF##9150148##18##]. In Asia, the prevalence of BRCA1/2 mutations among unselected breast cancer cases was reported 5.1% in Philippines [##REF##11920621##19##], and 2.5%–3.1% in Korea [##REF##17100994##20##, ####REF##15082902##21##, ##UREF##2##22####2##22##].</p>","<p>2% of breast cancer cases in largest breast cancer population based study in UK population showed association with BRCA genes with 0.7% attribution of BRCA1 (Anglian Breast Cancer Study Group, 2000) [##REF##11044354##23##]. In the only population based study of unselected breast cancer cases, BRCA1 mutations were found in 3/211 American patients (1.4%). Several hospital based series of unselected breast cancers implicate BRCA1 and BRCA2 in 2–5% and 0–2% of all cases, respectively [##REF##7545954##7##]. Earlier studies have estimated the prevalence of deleterious mutations as 5.1 and 6.7% variable by ethnicity [##REF##11920621##24##] in Korean population and germline mutations of the BRCA2 gene account for less than 0.5% of all invasive breast cancers [##REF##15635067##25##]. This variation may be attributed to difference on genome level among various ethnic and population heterogeneity. The reason of marginally low penetrance of BRCA1 gerline mutations may be attributed to the polygenic involvement and heterogeneity of samples origin too. As in Asia the overall prevalence of germline mutation varies from 0.8% in Japanese [##REF##9510469##26##] to 8.0% in Signapore region [##REF##10682662##27##] indicating involvement of other genes and population response with respect to various types and origin of cancers.</p>","<p>Moreover inter individual variation does exist among the ethnic groups in association with various risk factor as reported by Peto <italic>et al</italic>., [##REF##10359546##28##] showing mutation prevalence as 3.5% before age 35 yr declining to 0.49% in ≥ 50 yrs.</p>"],"string":"[\n \"<title>Results and discussion</title>\",\n \"<p>After extensive screening, five samples were found positive showing an altered mobility shift on the exon 13 of BRCA1. No mutation was detected with respect to exon 2 and 3 of BRCA1 gene. Sequencing reveals an evidence of mis-sense variation on 1435 amino acid Ser. of BRCA1 protein. There is novel splice site mutation changing amino acid 1452 from Ala to Gln and is due to del of A' reported leading to splice site truncation which has not been reported in Breast Information Core database as well (figure ##FIG##1##2##). The prevalence of the mutations is summarized in table ##TAB##2##3##.</p>\",\n \"<p>The present study was undertaken to evaluate the prevalence of germ-line mutations of these genes in sporadic breast cancer patients on following exons; 2, 3 and 13 of BRCA1. Reason of choosing these exons included,</p>\",\n \"<p>1. Out of 1863 amino acids, ring finger domain has been formed from exons 2 to 5 [##REF##7545954##7##]. Most frequently observed mutation 185 del AG has altered the cell viability as tested in ovarian cancers by Nicole <italic>et al </italic>in 2003 [##REF##12234376##8##].</p>\",\n \"<p>2. Exon 13 apart from variation study [##UREF##1##9##] was added with a intention to seek for target duplication studies later for those positive variants for geographic relationship as done by The BRCA1 Exon13 Duplication Screening Group.</p>\",\n \"<p>Genetic linkage analysis identification [##REF##2270482##10##] and refine mapping [##REF##7951316##11##,##REF##8116622##12##] provided the evidence of location of BRCA1 on chromosome 17 of human genome. BRCA1 mutations accounts for 45% in multiple breast cancer familial cases [##REF##8460634##13##]. BRCA contribution in relation to familial cases of breast cancer is strongly established. Its penetrance as having a germline mutation, in most commonly encountered sporadic forms of breast cancer varies among different populations [##REF##8595420##14##, ####REF##8808710##15##, ##REF##8723683##16##, ##REF##9042909##17####9042909##17##]. This contributory variation may be attributed to their different gene pool make and also due to low penetrance genes involvement. In families with no prior history of breast cancer, frequency of BRCA mutation is found significantly low from 0.02% to 10% [##REF##9150148##18##]. In Asia, the prevalence of BRCA1/2 mutations among unselected breast cancer cases was reported 5.1% in Philippines [##REF##11920621##19##], and 2.5%–3.1% in Korea [##REF##17100994##20##, ####REF##15082902##21##, ##UREF##2##22####2##22##].</p>\",\n \"<p>2% of breast cancer cases in largest breast cancer population based study in UK population showed association with BRCA genes with 0.7% attribution of BRCA1 (Anglian Breast Cancer Study Group, 2000) [##REF##11044354##23##]. In the only population based study of unselected breast cancer cases, BRCA1 mutations were found in 3/211 American patients (1.4%). Several hospital based series of unselected breast cancers implicate BRCA1 and BRCA2 in 2–5% and 0–2% of all cases, respectively [##REF##7545954##7##]. Earlier studies have estimated the prevalence of deleterious mutations as 5.1 and 6.7% variable by ethnicity [##REF##11920621##24##] in Korean population and germline mutations of the BRCA2 gene account for less than 0.5% of all invasive breast cancers [##REF##15635067##25##]. This variation may be attributed to difference on genome level among various ethnic and population heterogeneity. The reason of marginally low penetrance of BRCA1 gerline mutations may be attributed to the polygenic involvement and heterogeneity of samples origin too. As in Asia the overall prevalence of germline mutation varies from 0.8% in Japanese [##REF##9510469##26##] to 8.0% in Signapore region [##REF##10682662##27##] indicating involvement of other genes and population response with respect to various types and origin of cancers.</p>\",\n \"<p>Moreover inter individual variation does exist among the ethnic groups in association with various risk factor as reported by Peto <italic>et al</italic>., [##REF##10359546##28##] showing mutation prevalence as 3.5% before age 35 yr declining to 0.49% in ≥ 50 yrs.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>The continuing uncertainty as to the exact penetrance for breast cancer among BRCA1 mutation carriers may be due to several factors including differences owing to study design, allelic heterogeneity and to modifying genetic and or environmental factors. Pakistani population, although offers the potential to explore the contribution that consanguinity makes to breast cancer, but that seems to be specific for hereditary form of the cancer and it might not be the case for sporadic cancer. It is possible that no or marginally low germline mutations are present for BRCA1, specifically in the case of sporadic cancer</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>The continuing uncertainty as to the exact penetrance for breast cancer among BRCA1 mutation carriers may be due to several factors including differences owing to study design, allelic heterogeneity and to modifying genetic and or environmental factors. Pakistani population, although offers the potential to explore the contribution that consanguinity makes to breast cancer, but that seems to be specific for hereditary form of the cancer and it might not be the case for sporadic cancer. It is possible that no or marginally low germline mutations are present for BRCA1, specifically in the case of sporadic cancer</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<p>Hereditary artifacts in BRCA1 gene have a significant contributory role in familial cases of breast cancer. However, its germline mutational penetrance in sporadic breast cancer cases with respect to Pakistani population has not yet been very well defined. This study was designed to assess the contributory role of germline mutations of this gene in sporadic cases of breast cancer. 150 cases of unilateral breast cancer patients, with no prior family history of breast cancer and no other disorders or diseases in general with age range 35–75 yrs, were included in this study.</p>","<p>Mutational analysis for hot spots on Exon 2, 3 and 13 of BRCA1 was done by using Single Strand Conformational Polymorphism (SSCP). Sequence analysis revealed five variants (missense) and one novel splice site mutation at exon 13. No germline mutation was observed on the remaining exons with respect sporadic breast cancer cases in Pakistani population. A vast majority of breast cancer cases are sporadic; the present study may be helpful for designing a better genetic screening tool for germline BRCA mutations in sporadic breast cancer patients of Pakistani population. Further studies involving a screening of entire coding region of BRCA1 is required to explore the merits of genetic diagnosis and counseling in breast cancer patients.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<p>Hereditary artifacts in BRCA1 gene have a significant contributory role in familial cases of breast cancer. However, its germline mutational penetrance in sporadic breast cancer cases with respect to Pakistani population has not yet been very well defined. This study was designed to assess the contributory role of germline mutations of this gene in sporadic cases of breast cancer. 150 cases of unilateral breast cancer patients, with no prior family history of breast cancer and no other disorders or diseases in general with age range 35–75 yrs, were included in this study.</p>\",\n \"<p>Mutational analysis for hot spots on Exon 2, 3 and 13 of BRCA1 was done by using Single Strand Conformational Polymorphism (SSCP). Sequence analysis revealed five variants (missense) and one novel splice site mutation at exon 13. No germline mutation was observed on the remaining exons with respect sporadic breast cancer cases in Pakistani population. A vast majority of breast cancer cases are sporadic; the present study may be helpful for designing a better genetic screening tool for germline BRCA mutations in sporadic breast cancer patients of Pakistani population. Further studies involving a screening of entire coding region of BRCA1 is required to explore the merits of genetic diagnosis and counseling in breast cancer patients.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Authors' contributions</title>","<p>FAM performed laboratory tests and prepared the manuscript; SA, IAB, AM, MA and RS contributed clinical samples and clinical information; MAK and WGJ participated in study design, coordination and manuscript preparation.</p>"],"string":"[\n \"<title>Authors' contributions</title>\",\n \"<p>FAM performed laboratory tests and prepared the manuscript; SA, IAB, AM, MA and RS contributed clinical samples and clinical information; MAK and WGJ participated in study design, coordination and manuscript preparation.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>We are extremely thankful to all those patients who took part in this study and want to extend our immense gratitude for the above mentioned institutes for their friendly response and support in this research. Funding approved by COMSATS Institute of information Technology for research work is highly acknowledged by our group.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>We are extremely thankful to all those patients who took part in this study and want to extend our immense gratitude for the above mentioned institutes for their friendly response and support in this research. Funding approved by COMSATS Institute of information Technology for research work is highly acknowledged by our group.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Graphical display of the number of participants from the four provinces.</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Germline mutation of exon-13 of BRCA1 with splice site deletion.</bold><underline>A</underline>: SSCP mobility shift of the amplified region in exon-13. White arrow: wild type from normal controls; dark arrow: mutated product from a patient showing the mobility shift. <underline>B</underline>: sequence verification of the deleted nucleotide as indicated in <underline>A</underline>. Arrow indicates the missing nucleotide A in the exon13 splice site.</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p>Graphical display of the number of participants from the four provinces.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p><bold>Germline mutation of exon-13 of BRCA1 with splice site deletion.</bold><underline>A</underline>: SSCP mobility shift of the amplified region in exon-13. White arrow: wild type from normal controls; dark arrow: mutated product from a patient showing the mobility shift. <underline>B</underline>: sequence verification of the deleted nucleotide as indicated in <underline>A</underline>. Arrow indicates the missing nucleotide A in the exon13 splice site.</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Information on source of patients from the participating institutes</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">Basic Characteristics of cases and Controls</td><td align=\"center\">Breast Cases (%)</td><td align=\"center\">Normal Control Group (%)</td></tr></thead><tbody><tr><td align=\"center\">NFP1: Cases from Punjab Province</td><td align=\"center\">66 (44)</td><td align=\"center\">25</td></tr><tr><td align=\"center\">NFB2: Cases from Blochistan Province</td><td align=\"center\">28 (19)</td><td align=\"center\">25</td></tr><tr><td align=\"center\">NFNWFP3: Cases from North Western Frontier Province</td><td align=\"center\">35 (23)</td><td align=\"center\">25</td></tr><tr><td align=\"center\">NFS4: Cases from Sindh Province</td><td align=\"center\">21 (14)</td><td align=\"center\">25</td></tr><tr><td align=\"center\"><underline>Total number</underline></td><td align=\"center\"><underline>150</underline></td><td align=\"center\"><underline>100</underline></td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T2\"><label>Table 2</label><caption><p>Primer sequences for exons 2, 3, & 13</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>BRCA1</bold></td><td align=\"left\" colspan=\"2\"><bold>EXON</bold></td><td align=\"left\"><bold>PRIMER Sequences(5'-to-3')</bold></td><td align=\"left\"><bold>Product size</bold></td><td align=\"left\"><bold>Tm(°C)</bold></td></tr></thead><tbody><tr><td/><td align=\"left\">EXON2</td><td align=\"left\">F</td><td align=\"left\">GGTTGTGATTAGTTCTTTGG</td><td align=\"left\">458</td><td align=\"left\">51.3</td></tr><tr><td/><td/><td align=\"left\">R</td><td align=\"left\">GTGTTGAAAAGGAGAGGAGT</td><td/><td align=\"left\">53.4</td></tr><tr><td/><td align=\"left\">EXON3</td><td align=\"left\">R</td><td align=\"left\">GAATGAAATGGAGTTGGATT</td><td align=\"left\">381</td><td align=\"left\">55.81</td></tr><tr><td/><td/><td align=\"left\">F</td><td align=\"left\">AGGATCGTATTCTCTGCTGT</td><td/><td align=\"left\">53.98</td></tr><tr><td/><td align=\"left\">EXON13</td><td align=\"left\">R</td><td align=\"left\">AGAACCAAGGCTCCATAAT</td><td align=\"left\">476</td><td align=\"left\">54</td></tr><tr><td/><td/><td align=\"left\">F</td><td align=\"left\">ATTGCATGAATGTGGTTAGA</td><td/><td align=\"left\">53.76</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T3\"><label>Table 3</label><caption><p>Summary of the prevalence of BRCA1 mutation in the study cohort</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\"><bold>Gene</bold></td><td align=\"center\"><bold>Exon</bold></td><td align=\"center\"><bold>Number and location of chroms</bold></td><td align=\"center\"><bold>Prevalence percentage</bold></td></tr></thead><tbody><tr><td align=\"center\">BRCA1</td><td align=\"center\">13</td><td align=\"center\">5</td><td align=\"center\">3.33%</td></tr><tr><td align=\"center\"><bold>Truncated Mutation*</bold></td><td align=\"center\">13</td><td align=\"center\">1</td><td align=\"center\">0.66%</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Information on source of patients from the participating institutes</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"center\\\">Basic Characteristics of cases and Controls</td><td align=\\\"center\\\">Breast Cases (%)</td><td align=\\\"center\\\">Normal Control Group (%)</td></tr></thead><tbody><tr><td align=\\\"center\\\">NFP1: Cases from Punjab Province</td><td align=\\\"center\\\">66 (44)</td><td align=\\\"center\\\">25</td></tr><tr><td align=\\\"center\\\">NFB2: Cases from Blochistan Province</td><td align=\\\"center\\\">28 (19)</td><td align=\\\"center\\\">25</td></tr><tr><td align=\\\"center\\\">NFNWFP3: Cases from North Western Frontier Province</td><td align=\\\"center\\\">35 (23)</td><td align=\\\"center\\\">25</td></tr><tr><td align=\\\"center\\\">NFS4: Cases from Sindh Province</td><td align=\\\"center\\\">21 (14)</td><td align=\\\"center\\\">25</td></tr><tr><td align=\\\"center\\\"><underline>Total number</underline></td><td align=\\\"center\\\"><underline>150</underline></td><td align=\\\"center\\\"><underline>100</underline></td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T2\\\"><label>Table 2</label><caption><p>Primer sequences for exons 2, 3, & 13</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\"><bold>BRCA1</bold></td><td align=\\\"left\\\" colspan=\\\"2\\\"><bold>EXON</bold></td><td align=\\\"left\\\"><bold>PRIMER Sequences(5'-to-3')</bold></td><td align=\\\"left\\\"><bold>Product size</bold></td><td align=\\\"left\\\"><bold>Tm(°C)</bold></td></tr></thead><tbody><tr><td/><td align=\\\"left\\\">EXON2</td><td align=\\\"left\\\">F</td><td align=\\\"left\\\">GGTTGTGATTAGTTCTTTGG</td><td align=\\\"left\\\">458</td><td align=\\\"left\\\">51.3</td></tr><tr><td/><td/><td align=\\\"left\\\">R</td><td align=\\\"left\\\">GTGTTGAAAAGGAGAGGAGT</td><td/><td align=\\\"left\\\">53.4</td></tr><tr><td/><td align=\\\"left\\\">EXON3</td><td align=\\\"left\\\">R</td><td align=\\\"left\\\">GAATGAAATGGAGTTGGATT</td><td align=\\\"left\\\">381</td><td align=\\\"left\\\">55.81</td></tr><tr><td/><td/><td align=\\\"left\\\">F</td><td align=\\\"left\\\">AGGATCGTATTCTCTGCTGT</td><td/><td align=\\\"left\\\">53.98</td></tr><tr><td/><td align=\\\"left\\\">EXON13</td><td align=\\\"left\\\">R</td><td align=\\\"left\\\">AGAACCAAGGCTCCATAAT</td><td align=\\\"left\\\">476</td><td align=\\\"left\\\">54</td></tr><tr><td/><td/><td align=\\\"left\\\">F</td><td align=\\\"left\\\">ATTGCATGAATGTGGTTAGA</td><td/><td align=\\\"left\\\">53.76</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T3\\\"><label>Table 3</label><caption><p>Summary of the prevalence of BRCA1 mutation in the study cohort</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"center\\\"><bold>Gene</bold></td><td align=\\\"center\\\"><bold>Exon</bold></td><td align=\\\"center\\\"><bold>Number and location of chroms</bold></td><td align=\\\"center\\\"><bold>Prevalence percentage</bold></td></tr></thead><tbody><tr><td align=\\\"center\\\">BRCA1</td><td align=\\\"center\\\">13</td><td align=\\\"center\\\">5</td><td align=\\\"center\\\">3.33%</td></tr><tr><td align=\\\"center\\\"><bold>Truncated Mutation*</bold></td><td align=\\\"center\\\">13</td><td align=\\\"center\\\">1</td><td align=\\\"center\\\">0.66%</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1477-7800-5-21-1\"/>","<graphic xlink:href=\"1477-7800-5-21-2\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1477-7800-5-21-1\\\"/>\",\n \"<graphic xlink:href=\\\"1477-7800-5-21-2\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Anderson\", \"Tian-Wei\", \"Malgorzata\", \"Dobrzy\\u00f1ska\", \"Ribas\", \"Marcos\"], \"given-names\": [\"D\", \"Y\", \"M\", \"G\", \"R\"], \"article-title\": [\"Effects in the comet assay of storage conditions on human blood\"], \"source\": [\"Teratogenesis Carcinogenesis and Mutagenesis\"], \"year\": [\"1997\"], \"volume\": [\"17\"], \"fpage\": [\"115\"], \"lpage\": [\"125\"], \"pub-id\": [\"10.1002/(SICI)1520-6866(1997)17:3<115::AID-TCM3>3.0.CO;2-K\"]}, {\"surname\": [\"Hofmann\", \"Wappenschmidt\", \"Berhane\", \"Schmutzler\", \"Scherneck\"], \"given-names\": [\"W\", \"B\", \"S\", \"R\", \"S\"], \"article-title\": [\"Detection of large rearrangements of exons 13 and 22 in the BRCA1 gene in German families\"], \"source\": [\"J Med Genet\"], \"year\": [\"2002\"], \"fpage\": [\"39\"], \"lpage\": [\"40\"]}, {\"surname\": [\"Seo\", \"Dae\", \"Cho Se\", \"Ahn\"], \"given-names\": [\"JH\", \"Y\", \"H\"], \"article-title\": [\"BRCA 1 and BRCA 2 germline mutations in Korean mutation with sporadic cancer\"], \"source\": [\"Human Mutation\"], \"year\": [\"2004\"], \"fpage\": [\"1\"], \"lpage\": [\"6\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":28,"string":"28"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:37"},"citation":{"kind":"string","value":"Int Semin Surg Oncol. 2008 Aug 29; 5:21"},"package_file":{"kind":"string","value":"oa_package/4b/fc/PMC2538523.tar.gz"}}},{"rowIdx":119688,"cells":{"accession_id":{"kind":"string","value":"PMC2538524"},"pmid":{"kind":"string","value":"18759966"},"introduction":{"kind":"list like","value":["<title>Introduction</title>","<p>The chiropractic profession has been in existence for over 110 years. In that time it has overcome a variety of hardships and adversities, including practitioners being jailed for practicing medicine without a license, attempts by the American Medical Association to contain and eliminate the profession, and general ostracism by many within and outside health care [##UREF##0##1##]. It has made some remarkable advances in recent years including substantial Federal funding of chiropractic research by the National Institutes of Health and the inclusion of chiropractic physicians in the Veterans Administration healthcare system. However, in spite of this, the profession has not gained a level credibility and cultural authority in mainstream society that is required to establish itself on equal ground with other healthcare professions. The profession still finds itself in a situation in which it is rated dead last amongst healthcare professions with regard to ethics and honesty [##UREF##1##2##], and in which only 7.5% of the population utilizes its services [##REF##15712765##3##], this percentage having dwindled from 10% only a short time ago [##REF##15712765##3##,##REF##8418405##4##].</p>","<p>Why have chiropractors not been able to establish themselves as a well-respected, highly utilized group of professionals who are widely seen by the public as offering essential services to society? Is it possible that the chiropractic profession can overcome its troubled past to become a mainstream, respected, highly utilized profession with an abundance of cultural authority? We believe so, and will point to the podiatric medical profession as an illustration of how the chiropractic profession could have established itself in mainstream health care, and perhaps still can.</p>","<title>The Example of Podiatry</title>","<p>Interestingly, the podiatric medical profession has been in existence in the United States (US) for about the same amount of time as chiropractic; the first licensing laws for podiatric physicians were enacted in 1895 [##UREF##2##5##]. In the US, podiatry grew up and matured as a new profession within the same healthcare environment as chiropractic, during a time when new professions (e.g., osteopathy, homeopathy, Thompsonism) were arising out of the failure of pre-Flexner allopathic medicine to provide beneficial care for a variety of human complaints [##REF##6356373##6##]. Yet, podiatrists currently find themselves far more established and respected in mainstream health care and society than chiropractors. According to the American Podiatric Medical Association (details can be found at <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.apma.org\"/>; accessed 29 May, 2008) many, perhaps most, major hospitals provide podiatry services, podiatrists regularly serve on the staffs of long-term care facilities, are included on the faculties of schools of medicine, serve as commissioned officers in the Armed Forces, in the US Public Health Service and in many municipal health departments.</p>","<p>We suggest the chiropractic profession consider several questions that speak to the different histories of the chiropractic and podiatric profession. Why are podiatrists better integrated into hospitals [##REF##1517983##7##,##REF##17127158##8##] and other multidisciplinary facilities [##REF##8868674##9##,##REF##15301988##10##] than chiropractors? Why are most schools of podiatry integrated into the university system, while chiropractic schools (with very few exceptions) are not? Why did the AMA not try to \"contain and eliminate\" the podiatric medical profession (despite the several turf battles podiatry has had with the orthopedic specialty)? Why were podiatrists not thrown in jail in the early days for practicing medicine without a license? How did podiatrists gain the level of cultural authority that they currently enjoy, despite having the same duration of existence and a smaller number of practitioners than chiropractic?</p>","<p>In the remainder of the paper we will address several key points regarding the professional attitudes and behaviors that permitted the podiatric profession to successfully mature. We feel that there are significant lessons to be learned from podiatry's successes, and that a critical look at our profession can help us to correct our mistakes and move ourselves in the direction of cultural authority, widespread acceptance, public confidence, and wide utilization.</p>","<title>1. Public Health</title>","<p>One important reason podiatry succeeded in establishing itself in mainstream health care was its traditional dedication to public health [##REF##3625509##11##, ####REF##11679629##12##, ##REF##10466298##13##, ##REF##9680773##14####9680773##14##]. Podiatrists became active members of the American Public Health Association (APHA) as far back as the 1950's, embracing and contributing to the advancement of accepted public health initiatives, in cooperation with others involved in public health. Podiatrists slowly gained an image as proponents of public health, at a time when many chiropractors aggressively (and dogmatically, without evidence [##REF##15530683##15##]) opposed many public health measures such as vaccination and water fluoridation. As a result, podiatrists became influential members of the healthcare community, and foot health became widely recognized as an important component to overall human health.</p>","<p>The chiropractic profession should openly embrace, and become actively involved in, established public health initiatives. The APHA is by far the largest and most influential public health organization in the United States. It wields tremendous influence on policy and procedure in our healthcare system. In 1983 a few chiropractic pioneers began what eventually became the Chiropractic Section of APHA [##UREF##3##16##]. This section is made up of dedicated individuals who care about promoting and taking part in APHA activities. Some examples of these activities are provided in Table ##TAB##0##1##. However, these dedicated individuals did this with very little support from the profession as a whole. Even now, very few chiropractic physicians are members of the APHA.</p>","<p>One immediate action step that individual chiropractic physicians can make is to join and become active in the APHA. This would be one of the best ways for chiropractors to have an influence on public health policy. Spinal pain is an enormous public health issue, as the vast majority of Americans will develop a painful back or neck that will require treatment some time in their lives. Back pain-related conditions make up three of the top 10 conditions in the US, and the cost to society from spinal pain is amongst the highest for any condition [##REF##9871888##17##, ####REF##16418644##18##, ##REF##12553174##19####12553174##19##]. Employers are looking for ways to prevent disability from low back pain on the job, and we could fill tremendous void in public health by providing educational programs to the public on how to prevent spinal pain and its related disability. This could provide exposure of chiropractors to a variety of segments of society (since all are affected by spinal pain), including athletes, the elderly, children, workers and military personnel.</p>","<p>It is also vital that those chiropractors who dogmatically oppose common public health practices, such as immunization [##REF##15530683##15##] and public water fluoridation, cease such unfounded activity. In fact, because of the traditional chiropractic opposition of these well-accepted public health practices, there was major concern regarding whether chiropractic would even be accepted within the APHA [##UREF##3##16##]. In addition, the profession must take an honest public health-oriented approach to clinical practice and wellness care by becoming more involved in teaching patients how to stay healthy without frequent, endless visits to chiropractic offices. We are concerned that the common perception (which is well supported, in our experience) that chiropractors are only interested in \"selling\" a lifetime of chiropractic visits may be one of the primary factors behind our low standing in the minds of members of the public [##UREF##1##2##]. This is supported by a Canadian study which found that when the public was educated about \"subluxation\", the cornerstone of many chiropractors' \"lifetime treatment plans\", members of the public actually developed a negative view, and were more likely to want to consult a medical doctor to see if they had a subluxation prior to seeing a chiropractor [##UREF##4##20##]. The recommendation for repetitive life-long chiropractic treatment compromises any attempt at establishing a positive public health image and needs to change. Public health is ultimately about self-empowerment and teaching people how to take care of themselves, with an emphasis on prevention and health maintenance. The chiropractic profession should adopt the APHA's scientifically-grounded emphasis on nutrition and exercise as the \"keys to wellness\" (<ext-link ext-link-type=\"uri\" xlink:href=\"http://www.apha.org/publications/tnh/archives/2003/05-03/Globe/1040.htm\"/>; accessed 3 June, 2008), as opposed to the common \"lifetime adjustments\" approach.</p>","<title>2. Educational Reform</title>","<p>In 1961 podiatric medicine underwent its own version of allopathic medicine's Flexner Report. Known as the Selden Commission Report [##REF##8803408##21##,##REF##3305865##22##], it led to several improvements in podiatric medical education, some of which are similar to improvements that have been made to chiropractic education, including the adoption of identical requirements to those of all medical schools, advances in faculty development and major library expansion. In addition to these upgrades in the podiatric educational requirements, the Selden Commission report promoted the placement of podiatric education under the aegis of universities, with the inclusion of federally funded research [##REF##8803408##21##]. This led to further movement of the podiatric medical profession toward integration within the healthcare system by mainstreaming its educational institutions as well as demonstrating, and providing support for, its commitment to research. Equally important, it led to the recognition of podiatric physicians as being on equal par with Medical Doctors, Doctors of Osteopathy and Dentists [##REF##3305865##22##]. More recently, the podiatric medical profession has undergone an Educational Enhancement Project [##REF##8803406##23##] in which the profession examined its educational process, from the point of acceptance to podiatry school to the point of becoming board certified. Comparisons to allopathic and osteopathic education were undergone to determine those areas in which podiatric education fell short. Changes were made to bring podiatric education up to par with that of these other professions.</p>","<p>According to the American Association of Colleges of Podiatric Medicine, there are eight accredited schools of podiatric medicine in the United States, with five of these programs (62.5%) based within a university setting. Having podiatric education integrated within a university setting brings a certain level of respect as a mainstream profession. The culture of University-based academics stresses the importance of scholarship amongst faculty as well as academic freedom. This allows for growth and change of the profession's knowledge base [##UREF##5##24##]. It also allows for interaction between the podiatry students and students of other disciplines, fostering integration and understanding about their unique specialty.</p>","<p>The chiropractic profession has at times made significant advances in classroom education and accreditation. Known as \"Chiropractic's Abraham Flexner\" [##UREF##0##1##], John J. Nugent, DC helped bring about a number of beneficial changes in chiropractic education, including increasing the number of years for chiropractic education, the conversion of chiropractic \"trade schools\" into non-profit professional institutions and the standardization of curricula. It must be noted that Nugent was despised by many within chiropractic, particularly BJ Palmer, because of his efforts [##UREF##0##1##]. In addition, even with the efforts of Nugent and others in bringing about improvement, chiropractic education still remains behind other health professions in a number of key areas, particularly those of clinical exposure of students to a variety of clinical situations [##REF##15967045##25##] and involvement of faculty in the advancement of new knowledge in the field [##REF##16872544##26##].</p>","<p>We feel that the profession must undergo its own version of the Flexner Report in medicine, and/or the Selden Commission Report and Educational Enhancement Project in podiatry. That is, we must take a critical look at our educational institutions, find what is substandard, and correct those deficiencies. One of the problems that we encounter frequently in our interaction with chiropractic educational institutions is the perpetuation of dogma and unfounded claims. Examples include the concept of spinal subluxation as the cause of a variety of internal diseases and the metaphysical, pseudo-religious idea of \"innate intelligence\" flowing through spinal nerves, with spinal subluxations impeding this flow. These concepts are lacking in a scientific foundation [##REF##16092955##27##, ####UREF##6##28##, ##UREF##7##29####7##29##] and should not be permitted to be taught at our chiropractic institutions as part of the standard curriculum. Much of what is passed off as \"chiropractic philosophy\" is simply dogma [##UREF##8##30##], or untested (and, in some cases, untestable) theories [##REF##16092955##27##] which have no place in an institution of higher learning, except perhaps in an historical context. Faculty members who hold to and teach these belief systems should be replaced by instructors who are knowledgeable in the evidence-based approach to spine care and have adequate critical thinking skills that they can pass on to students directly, as well as through teaching by example in the clinic.</p>","<p>In addition, chiropractic faculty should be required to engage in research and scholarship. Currently, the bulk of such activity in chiropractic educational institutions is carried out by just a few individuals, with a recent trend toward a falling publication rate [##REF##16872544##26##]. In most other traditional university settings, including podiatric colleges, faculty are expected to \"publish or perish\". This level of academic excellence needs to permeate the chiropractic colleges as well.</p>","<p>Consideration should also be given to upgrading admission requirements to chiropractic schools. In podiatric medicine, such upgrading, which included the requirement of the Medical College Admission Test (MCAT), a requirement of medical school admission, is considered one of the significant events in the profession's history, giving the profession legitimacy in its calls for parity with medicine [##REF##8803408##21##]. Lest there be concern amongst chiropractic colleges for diminishing enrollment if this type of upgrade were instituted, it should be noted that podiatric medicine experienced an increase in students following the institution of the MCAT requirement [##REF##8803408##21##].</p>","<title>3. Residency Programs in Hospitals</title>","<p>The podiatric medical profession began hospital-based postgraduate training in 1956 [##REF##1460571##31##]. This training was officially sanctioned as a residency program in 1965 [##REF##1460571##31##]. Important in the progress of residency training was when podiatric regulatory bodies started requiring residency training as a condition of licensure [##REF##1460571##31##]. So the development and progression of residency training in podiatry was brought about not only by the academic portion of the profession, but also by the regulatory portion. This led not only to improved clinical competence of podiatrists, but also to greater respect for, and confidence in, podiatric physicians on the part other healthcare groups as well as by the public at large. Working within hospital-based residency programs allowed podiatrists to be considered peers of the medical community. This type of professional and cultural authority has its roots in the daily interaction between podiatric residents and the other medical physicians in these hospital-based residency programs.</p>","<p>It is essential that the chiropractic profession establish hospital-based residencies [##REF##15967045##25##]. There is a tremendous void in how chiropractic graduates develop any meaningful hands-on clinical experience with real patients in real life situations. It is widely recognized in medical and podiatric education that abundant exposure to clinical environments is essential to developing top-quality professions. The Council on Chiropractic Education requirement of 250 adjustments forces interns to use manipulation on patients whether they need it or not, and the radiographic requirement forces interns to take radiographs on patients whether they need them or not. Rather than focus on interns meeting certain numerical requirements, interns should be encouraged to develop clinical decision making and patient management skills. Further, the emphasis on achieving a certain number of procedures as opposed to the acquisition of skill and knowledge impedes the development of professional moral reasoning by training interns to use patients as a means to meet their own goals, rather than focusing on the needs of the patients themselves.</p>","<p>The chiropractic internship should, as with medicine and podiatry, occur <italic>after </italic>graduation. Because chiropractic physicians are not trained in surgery, it may not have to last the full four years that many podiatry residencies entail [##REF##1460571##31##], but we feel that the post-graduate internship should last a full year, with a second year of residency following the internship. The internship and residency should occur partly in a hospital, and partly in outpatient centers of excellence in which the intern/resident takes part in clinical decision making and patient management under the supervision of chiropractic physicians who are among the top in their field.</p>","<p>Chiropractic regulatory bodies such as state boards of chiropractic medicine should move in the direction of requiring the completion of postgraduate residency training as a condition of licensure. As was the case in podiatric medicine, this new requirement would force the profession to upgrade the training of its new practitioners to include a post-graduate residency.</p>","<title>4. Clear Identity</title>","<p>Perhaps the most important factor that helped the podiatric medical profession to flourish was the fact that podiatrists had a clear identity and purpose; the podiatric medical profession was founded on the purpose of filling a need in society – the care of problems of the foot. They did not invent a \"lesion\" and a \"philosophy\" and try to force it on the public. They certainly did not claim that all disease arose from the foot, without any evidence to support this notion. The podiatric medical profession simply did what credible and authoritative professions do [##UREF##9##32##] – they provided society with services that people actually wanted and needed.</p>","<p>The podiatric medical profession focused on a particular set of problems for which allopathic medicine had little interest and a limited ability to deal with effectively, i.e., common foot disorders [##REF##6356373##6##]. A key occurrence in the development of the podiatric profession was when the AMA determined that medical physicians should not get involved with \"minor\" foot problems. This opened the door for podiatrists to flourish in their chosen area of specialty, and retain complete control of their scope of practice without fear of intrusion by organized medicine [##REF##6356373##6##]. The podiatric medical profession did not challenge the medical profession with claims of being an alternative method of treatment for medical problems.</p>","<p>The chiropractic profession must establish a clear identity and present this to society. In the beginning, DD Palmer invented a lesion, and a theory behind this lesion, and developed a profession of individuals who would become champions of that lesion. This is not what credible professions do. A credible profession is one that is established by society to meet a need that society itself has decided must be met [##UREF##9##32##]. Based on all the evidence regarding chiropractic practice and education, there is only one societal need (but it is a huge one) that chiropractic medicine has the potential to meet: non-surgical spine care. Our education and training is focused on the spine, and clearly if there is a common bond among all chiropractors, it is spine care [##REF##16000175##33##]. While there are a variety of practitioners who offer spine care (physical therapists, osteopaths, movement specialists, massage therapists) there is no physician-level specialty that has carved a niche as society's one-and-only non-surgical spine specialist whose expertise is focused on the diagnosis and management of spine disorders.</p>","<p>We often hear from chiropractors that \"chiropractic is more than just back pain\". But is it? And, more importantly, does it have to be? Studies have demonstrated that yes, chiropractic is more than just back pain. It is back pain, neck pain and, occasionally, headache [##REF##9585743##34##, ####REF##15300137##35##, ##REF##11805694##36####11805694##36##]. We feel that the primary reason the chiropractic profession has survived for 110+ years to the extent that it has is that manipulation is very helpful for many people with back and neck pain. Back pain, neck pain and headache are virtually the only reasons people consult chiropractors [##REF##9585743##34##, ####REF##15300137##35##, ##REF##11805694##36####11805694##36##].</p>","<p>Some chiropractors reading this statement may be thinking, \"This may apply to the rest of the profession, but my patients see me for wellness and a variety of visceral problems\". We would ask these readers to look critically at this assumption. Hawk, et al [##REF##11313611##37##] sought out practices that made that very claim, i.e., practices that claimed that a substantial percentage of their patients saw them for non-musculoskeletal complaints. They asked the patients the reason they were attending for treatment. Ninety percent of the patients stated that they were seeing the chiropractor for musculoskeletal problems. Recall that these were practices that were specifically sought out because they claimed to see a high percentage of non-musculoskeletal complaints. Before any chiropractor thinks of his or her practice as including a large number of non-musculoskeletal conditions, we suggest they ask their patients first. Or, better yet, have an independent source ask the patients. Chances are the reality will be much different than the perception.</p>","<p>No matter how one looks at it, or what one would like reality to be, chiropractic medicine is about back pain, neck pain and headache. Instead of fighting that fact (or denying it), we should embrace it fully and focus on becoming society's go-to profession for disorders in this area. First, spine-related pain is one of the largest markets in all of health care. Considering neck/arm pain, back/leg pain and headache, virtually 100% of the population is potentially included [##REF##15561381##38##,##REF##16371911##39##] (contrast this with the fact that only 7.5% of the population currently see a chiropractor [##REF##15712765##3##]). Second, no medical specialty has successfully carved a niche for itself in this area (although the physical therapy profession is moving rapidly in this direction). Third, spine-related disorders create a great deal of suffering on the part of patients, in addition to exacting great costs on employers, the healthcare system and society at large. Providing much-needed high quality care to individuals suffering from spinal pain, as well as initiating and taking part in public health campaigns designed to educate people about spinal pain, would be a great service to society, and would bring millions of new patients to chiropractic offices, patients who would not ordinarily consider seeing a chiropractic physician.</p>","<p>The chiropractic profession fairly recently had a unique opportunity to catapult itself into the role of society's non-surgical spine specialists. In 1994 the Agency for Health Care Policy and Research released its guidelines on the management of acute low back pain in adults [##UREF##10##40##]. These guidelines recommended spinal manipulation as one of the only treatments for which adequate evidence existed for its efficacy. The report received a great deal of media coverage, with some media outlets actually mistakenly identifying \"chiropractic\", rather than \"manipulation\" as the recommended first-line approach. We could have used this as a springboard to moving ourselves into the mainstream as the premier non-surgical spine specialists in society. However, the profession did not jump at the chance, largely, in our experience, for fear of being \"limited\" by the image. Ironically, the profession chose to avoid being \"limited\" to the management of a group of disorders (back pain, neck pain and headache) that affect virtually 100% of the population through all stages of life [##REF##18404112##41##]. In the interim it has seen its market share dwindle from 10% of the population [##REF##8418405##4##] to 7.5% [##REF##15712765##3##,##REF##15188733##42##]. Even amongst patients with back pain, the proportion of patients seeing chiropractors dropped significantly between 1987 and 1997, a period of time in which the proportion seeing both medical doctors and physical therapists increased [##REF##14749194##43##].</p>","<p>It is interesting that chiropractors have traditionally prided themselves on being \"holistic\". The emerging model of modern spine care is the \"biopsychosocial\" model [##UREF##11##44##]. That is, it is increasingly recognized that in order to provide optimum care for patients with spine-related disorders, one has to consider the <italic>whole person</italic>. Thus, non-surgical spine care provides chiropractic medicine with a wonderful opportunity to provide truly holistic care for patients, and to be recognized for expertise in this area. This would certainly be a drastic departure from the reductionistic subluxation-only approach, which \"reduces\" the cause and care of health problems to a spinal subluxation. Further, because the biopsychosocial approach often requires multidisciplinary involvement, embracing this model will further help to integrate chiropractic medicine into mainstream health care.</p>","<p>The World Federation of Chiropractic (WFC) has taken an important step in establishing a clear identity for chiropractors as \"The spinal health care experts in the health care system\" [##UREF##12##45##]. It is critical that other state, provincial and national associations follow the lead of the WFC.</p>","<title>5. Fidelity to the Social Contract</title>","<p>The professions, which classically included medicine, law and the ministry, are vocations whose members \"profess\" to have knowledge that the laity do not comprehend. Given the asymmetry of knowledge between professionals and the laity, society has granted to the professions a certain degree of autonomous control over themselves. However, this social contract demands that each profession, and each professional, place the wellbeing of society and the patient, client or parishioner ahead of the profession and professional. Lay persons put their faith in the professional following the dictum <italic>credat emptor </italic>(let the buyer have faith) rather than <italic>caveat emptor </italic>(let the buyer beware) [##UREF##9##32##]. This social contract imparts great freedom on all professions, but with this freedom comes great responsibility.</p>","<p>When an individual consults a member of any of the medical professions, it is reasonably expected that the advice and treatment that he or she receives is based in science, not metaphysics or pseudoscience. In addition, it is reasonably expected that the services he or she receives are being provided for the primary purpose of benefiting the patient, and not for any other reason. The financial benefit to the professional is secondary, and results from the degree of clinical benefit received by the patient. Patients place their faith in the professional, and trust that they will not be subject to fraud, abuse or quackery. This is the social contract as it applies to chiropractic physicians.</p>","<p>By focusing on a specific set of clinical problems (i.e., foot disorders) for which society had a demonstrable need for professional services, using the scientific method to explore ways to better serve society, consistently upgrading their clinical training, and appropriately policing themselves, podiatrists have successfully fulfilled the social contract. As a result, it is our experience that podiatrists are widely perceived by the public to be ethical and honest professionals who generally have their patient's best interests at heart.</p>","<p>The chiropractic profession has an obligation to actively divorce itself from metaphysical explanations of health and disease as well as to actively regulate itself in refusing to tolerate fraud, abuse and quackery, which are more rampant in our profession than in other healthcare professions [##REF##15389179##46##]. This must be done on an individual practitioner basis as well as by the political, educational and regulatory bodies. In this way the profession can fulfill its responsibility to the social contract. This will dramatically increase the level of trust in and respect for the profession from society at large.</p>","<title>6. Podiatrists and Foot Reflexologists</title>","<p>We feel it is important here to briefly contrast and compare podiatry and foot reflexology. While the two professions have always been distinct, there is commonality in that each focuses its treatment efforts on the foot; however, this is where any resemblance between the two professions ends. Podiatric medicine is a science-based profession dedicated to the diagnosis and treatment of foot disorders. Foot reflexology is a metaphysically-based group consisting of non-physicians who believe that many physical disorders arise from the foot. Podiatrists have rejected foot reflexology as an unproven and unscientific practice, and do not consider it part of mainstream podiatric practice. Thus, it would be quite unreasonable to think that podiatry and foot reflexology could ever exist under one professional roof.</p>","<p>Yet, this is the very untenable situation in which we find ourselves in the chiropractic profession. Chiropractic has frequently been described as being two professions masquerading as one, and those two professions have attempted to live under one roof. One profession, the \"subluxation-based\" profession, occupies the same metaphysical and pseudoscientific space as foot reflexology. The other chiropractic profession – call it \"chiropractic medicine\" as we do in this commentary – has attempted to occupy the same scientific space as the podiatric profession. Alas, the marriage of convenience between these two chiropractic professions living under one roof has not worked. We find science-based practitioners and organizations alongside quasi-metaphysical, pseudoreligious, pseudoscientific practitioners and organizations. The result is continual battling with a huge waste of energy and resources, while professional growth stagnates.</p>","<p>We must finally come to the painful realization that the chiropractic concept of spinal subluxation as the cause of \"dis-ease\" within the human body is an untested hypothesis [##REF##16092955##27##]. It is an albatross around our collective necks that impedes progress. There can be no unity between the majority of non-surgical spine specialist chiropractic physicians and the minority of chiropractors who espouse metaphysical, pseudoreligious views of spinal subluxations as \"silent killers\" [##UREF##13##47##]. The latter minority group needs to be marginalized from the mainstream majority group, and no longer should unrealistic efforts be made toward unification of these disparate factions within the profession.</p>"],"string":"[\n \"<title>Introduction</title>\",\n \"<p>The chiropractic profession has been in existence for over 110 years. In that time it has overcome a variety of hardships and adversities, including practitioners being jailed for practicing medicine without a license, attempts by the American Medical Association to contain and eliminate the profession, and general ostracism by many within and outside health care [##UREF##0##1##]. It has made some remarkable advances in recent years including substantial Federal funding of chiropractic research by the National Institutes of Health and the inclusion of chiropractic physicians in the Veterans Administration healthcare system. However, in spite of this, the profession has not gained a level credibility and cultural authority in mainstream society that is required to establish itself on equal ground with other healthcare professions. The profession still finds itself in a situation in which it is rated dead last amongst healthcare professions with regard to ethics and honesty [##UREF##1##2##], and in which only 7.5% of the population utilizes its services [##REF##15712765##3##], this percentage having dwindled from 10% only a short time ago [##REF##15712765##3##,##REF##8418405##4##].</p>\",\n \"<p>Why have chiropractors not been able to establish themselves as a well-respected, highly utilized group of professionals who are widely seen by the public as offering essential services to society? Is it possible that the chiropractic profession can overcome its troubled past to become a mainstream, respected, highly utilized profession with an abundance of cultural authority? We believe so, and will point to the podiatric medical profession as an illustration of how the chiropractic profession could have established itself in mainstream health care, and perhaps still can.</p>\",\n \"<title>The Example of Podiatry</title>\",\n \"<p>Interestingly, the podiatric medical profession has been in existence in the United States (US) for about the same amount of time as chiropractic; the first licensing laws for podiatric physicians were enacted in 1895 [##UREF##2##5##]. In the US, podiatry grew up and matured as a new profession within the same healthcare environment as chiropractic, during a time when new professions (e.g., osteopathy, homeopathy, Thompsonism) were arising out of the failure of pre-Flexner allopathic medicine to provide beneficial care for a variety of human complaints [##REF##6356373##6##]. Yet, podiatrists currently find themselves far more established and respected in mainstream health care and society than chiropractors. According to the American Podiatric Medical Association (details can be found at <ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www.apma.org\\\"/>; accessed 29 May, 2008) many, perhaps most, major hospitals provide podiatry services, podiatrists regularly serve on the staffs of long-term care facilities, are included on the faculties of schools of medicine, serve as commissioned officers in the Armed Forces, in the US Public Health Service and in many municipal health departments.</p>\",\n \"<p>We suggest the chiropractic profession consider several questions that speak to the different histories of the chiropractic and podiatric profession. Why are podiatrists better integrated into hospitals [##REF##1517983##7##,##REF##17127158##8##] and other multidisciplinary facilities [##REF##8868674##9##,##REF##15301988##10##] than chiropractors? Why are most schools of podiatry integrated into the university system, while chiropractic schools (with very few exceptions) are not? Why did the AMA not try to \\\"contain and eliminate\\\" the podiatric medical profession (despite the several turf battles podiatry has had with the orthopedic specialty)? Why were podiatrists not thrown in jail in the early days for practicing medicine without a license? How did podiatrists gain the level of cultural authority that they currently enjoy, despite having the same duration of existence and a smaller number of practitioners than chiropractic?</p>\",\n \"<p>In the remainder of the paper we will address several key points regarding the professional attitudes and behaviors that permitted the podiatric profession to successfully mature. We feel that there are significant lessons to be learned from podiatry's successes, and that a critical look at our profession can help us to correct our mistakes and move ourselves in the direction of cultural authority, widespread acceptance, public confidence, and wide utilization.</p>\",\n \"<title>1. Public Health</title>\",\n \"<p>One important reason podiatry succeeded in establishing itself in mainstream health care was its traditional dedication to public health [##REF##3625509##11##, ####REF##11679629##12##, ##REF##10466298##13##, ##REF##9680773##14####9680773##14##]. Podiatrists became active members of the American Public Health Association (APHA) as far back as the 1950's, embracing and contributing to the advancement of accepted public health initiatives, in cooperation with others involved in public health. Podiatrists slowly gained an image as proponents of public health, at a time when many chiropractors aggressively (and dogmatically, without evidence [##REF##15530683##15##]) opposed many public health measures such as vaccination and water fluoridation. As a result, podiatrists became influential members of the healthcare community, and foot health became widely recognized as an important component to overall human health.</p>\",\n \"<p>The chiropractic profession should openly embrace, and become actively involved in, established public health initiatives. The APHA is by far the largest and most influential public health organization in the United States. It wields tremendous influence on policy and procedure in our healthcare system. In 1983 a few chiropractic pioneers began what eventually became the Chiropractic Section of APHA [##UREF##3##16##]. This section is made up of dedicated individuals who care about promoting and taking part in APHA activities. Some examples of these activities are provided in Table ##TAB##0##1##. However, these dedicated individuals did this with very little support from the profession as a whole. Even now, very few chiropractic physicians are members of the APHA.</p>\",\n \"<p>One immediate action step that individual chiropractic physicians can make is to join and become active in the APHA. This would be one of the best ways for chiropractors to have an influence on public health policy. Spinal pain is an enormous public health issue, as the vast majority of Americans will develop a painful back or neck that will require treatment some time in their lives. Back pain-related conditions make up three of the top 10 conditions in the US, and the cost to society from spinal pain is amongst the highest for any condition [##REF##9871888##17##, ####REF##16418644##18##, ##REF##12553174##19####12553174##19##]. Employers are looking for ways to prevent disability from low back pain on the job, and we could fill tremendous void in public health by providing educational programs to the public on how to prevent spinal pain and its related disability. This could provide exposure of chiropractors to a variety of segments of society (since all are affected by spinal pain), including athletes, the elderly, children, workers and military personnel.</p>\",\n \"<p>It is also vital that those chiropractors who dogmatically oppose common public health practices, such as immunization [##REF##15530683##15##] and public water fluoridation, cease such unfounded activity. In fact, because of the traditional chiropractic opposition of these well-accepted public health practices, there was major concern regarding whether chiropractic would even be accepted within the APHA [##UREF##3##16##]. In addition, the profession must take an honest public health-oriented approach to clinical practice and wellness care by becoming more involved in teaching patients how to stay healthy without frequent, endless visits to chiropractic offices. We are concerned that the common perception (which is well supported, in our experience) that chiropractors are only interested in \\\"selling\\\" a lifetime of chiropractic visits may be one of the primary factors behind our low standing in the minds of members of the public [##UREF##1##2##]. This is supported by a Canadian study which found that when the public was educated about \\\"subluxation\\\", the cornerstone of many chiropractors' \\\"lifetime treatment plans\\\", members of the public actually developed a negative view, and were more likely to want to consult a medical doctor to see if they had a subluxation prior to seeing a chiropractor [##UREF##4##20##]. The recommendation for repetitive life-long chiropractic treatment compromises any attempt at establishing a positive public health image and needs to change. Public health is ultimately about self-empowerment and teaching people how to take care of themselves, with an emphasis on prevention and health maintenance. The chiropractic profession should adopt the APHA's scientifically-grounded emphasis on nutrition and exercise as the \\\"keys to wellness\\\" (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www.apha.org/publications/tnh/archives/2003/05-03/Globe/1040.htm\\\"/>; accessed 3 June, 2008), as opposed to the common \\\"lifetime adjustments\\\" approach.</p>\",\n \"<title>2. Educational Reform</title>\",\n \"<p>In 1961 podiatric medicine underwent its own version of allopathic medicine's Flexner Report. Known as the Selden Commission Report [##REF##8803408##21##,##REF##3305865##22##], it led to several improvements in podiatric medical education, some of which are similar to improvements that have been made to chiropractic education, including the adoption of identical requirements to those of all medical schools, advances in faculty development and major library expansion. In addition to these upgrades in the podiatric educational requirements, the Selden Commission report promoted the placement of podiatric education under the aegis of universities, with the inclusion of federally funded research [##REF##8803408##21##]. This led to further movement of the podiatric medical profession toward integration within the healthcare system by mainstreaming its educational institutions as well as demonstrating, and providing support for, its commitment to research. Equally important, it led to the recognition of podiatric physicians as being on equal par with Medical Doctors, Doctors of Osteopathy and Dentists [##REF##3305865##22##]. More recently, the podiatric medical profession has undergone an Educational Enhancement Project [##REF##8803406##23##] in which the profession examined its educational process, from the point of acceptance to podiatry school to the point of becoming board certified. Comparisons to allopathic and osteopathic education were undergone to determine those areas in which podiatric education fell short. Changes were made to bring podiatric education up to par with that of these other professions.</p>\",\n \"<p>According to the American Association of Colleges of Podiatric Medicine, there are eight accredited schools of podiatric medicine in the United States, with five of these programs (62.5%) based within a university setting. Having podiatric education integrated within a university setting brings a certain level of respect as a mainstream profession. The culture of University-based academics stresses the importance of scholarship amongst faculty as well as academic freedom. This allows for growth and change of the profession's knowledge base [##UREF##5##24##]. It also allows for interaction between the podiatry students and students of other disciplines, fostering integration and understanding about their unique specialty.</p>\",\n \"<p>The chiropractic profession has at times made significant advances in classroom education and accreditation. Known as \\\"Chiropractic's Abraham Flexner\\\" [##UREF##0##1##], John J. Nugent, DC helped bring about a number of beneficial changes in chiropractic education, including increasing the number of years for chiropractic education, the conversion of chiropractic \\\"trade schools\\\" into non-profit professional institutions and the standardization of curricula. It must be noted that Nugent was despised by many within chiropractic, particularly BJ Palmer, because of his efforts [##UREF##0##1##]. In addition, even with the efforts of Nugent and others in bringing about improvement, chiropractic education still remains behind other health professions in a number of key areas, particularly those of clinical exposure of students to a variety of clinical situations [##REF##15967045##25##] and involvement of faculty in the advancement of new knowledge in the field [##REF##16872544##26##].</p>\",\n \"<p>We feel that the profession must undergo its own version of the Flexner Report in medicine, and/or the Selden Commission Report and Educational Enhancement Project in podiatry. That is, we must take a critical look at our educational institutions, find what is substandard, and correct those deficiencies. One of the problems that we encounter frequently in our interaction with chiropractic educational institutions is the perpetuation of dogma and unfounded claims. Examples include the concept of spinal subluxation as the cause of a variety of internal diseases and the metaphysical, pseudo-religious idea of \\\"innate intelligence\\\" flowing through spinal nerves, with spinal subluxations impeding this flow. These concepts are lacking in a scientific foundation [##REF##16092955##27##, ####UREF##6##28##, ##UREF##7##29####7##29##] and should not be permitted to be taught at our chiropractic institutions as part of the standard curriculum. Much of what is passed off as \\\"chiropractic philosophy\\\" is simply dogma [##UREF##8##30##], or untested (and, in some cases, untestable) theories [##REF##16092955##27##] which have no place in an institution of higher learning, except perhaps in an historical context. Faculty members who hold to and teach these belief systems should be replaced by instructors who are knowledgeable in the evidence-based approach to spine care and have adequate critical thinking skills that they can pass on to students directly, as well as through teaching by example in the clinic.</p>\",\n \"<p>In addition, chiropractic faculty should be required to engage in research and scholarship. Currently, the bulk of such activity in chiropractic educational institutions is carried out by just a few individuals, with a recent trend toward a falling publication rate [##REF##16872544##26##]. In most other traditional university settings, including podiatric colleges, faculty are expected to \\\"publish or perish\\\". This level of academic excellence needs to permeate the chiropractic colleges as well.</p>\",\n \"<p>Consideration should also be given to upgrading admission requirements to chiropractic schools. In podiatric medicine, such upgrading, which included the requirement of the Medical College Admission Test (MCAT), a requirement of medical school admission, is considered one of the significant events in the profession's history, giving the profession legitimacy in its calls for parity with medicine [##REF##8803408##21##]. Lest there be concern amongst chiropractic colleges for diminishing enrollment if this type of upgrade were instituted, it should be noted that podiatric medicine experienced an increase in students following the institution of the MCAT requirement [##REF##8803408##21##].</p>\",\n \"<title>3. Residency Programs in Hospitals</title>\",\n \"<p>The podiatric medical profession began hospital-based postgraduate training in 1956 [##REF##1460571##31##]. This training was officially sanctioned as a residency program in 1965 [##REF##1460571##31##]. Important in the progress of residency training was when podiatric regulatory bodies started requiring residency training as a condition of licensure [##REF##1460571##31##]. So the development and progression of residency training in podiatry was brought about not only by the academic portion of the profession, but also by the regulatory portion. This led not only to improved clinical competence of podiatrists, but also to greater respect for, and confidence in, podiatric physicians on the part other healthcare groups as well as by the public at large. Working within hospital-based residency programs allowed podiatrists to be considered peers of the medical community. This type of professional and cultural authority has its roots in the daily interaction between podiatric residents and the other medical physicians in these hospital-based residency programs.</p>\",\n \"<p>It is essential that the chiropractic profession establish hospital-based residencies [##REF##15967045##25##]. There is a tremendous void in how chiropractic graduates develop any meaningful hands-on clinical experience with real patients in real life situations. It is widely recognized in medical and podiatric education that abundant exposure to clinical environments is essential to developing top-quality professions. The Council on Chiropractic Education requirement of 250 adjustments forces interns to use manipulation on patients whether they need it or not, and the radiographic requirement forces interns to take radiographs on patients whether they need them or not. Rather than focus on interns meeting certain numerical requirements, interns should be encouraged to develop clinical decision making and patient management skills. Further, the emphasis on achieving a certain number of procedures as opposed to the acquisition of skill and knowledge impedes the development of professional moral reasoning by training interns to use patients as a means to meet their own goals, rather than focusing on the needs of the patients themselves.</p>\",\n \"<p>The chiropractic internship should, as with medicine and podiatry, occur <italic>after </italic>graduation. Because chiropractic physicians are not trained in surgery, it may not have to last the full four years that many podiatry residencies entail [##REF##1460571##31##], but we feel that the post-graduate internship should last a full year, with a second year of residency following the internship. The internship and residency should occur partly in a hospital, and partly in outpatient centers of excellence in which the intern/resident takes part in clinical decision making and patient management under the supervision of chiropractic physicians who are among the top in their field.</p>\",\n \"<p>Chiropractic regulatory bodies such as state boards of chiropractic medicine should move in the direction of requiring the completion of postgraduate residency training as a condition of licensure. As was the case in podiatric medicine, this new requirement would force the profession to upgrade the training of its new practitioners to include a post-graduate residency.</p>\",\n \"<title>4. Clear Identity</title>\",\n \"<p>Perhaps the most important factor that helped the podiatric medical profession to flourish was the fact that podiatrists had a clear identity and purpose; the podiatric medical profession was founded on the purpose of filling a need in society – the care of problems of the foot. They did not invent a \\\"lesion\\\" and a \\\"philosophy\\\" and try to force it on the public. They certainly did not claim that all disease arose from the foot, without any evidence to support this notion. The podiatric medical profession simply did what credible and authoritative professions do [##UREF##9##32##] – they provided society with services that people actually wanted and needed.</p>\",\n \"<p>The podiatric medical profession focused on a particular set of problems for which allopathic medicine had little interest and a limited ability to deal with effectively, i.e., common foot disorders [##REF##6356373##6##]. A key occurrence in the development of the podiatric profession was when the AMA determined that medical physicians should not get involved with \\\"minor\\\" foot problems. This opened the door for podiatrists to flourish in their chosen area of specialty, and retain complete control of their scope of practice without fear of intrusion by organized medicine [##REF##6356373##6##]. The podiatric medical profession did not challenge the medical profession with claims of being an alternative method of treatment for medical problems.</p>\",\n \"<p>The chiropractic profession must establish a clear identity and present this to society. In the beginning, DD Palmer invented a lesion, and a theory behind this lesion, and developed a profession of individuals who would become champions of that lesion. This is not what credible professions do. A credible profession is one that is established by society to meet a need that society itself has decided must be met [##UREF##9##32##]. Based on all the evidence regarding chiropractic practice and education, there is only one societal need (but it is a huge one) that chiropractic medicine has the potential to meet: non-surgical spine care. Our education and training is focused on the spine, and clearly if there is a common bond among all chiropractors, it is spine care [##REF##16000175##33##]. While there are a variety of practitioners who offer spine care (physical therapists, osteopaths, movement specialists, massage therapists) there is no physician-level specialty that has carved a niche as society's one-and-only non-surgical spine specialist whose expertise is focused on the diagnosis and management of spine disorders.</p>\",\n \"<p>We often hear from chiropractors that \\\"chiropractic is more than just back pain\\\". But is it? And, more importantly, does it have to be? Studies have demonstrated that yes, chiropractic is more than just back pain. It is back pain, neck pain and, occasionally, headache [##REF##9585743##34##, ####REF##15300137##35##, ##REF##11805694##36####11805694##36##]. We feel that the primary reason the chiropractic profession has survived for 110+ years to the extent that it has is that manipulation is very helpful for many people with back and neck pain. Back pain, neck pain and headache are virtually the only reasons people consult chiropractors [##REF##9585743##34##, ####REF##15300137##35##, ##REF##11805694##36####11805694##36##].</p>\",\n \"<p>Some chiropractors reading this statement may be thinking, \\\"This may apply to the rest of the profession, but my patients see me for wellness and a variety of visceral problems\\\". We would ask these readers to look critically at this assumption. Hawk, et al [##REF##11313611##37##] sought out practices that made that very claim, i.e., practices that claimed that a substantial percentage of their patients saw them for non-musculoskeletal complaints. They asked the patients the reason they were attending for treatment. Ninety percent of the patients stated that they were seeing the chiropractor for musculoskeletal problems. Recall that these were practices that were specifically sought out because they claimed to see a high percentage of non-musculoskeletal complaints. Before any chiropractor thinks of his or her practice as including a large number of non-musculoskeletal conditions, we suggest they ask their patients first. Or, better yet, have an independent source ask the patients. Chances are the reality will be much different than the perception.</p>\",\n \"<p>No matter how one looks at it, or what one would like reality to be, chiropractic medicine is about back pain, neck pain and headache. Instead of fighting that fact (or denying it), we should embrace it fully and focus on becoming society's go-to profession for disorders in this area. First, spine-related pain is one of the largest markets in all of health care. Considering neck/arm pain, back/leg pain and headache, virtually 100% of the population is potentially included [##REF##15561381##38##,##REF##16371911##39##] (contrast this with the fact that only 7.5% of the population currently see a chiropractor [##REF##15712765##3##]). Second, no medical specialty has successfully carved a niche for itself in this area (although the physical therapy profession is moving rapidly in this direction). Third, spine-related disorders create a great deal of suffering on the part of patients, in addition to exacting great costs on employers, the healthcare system and society at large. Providing much-needed high quality care to individuals suffering from spinal pain, as well as initiating and taking part in public health campaigns designed to educate people about spinal pain, would be a great service to society, and would bring millions of new patients to chiropractic offices, patients who would not ordinarily consider seeing a chiropractic physician.</p>\",\n \"<p>The chiropractic profession fairly recently had a unique opportunity to catapult itself into the role of society's non-surgical spine specialists. In 1994 the Agency for Health Care Policy and Research released its guidelines on the management of acute low back pain in adults [##UREF##10##40##]. These guidelines recommended spinal manipulation as one of the only treatments for which adequate evidence existed for its efficacy. The report received a great deal of media coverage, with some media outlets actually mistakenly identifying \\\"chiropractic\\\", rather than \\\"manipulation\\\" as the recommended first-line approach. We could have used this as a springboard to moving ourselves into the mainstream as the premier non-surgical spine specialists in society. However, the profession did not jump at the chance, largely, in our experience, for fear of being \\\"limited\\\" by the image. Ironically, the profession chose to avoid being \\\"limited\\\" to the management of a group of disorders (back pain, neck pain and headache) that affect virtually 100% of the population through all stages of life [##REF##18404112##41##]. In the interim it has seen its market share dwindle from 10% of the population [##REF##8418405##4##] to 7.5% [##REF##15712765##3##,##REF##15188733##42##]. Even amongst patients with back pain, the proportion of patients seeing chiropractors dropped significantly between 1987 and 1997, a period of time in which the proportion seeing both medical doctors and physical therapists increased [##REF##14749194##43##].</p>\",\n \"<p>It is interesting that chiropractors have traditionally prided themselves on being \\\"holistic\\\". The emerging model of modern spine care is the \\\"biopsychosocial\\\" model [##UREF##11##44##]. That is, it is increasingly recognized that in order to provide optimum care for patients with spine-related disorders, one has to consider the <italic>whole person</italic>. Thus, non-surgical spine care provides chiropractic medicine with a wonderful opportunity to provide truly holistic care for patients, and to be recognized for expertise in this area. This would certainly be a drastic departure from the reductionistic subluxation-only approach, which \\\"reduces\\\" the cause and care of health problems to a spinal subluxation. Further, because the biopsychosocial approach often requires multidisciplinary involvement, embracing this model will further help to integrate chiropractic medicine into mainstream health care.</p>\",\n \"<p>The World Federation of Chiropractic (WFC) has taken an important step in establishing a clear identity for chiropractors as \\\"The spinal health care experts in the health care system\\\" [##UREF##12##45##]. It is critical that other state, provincial and national associations follow the lead of the WFC.</p>\",\n \"<title>5. Fidelity to the Social Contract</title>\",\n \"<p>The professions, which classically included medicine, law and the ministry, are vocations whose members \\\"profess\\\" to have knowledge that the laity do not comprehend. Given the asymmetry of knowledge between professionals and the laity, society has granted to the professions a certain degree of autonomous control over themselves. However, this social contract demands that each profession, and each professional, place the wellbeing of society and the patient, client or parishioner ahead of the profession and professional. Lay persons put their faith in the professional following the dictum <italic>credat emptor </italic>(let the buyer have faith) rather than <italic>caveat emptor </italic>(let the buyer beware) [##UREF##9##32##]. This social contract imparts great freedom on all professions, but with this freedom comes great responsibility.</p>\",\n \"<p>When an individual consults a member of any of the medical professions, it is reasonably expected that the advice and treatment that he or she receives is based in science, not metaphysics or pseudoscience. In addition, it is reasonably expected that the services he or she receives are being provided for the primary purpose of benefiting the patient, and not for any other reason. The financial benefit to the professional is secondary, and results from the degree of clinical benefit received by the patient. Patients place their faith in the professional, and trust that they will not be subject to fraud, abuse or quackery. This is the social contract as it applies to chiropractic physicians.</p>\",\n \"<p>By focusing on a specific set of clinical problems (i.e., foot disorders) for which society had a demonstrable need for professional services, using the scientific method to explore ways to better serve society, consistently upgrading their clinical training, and appropriately policing themselves, podiatrists have successfully fulfilled the social contract. As a result, it is our experience that podiatrists are widely perceived by the public to be ethical and honest professionals who generally have their patient's best interests at heart.</p>\",\n \"<p>The chiropractic profession has an obligation to actively divorce itself from metaphysical explanations of health and disease as well as to actively regulate itself in refusing to tolerate fraud, abuse and quackery, which are more rampant in our profession than in other healthcare professions [##REF##15389179##46##]. This must be done on an individual practitioner basis as well as by the political, educational and regulatory bodies. In this way the profession can fulfill its responsibility to the social contract. This will dramatically increase the level of trust in and respect for the profession from society at large.</p>\",\n \"<title>6. Podiatrists and Foot Reflexologists</title>\",\n \"<p>We feel it is important here to briefly contrast and compare podiatry and foot reflexology. While the two professions have always been distinct, there is commonality in that each focuses its treatment efforts on the foot; however, this is where any resemblance between the two professions ends. Podiatric medicine is a science-based profession dedicated to the diagnosis and treatment of foot disorders. Foot reflexology is a metaphysically-based group consisting of non-physicians who believe that many physical disorders arise from the foot. Podiatrists have rejected foot reflexology as an unproven and unscientific practice, and do not consider it part of mainstream podiatric practice. Thus, it would be quite unreasonable to think that podiatry and foot reflexology could ever exist under one professional roof.</p>\",\n \"<p>Yet, this is the very untenable situation in which we find ourselves in the chiropractic profession. Chiropractic has frequently been described as being two professions masquerading as one, and those two professions have attempted to live under one roof. One profession, the \\\"subluxation-based\\\" profession, occupies the same metaphysical and pseudoscientific space as foot reflexology. The other chiropractic profession – call it \\\"chiropractic medicine\\\" as we do in this commentary – has attempted to occupy the same scientific space as the podiatric profession. Alas, the marriage of convenience between these two chiropractic professions living under one roof has not worked. We find science-based practitioners and organizations alongside quasi-metaphysical, pseudoreligious, pseudoscientific practitioners and organizations. The result is continual battling with a huge waste of energy and resources, while professional growth stagnates.</p>\",\n \"<p>We must finally come to the painful realization that the chiropractic concept of spinal subluxation as the cause of \\\"dis-ease\\\" within the human body is an untested hypothesis [##REF##16092955##27##]. It is an albatross around our collective necks that impedes progress. There can be no unity between the majority of non-surgical spine specialist chiropractic physicians and the minority of chiropractors who espouse metaphysical, pseudoreligious views of spinal subluxations as \\\"silent killers\\\" [##UREF##13##47##]. The latter minority group needs to be marginalized from the mainstream majority group, and no longer should unrealistic efforts be made toward unification of these disparate factions within the profession.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":[],"string":"[]","isConversational":false},"results":{"kind":"list like","value":[],"string":"[]","isConversational":false},"discussion":{"kind":"list like","value":[],"string":"[]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>Reform of the chiropractic profession is long overdue. We need to make dramatic changes in the profession if we are to advance ourselves in the direction of becoming a credible, respected and widely utilized profession. Many mistakes were made in the past that prevented us from making this advancement. However, it is not too late to correct these mistakes. There is an example of a profession that, in the same 110+ years that the chiropractic profession has existed, has achieved the kind of mainstream acceptance that we have failed to achieve. We suggest that we examine how we may benefit from the experience of this other non-allopathic profession. The podiatric medical profession succeeded in establishing itself as a mainstream profession because of certain specific actions it took, and certain actions it did not take.</p>","<p>We see a tremendous opportunity for chiropractic medicine to become what it can and should be: a profession of non-surgical spine specialists who not only offer one useful modality of treatment for spinal pain (manipulation), but offer something much greater and more important – expertise in the diagnosis and management of spinal pain patients. This includes understanding the vast mechanisms of spinal pain as well as diagnosis, treatment and coordination of the treatment of other members of the healthcare team. It also means mastering a variety of non-surgical methods other than just manipulation that are useful in the management of patients with spinal pain. But, most importantly, it means becoming experts in <italic>patient management</italic>, i.e., helping patients overcome spinal pain, whether that means providing adjustments, exercise, short-term medication use and/or education regarding the issues related to LBP provided in a cognitive-behavioral context. Currently, there is no profession that adequately fills that role, although as we noted earlier, the physical therapy profession is moving quickly in this direction. The opportunity is there for us to correct our mistakes, but we must act now. The only question is whether the chiropractic profession has the integrity, vision and self reflection required to make the necessary changes. Time will tell.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>Reform of the chiropractic profession is long overdue. We need to make dramatic changes in the profession if we are to advance ourselves in the direction of becoming a credible, respected and widely utilized profession. Many mistakes were made in the past that prevented us from making this advancement. However, it is not too late to correct these mistakes. There is an example of a profession that, in the same 110+ years that the chiropractic profession has existed, has achieved the kind of mainstream acceptance that we have failed to achieve. We suggest that we examine how we may benefit from the experience of this other non-allopathic profession. The podiatric medical profession succeeded in establishing itself as a mainstream profession because of certain specific actions it took, and certain actions it did not take.</p>\",\n \"<p>We see a tremendous opportunity for chiropractic medicine to become what it can and should be: a profession of non-surgical spine specialists who not only offer one useful modality of treatment for spinal pain (manipulation), but offer something much greater and more important – expertise in the diagnosis and management of spinal pain patients. This includes understanding the vast mechanisms of spinal pain as well as diagnosis, treatment and coordination of the treatment of other members of the healthcare team. It also means mastering a variety of non-surgical methods other than just manipulation that are useful in the management of patients with spinal pain. But, most importantly, it means becoming experts in <italic>patient management</italic>, i.e., helping patients overcome spinal pain, whether that means providing adjustments, exercise, short-term medication use and/or education regarding the issues related to LBP provided in a cognitive-behavioral context. Currently, there is no profession that adequately fills that role, although as we noted earlier, the physical therapy profession is moving quickly in this direction. The opportunity is there for us to correct our mistakes, but we must act now. The only question is whether the chiropractic profession has the integrity, vision and self reflection required to make the necessary changes. Time will tell.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>The chiropractic profession has succeeded to remain in existence for over 110 years despite the fact that many other professions which had their start at around the same time as chiropractic have disappeared. Despite chiropractic's longevity, the profession has not succeeded in establishing cultural authority and respect within mainstream society, and its market share is dwindling. In the meantime, the podiatric medical profession, during approximately the same time period, has been far more successful in developing itself into a respected profession that is well integrated into mainstream health care and society.</p>","<title>Objective</title>","<p>To present a perspective on the current state of the chiropractic profession and to make recommendations as to how the profession can look to the podiatric medical profession as a model for how a non-allopathic healthcare profession can establish mainstream integration and cultural authority.</p>","<title>Discussion</title>","<p>There are several key areas in which the podiatric medical profession has succeeded and in which the chiropractic profession has not. The authors contend that it is in these key areas that changes must be made in order for our profession to overcome its shrinking market share and its present low status amongst healthcare professions. These areas include public health, education, identity and professionalism.</p>","<title>Conclusion</title>","<p>The chiropractic profession has great promise in terms of its potential contribution to society and the potential for its members to realize the benefits that come from being involved in a mainstream, respected and highly utilized professional group. However, there are several changes that must be made within the profession if it is going to fulfill this promise. Several lessons can be learned from the podiatric medical profession in this effort.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>The chiropractic profession has succeeded to remain in existence for over 110 years despite the fact that many other professions which had their start at around the same time as chiropractic have disappeared. Despite chiropractic's longevity, the profession has not succeeded in establishing cultural authority and respect within mainstream society, and its market share is dwindling. In the meantime, the podiatric medical profession, during approximately the same time period, has been far more successful in developing itself into a respected profession that is well integrated into mainstream health care and society.</p>\",\n \"<title>Objective</title>\",\n \"<p>To present a perspective on the current state of the chiropractic profession and to make recommendations as to how the profession can look to the podiatric medical profession as a model for how a non-allopathic healthcare profession can establish mainstream integration and cultural authority.</p>\",\n \"<title>Discussion</title>\",\n \"<p>There are several key areas in which the podiatric medical profession has succeeded and in which the chiropractic profession has not. The authors contend that it is in these key areas that changes must be made in order for our profession to overcome its shrinking market share and its present low status amongst healthcare professions. These areas include public health, education, identity and professionalism.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>The chiropractic profession has great promise in terms of its potential contribution to society and the potential for its members to realize the benefits that come from being involved in a mainstream, respected and highly utilized professional group. However, there are several changes that must be made within the profession if it is going to fulfill this promise. Several lessons can be learned from the podiatric medical profession in this effort.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Competing interests</title>","<p>Each of the authors makes his living practicing, teaching, administrating or studying chiropractic medicine (or some combination of these activities) and thus has a financial interest in the success of the profession.</p>","<title>Authors' contributions</title>","<p>DRM originally conceived of the conceptual basis of the paper and had detailed discussions of this with MJS, DRS, SMP and CFN both in person and via e mail. DRM then wrote the initial manuscript and this was distributed multiple times between MJS, DRS, SMP and CFN until the final manuscript was created. All authors took part in editing and revising the manuscript on multiple occasions.</p>"],"string":"[\n \"<title>Competing interests</title>\",\n \"<p>Each of the authors makes his living practicing, teaching, administrating or studying chiropractic medicine (or some combination of these activities) and thus has a financial interest in the success of the profession.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>DRM originally conceived of the conceptual basis of the paper and had detailed discussions of this with MJS, DRS, SMP and CFN both in person and via e mail. DRM then wrote the initial manuscript and this was distributed multiple times between MJS, DRS, SMP and CFN until the final manuscript was created. All authors took part in editing and revising the manuscript on multiple occasions.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":[],"string":"[]","isConversational":false},"figure":{"kind":"list like","value":[],"string":"[]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Examples of activities of chiropractors within the American Public Health Association (APHA)</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">1. Chiropractic members of the APHA conducted a session on immunization in 1992, which was attended by several epidemiologists from the Centers for Disease Control.</td></tr></thead><tbody><tr><td align=\"left\">2. A chiropractor served as Chair of the APHA Intersectional Council in 2000–2001.</td></tr><tr><td colspan=\"1\"><hr/></td></tr><tr><td align=\"left\">3. A chiropractor served on the APHA Executive Board in 2000.</td></tr><tr><td colspan=\"1\"><hr/></td></tr><tr><td align=\"left\">4. Several papers authored by chiropractors have been published in the Journal of the American Public Health Association.</td></tr><tr><td colspan=\"1\"><hr/></td></tr><tr><td align=\"left\">5. A chiropractor organized and presided over a special session called \"Faith, Terror, Hope, and Public Health: Exploring the Common Ground\" shortly after 9/11.</td></tr><tr><td colspan=\"1\"><hr/></td></tr><tr><td align=\"left\">6. In 2002 the Chiropractic Health Section won an APHA Intersectional Council grant to promote collaboration between sections. They teamed with the Vision Care, Podiatry, and Oral Health Sections to produce a mega-booth in the exhibit at the Annual Meeting, which was awarded 2nd place in 2002 and a tie for 1st place in 2003 for best exhibit.</td></tr><tr><td colspan=\"1\"><hr/></td></tr><tr><td align=\"left\">7. In 2005, with the help of chiropractic members of the APHA, the American Chiropractic Association began including a public health column in its online publication.</td></tr><tr><td colspan=\"1\"><hr/></td></tr><tr><td align=\"left\">8. A chiropractor introduced the Surgeon General of the United States in a special APHA session in 2002.</td></tr><tr><td colspan=\"1\"><hr/></td></tr><tr><td align=\"left\">9. A chiropractor received a gold watch and award/recognition for recruiting more members than any single person in APHA's 125 year history.</td></tr><tr><td colspan=\"1\"><hr/></td></tr><tr><td align=\"left\">10. A chiropractor serves on the APHA Forum on Aging.</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Examples of activities of chiropractors within the American Public Health Association (APHA)</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\">1. Chiropractic members of the APHA conducted a session on immunization in 1992, which was attended by several epidemiologists from the Centers for Disease Control.</td></tr></thead><tbody><tr><td align=\\\"left\\\">2. A chiropractor served as Chair of the APHA Intersectional Council in 2000–2001.</td></tr><tr><td colspan=\\\"1\\\"><hr/></td></tr><tr><td align=\\\"left\\\">3. A chiropractor served on the APHA Executive Board in 2000.</td></tr><tr><td colspan=\\\"1\\\"><hr/></td></tr><tr><td align=\\\"left\\\">4. Several papers authored by chiropractors have been published in the Journal of the American Public Health Association.</td></tr><tr><td colspan=\\\"1\\\"><hr/></td></tr><tr><td align=\\\"left\\\">5. A chiropractor organized and presided over a special session called \\\"Faith, Terror, Hope, and Public Health: Exploring the Common Ground\\\" shortly after 9/11.</td></tr><tr><td colspan=\\\"1\\\"><hr/></td></tr><tr><td align=\\\"left\\\">6. In 2002 the Chiropractic Health Section won an APHA Intersectional Council grant to promote collaboration between sections. They teamed with the Vision Care, Podiatry, and Oral Health Sections to produce a mega-booth in the exhibit at the Annual Meeting, which was awarded 2nd place in 2002 and a tie for 1st place in 2003 for best exhibit.</td></tr><tr><td colspan=\\\"1\\\"><hr/></td></tr><tr><td align=\\\"left\\\">7. In 2005, with the help of chiropractic members of the APHA, the American Chiropractic Association began including a public health column in its online publication.</td></tr><tr><td colspan=\\\"1\\\"><hr/></td></tr><tr><td align=\\\"left\\\">8. A chiropractor introduced the Surgeon General of the United States in a special APHA session in 2002.</td></tr><tr><td colspan=\\\"1\\\"><hr/></td></tr><tr><td align=\\\"left\\\">9. A chiropractor received a gold watch and award/recognition for recruiting more members than any single person in APHA's 125 year history.</td></tr><tr><td colspan=\\\"1\\\"><hr/></td></tr><tr><td align=\\\"left\\\">10. A chiropractor serves on the APHA Forum on Aging.</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"graphic":{"kind":"list like","value":[],"string":"[]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Wardwell\"], \"given-names\": [\"WI\"], \"source\": [\"Chiropractic - History and Evolution of a New Profession\"], \"year\": [\"1992\"], \"publisher-name\": [\"St. Louis , Mosby Year-Book\"]}, {\"article-title\": [\"Gallup poll: Americans have low opinion of chiropractors' honesty and ethics\"], \"source\": [\"Dynam Chiropr\"], \"year\": [\"2007\"], \"volume\": [\"22\"]}, {\"surname\": [\"Bates\"], \"given-names\": [\"JE\"], \"article-title\": [\"Podiatric medicine: history and education\"], \"source\": [\"J Am Podiatr Assn\"], \"year\": [\"1975\"], \"volume\": [\"65\"], \"fpage\": [\"1076\"], \"lpage\": [\"1077\"]}, {\"surname\": [\"Egan\"], \"given-names\": [\"JT\"], \"suffix\": [\"Baird R, Killinger LZ\"], \"article-title\": [\"Chiropractic within the American Public Health Association, 1984-2005: From pariah, to participant, to parity\"], \"source\": [\"Chiropr Hist\"], \"year\": [\"2006\"], \"volume\": [\"26\"], \"fpage\": [\"97\"], \"lpage\": [\"117\"]}, {\"surname\": [\"Mizel\"], \"given-names\": [\"D\"], \"suffix\": [\"Gorchynski S, Keenan, D, Duncan HJ, Gadd M\"], \"source\": [\"Branding Chiropractic for Public Education: Principles and Experience from Ontario: Paris, France.\\n\\t\\t\\t\\t\\t\"], \"year\": [\"2001\"]}, {\"surname\": [\"Boyer\"], \"given-names\": [\"EL\"], \"source\": [\"Scholarship reconsidered: Priorities of the professoriate\"], \"year\": [\"1990\"], \"publisher-name\": [\"Princeton , The Carnegie Foundation for the Advancement of Teaching\"]}, {\"surname\": [\"Mirtz\"], \"given-names\": [\"TA\"], \"article-title\": [\"The question of theology for chiropractic: A theological study of chiropractic's prime tenets\"], \"source\": [\"J Chiropr Human\"], \"year\": [\"2001\"], \"volume\": [\"10\"]}, {\"surname\": [\"Mirtz\"], \"given-names\": [\"TA\"], \"article-title\": [\"Universal intelligence: A theological entity in conflict with Lutheran theology\"], \"source\": [\"J Chiropr Human\"], \"year\": [\"1999\"], \"volume\": [\"9\"]}, {\"surname\": [\"Seaman\"], \"given-names\": [\"D\"], \"article-title\": [\"Philosophy and science versus dogmatism in the practice of chiropractic\"], \"source\": [\"J Chiro Human\"], \"year\": [\"1998\"], \"volume\": [\"8\"], \"fpage\": [\"55\"], \"lpage\": [\"66\"]}, {\"surname\": [\"Hughes\"], \"given-names\": [\"EC\"], \"article-title\": [\"Professions\"], \"source\": [\"Daedalus\"], \"year\": [\"1962\"], \"volume\": [\"92\"], \"fpage\": [\"655\"], \"lpage\": [\"668\"]}, {\"surname\": [\"Bigos\", \"Bowyer\", \"Braen\"], \"given-names\": [\"S\", \"O\", \"G\"], \"suffix\": [\"Brown K, Deyo R, Haldeman S\"], \"article-title\": [\" Acute Low Back Problems in Adults Clinical Practice Guideline Number 14 AHCPR Pub No 95-0642 Rockville, MD Agency for Health Care Policy and Research, Public Health Service, US Department of Health and Human Services\"], \"source\": [\"US Department of Health and Human Service\"], \"year\": [\"1994\"]}, {\"surname\": [\"Pollard\"], \"given-names\": [\"H\"], \"suffix\": [\"Hardy K, Curtin D\"], \"article-title\": [\"Biopsychosocial model of pain and its relevance to chiropractors\"], \"source\": [\"Chiropr J Aus\"], \"year\": [\"2006\"], \"volume\": [\"36\"], \"fpage\": [\"92\"], \"lpage\": [\"96\"]}, {\"article-title\": [\"Unanimous Agreement on the Identity of the Profession\"], \"source\": [\"Dynam Chiropr\"], \"year\": [\"2005\"], \"volume\": [\"23\"]}, {\"surname\": [\"Carter\"], \"given-names\": [\"R\"], \"article-title\": [\"Subluxation - the silent killer\"], \"source\": [\"J Can Chiropr Assoc\"], \"year\": [\"2000\"], \"volume\": [\"44\"], \"fpage\": [\"9\"], \"lpage\": [\"18\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":47,"string":"47"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:37"},"citation":{"kind":"string","value":"Chiropr Osteopat. 2008 Aug 29; 16:10"},"package_file":{"kind":"string","value":"oa_package/41/e4/PMC2538524.tar.gz"}}},{"rowIdx":119689,"cells":{"accession_id":{"kind":"string","value":"PMC2538525"},"pmid":{"kind":"string","value":"18694490"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>Accurate diagnosis or classification of patients with spinal pain has been identified as a research priority [##REF##11880849##1##]. We presented in Part 1 the theoretical model of an approach to diagnosis in patients with spinal pain [##REF##17683556##2##]. This approach incorporated the various factors that have been found, or in some cases theorized, to be of importance in the generation and perpetuation of neck or back pain into an organized scheme upon which a management strategy can be based. The authors termed this approach a diagnosis-based clinical decision rule (DBCDR). The DBCDR is not a clinical prediction rule. It is an attempt to identify aspects of the clinical picture in each patient that are relevant to the perpetuation of pain and disability so that these factors can be addressed with interventions designed to improve them. The purpose of this paper is to review the literature on the methods involved in the DBCDR regarding reliability and validity and to identify those areas in which the literature is currently lacking.</p>","<title>The Three Essential Questions of Diagnosis</title>","<p>The DBCDR is based on what the authors refer to as the 3 essential questions of diagnosis [##REF##17683556##2##]. The answers to these questions supply the clinician with the most important information that is required to develop an individualized diagnosis from which a management strategy can be derived. The 3 questions are:</p>","<title>1. Are the symptoms with which the patient is presenting reflective of a visceral disorder or a serious or potentially life-threatening disease?</title>","<p>In seeking the answer to this question, history and examination and, when indicated, special tests, are used to detect or raise the level of suspicion for the presence of pathological disorders for which spinal pain may be the first or only symptom. Some examples are gastrointestinal or genitourinary disorders, fracture, infection and malignancy. Potentially serious or life-threatening conditions are sometimes referred to as \"red flags\" [##UREF##0##3##].</p>","<title>2. From where is the patient's pain arising?</title>","<p>In seeking the answer to this question, four signs are searched for: (1) centralization signs, (2) segmental pain provocation signs, (3) neurodynamic signs, and (4) muscle palpation signs.</p>","<title>3. What has gone wrong with this person as a whole that would cause the pain experience to develop and persist?</title>","<p>In seeking the answer to this question, perpetuating factors are searched for: (1) dynamic instability (impaired motor control), (2) central pain hypersensitivity, (3) oculomotor dysfunction (in cervical trauma patients), (4) fear, (5) catastrophizing, (6) passive coping, and (7) depression. These latter psychological factors are sometimes referred to as \"yellow flags\" [##UREF##1##4##].</p>","<p>An algorithm illustrating the diagnostic strategy of the DBCDR is presented in figure ##FIG##0##1##. The recommended management strategy based on the DBCDR is presented in figure ##FIG##1##2##.</p>","<p>The purpose of this paper is to review the literature on the reliability and validity of the detection of the individual diagnostic factors included in the DBCDR, and to present the evidence as it currently exists, for the various aspects of this approach.</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>Accurate diagnosis or classification of patients with spinal pain has been identified as a research priority [##REF##11880849##1##]. We presented in Part 1 the theoretical model of an approach to diagnosis in patients with spinal pain [##REF##17683556##2##]. This approach incorporated the various factors that have been found, or in some cases theorized, to be of importance in the generation and perpetuation of neck or back pain into an organized scheme upon which a management strategy can be based. The authors termed this approach a diagnosis-based clinical decision rule (DBCDR). The DBCDR is not a clinical prediction rule. It is an attempt to identify aspects of the clinical picture in each patient that are relevant to the perpetuation of pain and disability so that these factors can be addressed with interventions designed to improve them. The purpose of this paper is to review the literature on the methods involved in the DBCDR regarding reliability and validity and to identify those areas in which the literature is currently lacking.</p>\",\n \"<title>The Three Essential Questions of Diagnosis</title>\",\n \"<p>The DBCDR is based on what the authors refer to as the 3 essential questions of diagnosis [##REF##17683556##2##]. The answers to these questions supply the clinician with the most important information that is required to develop an individualized diagnosis from which a management strategy can be derived. The 3 questions are:</p>\",\n \"<title>1. Are the symptoms with which the patient is presenting reflective of a visceral disorder or a serious or potentially life-threatening disease?</title>\",\n \"<p>In seeking the answer to this question, history and examination and, when indicated, special tests, are used to detect or raise the level of suspicion for the presence of pathological disorders for which spinal pain may be the first or only symptom. Some examples are gastrointestinal or genitourinary disorders, fracture, infection and malignancy. Potentially serious or life-threatening conditions are sometimes referred to as \\\"red flags\\\" [##UREF##0##3##].</p>\",\n \"<title>2. From where is the patient's pain arising?</title>\",\n \"<p>In seeking the answer to this question, four signs are searched for: (1) centralization signs, (2) segmental pain provocation signs, (3) neurodynamic signs, and (4) muscle palpation signs.</p>\",\n \"<title>3. What has gone wrong with this person as a whole that would cause the pain experience to develop and persist?</title>\",\n \"<p>In seeking the answer to this question, perpetuating factors are searched for: (1) dynamic instability (impaired motor control), (2) central pain hypersensitivity, (3) oculomotor dysfunction (in cervical trauma patients), (4) fear, (5) catastrophizing, (6) passive coping, and (7) depression. These latter psychological factors are sometimes referred to as \\\"yellow flags\\\" [##UREF##1##4##].</p>\",\n \"<p>An algorithm illustrating the diagnostic strategy of the DBCDR is presented in figure ##FIG##0##1##. The recommended management strategy based on the DBCDR is presented in figure ##FIG##1##2##.</p>\",\n \"<p>The purpose of this paper is to review the literature on the reliability and validity of the detection of the individual diagnostic factors included in the DBCDR, and to present the evidence as it currently exists, for the various aspects of this approach.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<title>Literature search and selection</title>","<p>The following databases were searched up to December 22, 2006: Medline, Cinahl, Embase and MANTIS. Searches of the authors' own libraries were also conducted. Finally, citation searches of relevant articles and texts were conducted manually. The following search terms were used:</p>","<p>Diagnosis AND \"low back pain\"</p>","<p>Diagnosis AND \"neck pain\"</p>","<p>Diagnosis AND \"low back pain\" AND palpation</p>","<p>Diagnosis AND \"neck pain\" AND palpation</p>","<p>Diagnosis AND \"low back pain\" AND McKenzie</p>","<p>Diagnosis AND \"neck pain\" AND McKenzie</p>","<p>Diagnosis AND \"low back pain\" AND neurodynamics</p>","<p>Diagnosis AND \"neck pain\" AND neurodynamics</p>","<p>Diagnosis AND \"low back pain\" AND radiculopathy</p>","<p>Diagnosis AND \"neck pain\" AND radiculopathy</p>","<p>Diagnosis AND \"low back pain\" AND trigger points</p>","<p>Diagnosis AND \"neck pain\" AND trigger points</p>","<p>Diagnosis AND \"low back pain\" AND muscle</p>","<p>Diagnosis AND \"neck pain\" AND muscle</p>","<p>Diagnosis AND \"low back pain\" AND instability</p>","<p>Diagnosis AND \"neck pain\" AND instability</p>","<p>Diagnosis AND \"low back pain\" AND \"motor control\"</p>","<p>Diagnosis AND \"neck pain\" AND \"motor control\"</p>","<p>Diagnosis AND \"low back pain\" AND \"central sensitization\"</p>","<p>Diagnosis AND \"low back pain\" AND \"central pain hypersensitivity\"</p>","<p>Diagnosis AND \"neck pain\" AND \"central sensitization\"</p>","<p>Diagnosis AND \"neck pain\" AND \"central pain hypersensitivity\"</p>","<p>Diagnosis AND \"neck pain\" AND oculomotor</p>","<p>Diagnosis AND \"low back pain\" AND fear</p>","<p>Diagnosis AND \"neck pain\" AND fear</p>","<p>Diagnosis AND \"low back pain\" AND catastrophizing</p>","<p>Diagnosis AND \"neck pain\" AND catastrophizing</p>","<p>Diagnosis AND \"low back pain\" AND coping</p>","<p>Diagnosis AND \"neck pain\" AND coping</p>","<p>Diagnosis AND \"low back pain\" AND depression</p>","<p>Diagnosis AND \"neck pain\" AND depression</p>","<p>Studies were included if they were in English and provided original, statistically analyzed data regarding the reliability and validity of clinic-based diagnostic procedures used for the identification of relevant factors in the causation or perpetuation of spinal pain. Included studies had to contain data on the assessment of patients with cervical or lumbar pain, including headache related to the cervical spine and spine-related upper or lower extremity pain. Non-English language studies were excluded, as were studies that did not present data on reliability and validity. The search focused on diagnostic procedures that are potentially useful in answering the second or third question of diagnosis. Studies that were potentially useful in answering question 1 were not considered for the purpose of this paper. Diagnostic studies that require special equipment not typically found in the clinic (such as MRI) or that require a laboratory (such as blood tests) were excluded because the purpose of the study was to evaluate clinic-based means by which the DBCDR may be applied. It is recognized that imaging or laboratory tests are often useful in the diagnosis of spinal pain, but the presentation of these procedures was beyond the scope of this paper. In cases in which systematic reviews of the literature were found, the individual studies included in the reviews were not reviewed separately, unless this was necessary to clarify information that was not readily apparent from the systematic review.</p>","<p>Each study was reviewed by two authors (DRM and CFN) and deemed relevant or irrelevant. A study was considered relevant if the information contained in the study indicated that it met the above inclusion/exclusion criteria.</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<title>Literature search and selection</title>\",\n \"<p>The following databases were searched up to December 22, 2006: Medline, Cinahl, Embase and MANTIS. Searches of the authors' own libraries were also conducted. Finally, citation searches of relevant articles and texts were conducted manually. The following search terms were used:</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\"</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\"</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND palpation</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND palpation</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND McKenzie</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND McKenzie</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND neurodynamics</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND neurodynamics</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND radiculopathy</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND radiculopathy</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND trigger points</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND trigger points</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND muscle</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND muscle</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND instability</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND instability</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND \\\"motor control\\\"</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND \\\"motor control\\\"</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND \\\"central sensitization\\\"</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND \\\"central pain hypersensitivity\\\"</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND \\\"central sensitization\\\"</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND \\\"central pain hypersensitivity\\\"</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND oculomotor</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND fear</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND fear</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND catastrophizing</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND catastrophizing</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND coping</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND coping</p>\",\n \"<p>Diagnosis AND \\\"low back pain\\\" AND depression</p>\",\n \"<p>Diagnosis AND \\\"neck pain\\\" AND depression</p>\",\n \"<p>Studies were included if they were in English and provided original, statistically analyzed data regarding the reliability and validity of clinic-based diagnostic procedures used for the identification of relevant factors in the causation or perpetuation of spinal pain. Included studies had to contain data on the assessment of patients with cervical or lumbar pain, including headache related to the cervical spine and spine-related upper or lower extremity pain. Non-English language studies were excluded, as were studies that did not present data on reliability and validity. The search focused on diagnostic procedures that are potentially useful in answering the second or third question of diagnosis. Studies that were potentially useful in answering question 1 were not considered for the purpose of this paper. Diagnostic studies that require special equipment not typically found in the clinic (such as MRI) or that require a laboratory (such as blood tests) were excluded because the purpose of the study was to evaluate clinic-based means by which the DBCDR may be applied. It is recognized that imaging or laboratory tests are often useful in the diagnosis of spinal pain, but the presentation of these procedures was beyond the scope of this paper. In cases in which systematic reviews of the literature were found, the individual studies included in the reviews were not reviewed separately, unless this was necessary to clarify information that was not readily apparent from the systematic review.</p>\",\n \"<p>Each study was reviewed by two authors (DRM and CFN) and deemed relevant or irrelevant. A study was considered relevant if the information contained in the study indicated that it met the above inclusion/exclusion criteria.</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<p>The search strategy identified 1769 articles, and of these, 138 were deemed relevant. Additional files ##SUPPL##0##1## and ##SUPPL##1##2## provide a breakdown of the number of studies in each area of consideration. Additional files ##SUPPL##2##3## and ##SUPPL##3##4## present the data from those studies that met the inclusion criteria. We have divided the presentation of the literature into those studies that apply to patients with neck pain and those that relate to patients with low back pain (LBP).</p>","<title>Neck Pain</title>","<title>Question 1. Are the symptoms with which the patient is presenting reflective of a visceral disorder or a serious or potentially life-threatening disease?</title>","<p>A detailed review of the literature related to this question is beyond the scope of this paper. However, in general, history, focusing on the presence of symptoms such as GI distress, fever or previous history of cancer, and examination, focusing on vital signs, abdominal examination and examination of peripheral pulses, are useful in raising the level of suspicion as to the presence of a visceral disorder or a serious or potentially life-threatening disease [##REF##17909209##5##]. Imaging and/or special tests such as sedimentation rate can be utilized for further confirmation [##REF##17909209##5##]. Details can be found elsewhere [##REF##17909209##5##, ####UREF##2##6##, ##UREF##3##7####3##7##].</p>","<title>Question 2. From where is the patient's pain arising?</title>","<title>Centralization signs</title>","<p>Centralization signs are detected through methods originally developed by McKenzie [##UREF##4##8##,##UREF##5##9##]. The examination procedure involves moving the spine to end range in various directions and monitoring the mechanical and symptomatic response to these movements.</p>","<title>Reliability</title>","<p>Clare, et al [##REF##15800512##10##] used 2 physical therapists trained in the McKenzie method to examine 25 patients with cervical pain. They found good inter-examiner reliability (IER) (<italic>kappa</italic>, [<italic>k</italic>] = 0.63 and 93% agreement) for the assessment procedure.</p>","<title>Validity</title>","<p>No studies were identified that have addressed the validity of centralization signs in the cervical spine.</p>","<title>Segmental pain provocation signs</title>","<p>A number of studies have examined segmental mobility assessment and have generally found poor IER [##REF##3559420##11##, ####UREF##6##12##, ##REF##12072848##13##, ##UREF##7##14##, ##REF##7659738##15##, ##REF##15994114##16####15994114##16##] and validity [##REF##11896374##17##]. Other studies have examined procedures designed to identify segmental pain (as opposed to mobility impairment).</p>","<title>Reliability</title>","<p>Hubka and Phelan [##REF##7884328##18##] assessed the IER of palpation for tenderness between 2 practitioners in 30 patients with unilateral neck pain. They found good IER (<italic>k </italic>= 0.68). Jull, et al [##REF##11676679##19##] assessed IER of segmental palpation using 7 examiners and 40 subjects with or without neck pain and headache. The criteria for a positive test were based on resistance to joint movement and pain provocation in response to palpation. Kappa values indicated excellent to perfect IER (<italic>k </italic>= 0.78–1.00) in 6 instances, fair to good (<italic>k </italic>= 0.45–0.65) in 14 instances and poor (<italic>k </italic>= 0.25–0.34) in 5 instances. They point out that, in the instances of poor agreement, the raw data indicated that the examiners had agreed on 13 of 14 decisions. But the calculations of <italic>k </italic>were vulnerable because 12 of the 13 agreements were in the same cell of agreed negative finding. Marcus, et al [##REF##15613190##20##] used 4 physical therapists to examine 72 headache patients and 24 controls. The therapists examined all subjects for \"cervical synovial joint abnormalities\" in the same manner as described in the study by Jull, et al [##REF##11676679##19##]. They found good IER (<italic>k </italic>= 0.63) between examiners. McPartland and Goodridge [##UREF##8##21##] assessed IER of \"TART\" exam, described as segmental palpation that focused on three parameters: tissue texture change, restriction of vertebral motion and zygapophyseal (z) joint tenderness. They found the IER of examination that considered all three parameters was poor (<italic>k </italic>= 0.35 for asymptomatic subjects, <italic>k </italic>= 0.34 for symptomatic subjects). But for the parameter of tenderness alone, IER improved (<italic>k </italic>= 0.529). Van Suijlekom, et al [##REF##10940097##22##] used 2 neurologists to examine 24 headache patients and found IER for segmental palpation to be slight to fair (<italic>k </italic>= 0.14 to 0.37). However, the palpation method was poorly described in this study. Also, it is not known as to whether the difference between the findings of this study and those of the other studies reported here relate to the fact that the \"negative\" IER studies used neurologists, whereas the \"positive\" IER study used chiropractors or physical therapists. Cleland, et al [##REF##17023251##23##] used 2 examiners and 22 subjects and found highly variable IER between 2 physical therapists for palpation for pain provocation, with <italic>k </italic>ranging from -.52 to .90, depending on the segment involved. They speculated that this high variability related to the clinicians not agreeing on the segmental level being examined, as opposed to lack of agreement on the findings.</p>","<title>Validity</title>","<p>Jull, et al [##REF##3343953##24##] used diagnostic blocks to identify the presence and location of symptomatic z joints in 20 patients with cervical related pain. The patients were examined by a manipulative physiotherapist who also attempted to identify the presence and location of symptomatic z joints. The definition of a symptomatic joint as determined by palpation was based on abnormal \"end feel\", increased resistance to motion and reproduction of pain. They found that the SE and SP were both 1.00. That is, the examiner was able to identify 100% of the symptomatic segments as well as all of the subjects whose pain was not abolished by diagnostic block. This study used single, rather than double blind, diagnostic blocks. Regardless, as will be discussed below, the use of diagnostic blocks as a Gold Standard for the presence of z joint pain has been questioned [##REF##17197329##25##]. Treleaven, et al [##REF##7954756##26##] assessed 12 patients with postconcussion headache with segmental palpation. The method of palpation was the same as that used by Jull, et al [##REF##3343953##24##]. They found complete agreement between the examiner and independent report of the patient as to which segments were painful and almost complete agreement as to which segment was most painful. Sandmark and Nisell [##REF##8602474##27##], calculated the SE, SP and PPV and negative predictive value (NPV) of segmental palpation in the cervical spine relative to reported neck pain. They found these values to be 0.82, 0.79, 0.62 and 0.91 respectively. Lord, et al [##REF##7931379##28##], used a double blind anesthetic block to determine the prevalence of pain arising from the C2-3 z joint in patients with the complaint of chronic headache after cervical trauma. These authors demonstrated that the prevalence of C2-3 z-joint pain was 53%, and the only sign that was associated with these patients was tenderness to palpation over the C2-3 z joint. They calculated that palpation had SE of 0.85, a positive likelihood ratio (PLR) of 1.7 and a negative likelihood ratio (NLR) of 0.3. The precise method of palpation was not described. Zito, et al [##REF##16027027##29##] using the palpation method found to be reliable by Jull et al [##REF##11676679##19##] found a significantly higher incidence (p < 0.05) of hypomobile and painful z joints in the upper cervical spine of patients classified according to the International Headache Society criteria as having cervicogenic headache compared to those classified as having migraine with aura. King, et al [##REF##17197328##30##] used \"controlled, diagnostic blocks\" as a Gold Standard against which segmental palpation that was described as being similar to that of Jull, et al [##REF##3343953##24##]. They found the SE to be 0.88, SP to be 0.39 and PLR to be 1.3. Again, using diagnostic block as a Gold Standard may be questionable [##REF##17197329##25##], leaving open the issue of what should be the Gold Standard for segmental palpation signs. Further work in the area of establishing a true Gold Standard for the identification of zygapophyseal joint pain may be needed before definitive statements regarding the presence or absence of pain from this structure can be made.</p>","<title>Neurodynamic signs</title>","<title>Reliability</title>","<p>The standard neurodynamic test in the cervical spine is the brachial plexus tension test (also known as the upper limb tension test [##REF##10590339##31##]). Wainner, et al [##REF##12544957##32##] found good to excellent IER of this test (<italic>k </italic>= 0.76 to 0.81). They also found good to excellent IER of several historical questions of patients with documented cervical radiculopathy (<italic>k </italic>= 0.53 to .082). They found varying IER of neurologic exam findings, but good to excellent IER of Spurling's test (which they described as bending the seated patient's head toward the side of symptoms, rotating and extending slightly, and applying downward pressure), the cervical distraction test and Valsalva's maneuver. The kappa values for these tests ranged from 0.60 to 0.88.</p>","<title>Validity</title>","<p>Wainner, et al [##REF##12544957##32##] provide data on the SE, SP PLR and NLR of a variety of historical factors and examination procedures. They found that the cluster of 4 tests – Spurling's test, the upper limb tension test, the cervical distraction test and limited rotation toward the side of symptoms secondary to pain – carried the greatest diagnostic accuracy as compared to the Gold Standard of electromyography. When 3 of these tests were positive, there was a 65% probability of the presence of cervical radiculopathy the SE and SP were 0.39 and 0.94, respectively and a PLR of 6.1. When all 4 tests were positive, there was a 90% probability of the presence of cervical radiculopathy. The SE and SP were 0.24 and 0.99 respectively and the PLR was 30.3.</p>","<p>Shah and Rajshekhar [##REF##15799149##33##] also used Spurling's test, the description of which was the same as that in the Wainner, et al study [##REF##12544957##32##], and found it to be useful in identifying \"soft disc prolapse\" as opposed to \"hard disc\" (i.e., osteophyte). They calculated the SE and SP to be 0.90 and 1.00, respectively compared to the Gold Standard of operative findings. The PPV was calculated to be 1.00 and the NPV to be 0.71. In patients treated non-surgically, they used MRI as the Gold Standard and calculated the SE and SP to be 0.90 and 0.93, respectively. The PPV was calculated to be 0.90 and the NPV to be 0.93.</p>","<title>Muscle palpation signs</title>","<title>Reliability</title>","<p>Marcus, et al, in the same study cited above [##REF##15613190##20##] found good to perfect IER of TrP palpation in the cervical spine (<italic>k </italic>= 0.74), head (<italic>k </italic>= 0.81) and shoulder (<italic>k </italic>= 1.00). van Suijlekom, et al [##REF##10940097##22##] in the study cited above, found variable IER (<italic>k </italic>= 0.0 – 1.00) of TrP palpation in patients with headache. As was the case with segmental palpation, the method of TrP examination was poorly described. Gerwin, et al [##REF##9060014##34##] performed 2 different experiments to assess IER. In the first, 4 examiners assessed 20 different muscles on each of 25 patients with various symptom presentations. They used a general observer-agreement statistic called the \"<italic>S</italic><sub>av</sub>\", which they defined as \"a generalized version of the Cohen's kappa which reports pairwise judge agreement corrected for chance agreement.\" They found poor IER (<italic>S</italic><sub>av </sub>= 0.0–1.0). They then repeated the study after spending a 3-hour session in which the examiners discussed positive findings and palpation techniques. They found good to excellent IER (<italic>S</italic><sub>av </sub>= 0.65 – .95) after the training session. Sciotti, et al [##REF##11514085##35##] found good IER (Generalizability coefficient = 0.83–0.92) between 2 examiners looking for latent trigger points (TrPs) in the upper trapezius muscle. However, the subjects were asymptomatic. On the other hand, Lew, et al [##REF##11485358##36##] found poor IER for TrP palpation in the upper trapezius, although the subjects in that study were also asymptomatic.</p>","<title>Validity</title>","<p>The validity of muscle palpation signs is unknown, largely due to lack of an appropriate Gold or reference standard.</p>","<title>3. What has gone wrong with this person as a whole that would cause the pain experience to develop and persist?</title>","<p>As was discussed in the earlier paper describing the DBCDR [##REF##17683556##2##], this third question attempts to identify those factors that may be placing the patient at risk of developing persistent or recurrent spinal pain, or, in the case of chronic patients, have contributed to the establishment of the chronic or recurrent problem. There are a number of factors that have been suggested to be of importance in the perpetuation of chronic spinal pain, although research investigating this area is ongoing.</p>","<title>Dynamic instability (impaired motor control)</title>","<title>Reliability</title>","<p>In the cervical spine, the Craniocervical Flexion (CF) test [##REF##15245706##37##,##REF##10234466##38##] is designed to detect decreased activity in the deep cervical flexor muscles and hyperactivity in the sternocleidomastoid muscles. It is thought that, as the deep cervical flexors are important for stability of the intersegmental joints of the cervical spine, this imbalance in muscle activation compromises cervical spine stability [##REF##15245706##37##]. The CF test measures the motor control capacity of the deep cervical flexors. Jull, et al [##REF##10234466##38##] found good IER (ICC = 0.81 to 0.93) in 50 asymptomatic subjects; Chiu, et al [##REF##16268243##39##] found good IER (<italic>k </italic>= 0.72) in 10 asymptomatic subjects.</p>","<p>Recently, 3 studies [##REF##17023251##23##,##REF##16305273##40##,##REF##16461172##41##] have demonstrated IER of a test that uses a similar positioning but, rather than using a pressure cuff, involves practitioner observation of the ability of patients to maintain a position of slight upper cervical flexion in the supine position. Cleland, et al [##REF##17023251##23##] used 2 examiners and 22 subjects and found moderate IER (ICC = 0.57). Harris, et al [##REF##16305273##40##] used 2 examiners and 40 subjects and found moderate IER (ICC = 0.67); Olson, et al [##REF##16461172##41##], using an almost identical test as Harris, et al [##REF##16305273##40##], found excellent IER (<italic>k </italic>= 0.83 to 0.88) between 2 examiners in 27 subjects without neck pain.</p>","<title>Validity</title>","<p>Treleavan, et al [##REF##7954756##26##] compared 12 patients with postconcussion headache with asymptomatic controls using the CF test. They found a significant (<italic>p </italic>= 0.02) decrease in the duration of time that the test position could be held in patients compared to controls. Jull, et al [##REF##10234466##38##] compared 15 patients with cervicogenic headache and compared them with 15 controls. They found significantly (<italic>p </italic>< 0.001) poorer performance on the CF test in the patients compared to controls. Jull, et al [##REF##15040968##42##] compared patients with neck pain after whiplash, patients with insidious onset neck pain and normal controls in the performance of the CF test. They found significantly poorer performance (<italic>p </italic>< 0.05) in both neck pain groups than in controls. There was no difference between the post-whiplash patients and the insidious onset patients. Falla, et al [##REF##15223935##43##] used the CF test and electromyography (EMG) to demonstrate reduced activity in the deep cervical flexor muscles in patients with chronic neck pain compared to controls. There was also a trend toward increased activity in the sternocleidomastoid and scalene muscles in patients compared to controls. With regard to increased activity in the sternocleidomastoid muscle during the performance of the CF test, this replicated the findings of Jull [##UREF##9##44##].</p>","<title>Central Pain Hypersensitivity (CPH)</title>","<p>As will be discussed below, there is good evidence that the presence of nonorganic signs is reflective of increased pain perception. [##REF##12911018##45##]</p>","<title>Reliability</title>","<p>Sobel, et al [##REF##10668770##46##] developed nonorganic signs for patients with neck pain and found excellent to perfect (<italic>k </italic>= 0.80 to 1.00) IER in 26 patients.</p>","<title>Validity</title>","<p>The validity of cervical nonorganic signs is unknown.</p>","<p>Imaging modalities like functional MRI and SPECT have promise in the diagnosis of CPH [##REF##11098696##47##,##REF##15748125##48##]; however, it is not clear as to whether these are viable tools for common use.</p>","<title>Oculomotor dysfunction</title>","<p>Oculomotor dysfunction has been found in patients with chronic neck pain after whiplash [##REF##8498168##49##] as well as in patients with chronic tension type headache [##UREF##10##50##]. Gimse, et al [##REF##8780953##51##] compared 26 patients with chronic (average 4.7 years) neck pain after whiplash and who had complaints of visual problems or vertigo and compared them with 26 matched controls. They found significantly (<italic>p </italic>< 0.001) poorer performance on tests of oculomotor function in the whiplash group. Tjell, et al [##UREF##11##52##] compared 160 chronic (a minimum of 6 months) neck pain patients whose pain was attributed to whiplash with 122 patients with either non-traumatic neck pain, dizziness related to the cervical spine and fibromyalgia. Using the same method of measurement of oculomotor function used by Gimse, et al [##REF##8780953##51##], they found significantly (<italic>p </italic>< 0.05 to <italic>p </italic>< 0.0001) poorer performance on tests of oculomotor function in the whiplash patients compared to the other groups. There currently are no simple tests for oculomotor reflex function that are practical for the typical clinical setting. However, Heikkilla and Wenngren [##REF##9749689##53##] found significant correlation between the finding of poor performance on oculomotor tests and on a test for head repositioning accuracy, which can be measured in the clinic using Revel's test [##REF##2009044##54##].</p>","<p>Revel, et al [##REF##2009044##54##] originally demonstrated that patients with chronic neck pain had significantly (<italic>p </italic>< 0.01) poorer repositioning accuracy compared to a group of 30 asymptomatic controls. Loudon, et al [##REF##9127919##55##] also found significantly (<italic>p </italic>< 0.05) poorer repositioning accuracy in patients with chronic neck pain after whiplash compared to healthy controls; however, the small sample size (11 subjects in each group) makes interpretation problematic. Heikkilla and Wenngren [##REF##9749689##53##] found significantly greater error in patients (n = 27) with chronic neck pain after whiplash compared to 39 controls. As was stated earlier, Heikklla and Wenngren [##REF##9749689##53##] found close correlation (<italic>p </italic>= 0.007) between poor head repositioning accuracy and dysfunction of oculomotor reflexes.</p>","<p>Treleaven, et al [##REF##15919229##56##] also found close correlation between head repositioning accuracy (which they termed \"joint position error\") and oculomotor function. They calculated the SE and SP of using head repositioning accuracy to predict oculomotor dysfunction to be 0.60 and 0.54, respectively and the PPV to be 0.88.</p>","<title>Fear and Catastrophizing</title>","<p>Several instruments have been used to measure fear and catastrophizing. Regarding fear, the best studied are the Fear-Avoidance Beliefs Questionnaire [##REF##8455963##57##], the Tampa Scale for Kinesiophobia [##REF##12586559##58##] and the Fear-Avoidance Pain Scale [##UREF##12##59##].</p>","<p>In patients with neck pain, measures of fear have been found to predict future chronicity in both non-traumatic neck pain [##REF##15031840##60##] and neck pain after whiplash [##REF##15733639##61##,##REF##16527397##62##], although there is some conflicting evidence [##REF##16514328##63##].</p>","<title>Passive coping</title>","<p>The Vanderbilt Pain Management Inventory has been demonstrated to be a reliable and valid measure of passive coping [##REF##10907651##64##] and this measure has been found to predict slower recovery from whiplash injury [##REF##16644133##65##].</p>","<title>Depression</title>","<p>The Center for Epidemiologic Studies Depression (CES-D) Scale [##REF##16436016##66##] has been found to have good internal consistency and responsiveness to change over time as well as validity as compared to clinical criteria, self-report criteria, need for services and association with life events [##UREF##13##67##]. Depressive symptoms as measured by the CES-D have been found to contribute to slower recovery from whiplash injury [##REF##16644133##65##].</p>","<title>Low Back Pain</title>","<title>Question 1. Are the symptoms with which the patient is presenting reflective of a visceral disorder or a serious or potentially life-threatening disease?</title>","<p>As stated earlier, a detailed review of the literature related to this question is beyond the scope of this paper. The discussion of this question in the neck pain section of the paper applies to this section as well.</p>","<title>Question 2. From where is the patient's pain arising?</title>","<title>Centralization signs</title>","<title>Reliability</title>","<p>Early studies [##REF##8093123##68##,##UREF##14##69##] failed to demonstrated adequate IER of the McKenzie assessment in the lumbar spine. For example, Riddle and Rothstein [##REF##8093123##68##] looked at 363 patients with LBP and used 49 physical therapists at 8 different clinics and found poor IER (<italic>k </italic>= 0.26) of the classification systems of McKenzie. Postgraduate training in the system did not improve IER. However, these studies have been criticized on the grounds that minimally trained therapists were used, the study failed to consider the classification of patients into subsyndromes and, in the case of Kilby, et al [##UREF##14##69##], the protocol included elements that are not a standard part of the McKenzie system [##REF##15800512##10##]. More recent studies have attempted to improve upon the methodology of these earlier studies. Werneke, et al [##REF##10209797##70##] used 5 physical therapists who assessed 289 patients with LBP or neck pain and found IER that ranged from <italic>k </italic>= 0.917 to 1.0. Fritz, et al [##REF##10638877##71##] used 40 physical therapists in practice and 40 physical therapy students and had them watch a video of 12 examinations using the McKenzie method. They found IER coefficients ranging from <italic>k </italic>= 0.763 to 0.823. Razmjou, et al [##REF##10907894##72##] used 2 trained McKenzie therapists and 45 patients with acute, subacute or chronic LBP and found good IER (<italic>k </italic>= 0.70). Kilpikosk, et al [##REF##11935120##73##] looked at 39 patients with low back pain examined by 2 physical therapists trained in the McKenzie method. They found good agreement for the presence of the centralization sign (<italic>k </italic>= 0.7) and excellent agreement for direction preference (<italic>k </italic>= 0.9). Clare, et al [##REF##15800512##10##] found perfect IER (<italic>k </italic>= 1.0) between 2 examiners in 25 patients with LBP.</p>","<title>Validity</title>","<p>Donelson, et al [##REF##9160470##74##] found that the McKenzie assessment differentiated discogenic from nondiscogenic pain (<italic>p </italic>< 0.001), using discogram as the Gold Standard. Young, et al [##REF##14609690##75##] used the Donelson, et al [##REF##9160470##74##] data and calculated the sensitivity (SE) and specificity (SP) to be 0.94 (95% confidence interval [CI] 0.82, 0.99) and 0.52 (95% CI 0.34, 0.69), respectively. Young, et al [##REF##14609690##75##], using their own original data, calculated the SE and SP of centralization signs to be 0.47 and 1.00, respectively, also using discography as the Gold Standard. They also found that pain upon arising from a sitting position was associated with disc pain (<italic>p </italic>= .017). This historical factor may therefore be useful in identifying the \"centralizer\", though as will be noted below, pain when arising from sitting is also associated with segmental pain provocation signs in the sacroiliac (SI) area. Laslett, et al [##REF##15996606##76##] also used discogram as the Gold Standard and calculated the SE, SP, and positive likelihood ratio (PLR) and negative likelihood ratio (NLR) for centralization signs to be 40%, 94%, 6.9 and 0.63 respectively. They also used the Roland Morris Disability questionnaire to measure disability and the Distress Risk Assessment Method to measure distress, and found these factors altered the SE, SP and PPV. In the presence of severe disability, these values were 46%, 80%, 3.2 and 0.63 respectively and in the presence of severe distress they were 45%, 89%, 4.1 and 0.61 respectively.</p>","<p>It is pointed out by Long, et al [##REF##15564907##77##], that it is not necessary to assume a particular pain generating tissue when using the McKenzie assessment as a means of making treatment decisions. In their study, clinical decisions were made regarding exercise direction based on the findings of the end range loading examination. One group of patients were given exercise maneuvers in the direction of centralization of symptoms, another was given exercises in the direction opposite that of centralization, and a third group was given exercises that did not consider any specific direction. They found significantly greater improvement (<italic>p </italic>< 0.001) in outcome in the patients who were given exercises in the direction of centralization, suggesting that the McKenzie evaluation in the lumbar spine allows clinicians to make treatment decisions that are of ultimate benefit to patients. This may be a more important measure of \"validity\" than the identification of a certain pain generating tissue (e.g., using a prognostic criterion as a reference standard for the assessment method).</p>","<p>Centralization signs have also been found to be predictive of long term outcome. Werneke and Hart [##REF##11295896##78##] found that discriminating between patients who exhibit centralization signs from those who do not allows for prediction of pain, disability and return to work at 1 year. In a separate study, Werneke and Hart [##REF##14984296##79##] compared classification according to centralization signs with classification according to the Quebec Task Force (QTF) criteria [##UREF##15##80##]. They found that examination for centralization signs had greater predictive validity for pain and disability at discharge from care than the QTF criteria. Werneke and Hart have also found that assessing centralization signs over the period of multiple visits allows for more accurate discrimination than a single assessment [##REF##12544933##81##].</p>","<title>Segmental pain provocation signs</title>","<title>Reliability – lumbar</title>","<p>Similar to what was found for the cervical spine, palpation for movement restriction in the lumbar spine has not been shown to be reliable, though palpation for pain has. Keating, et al [##REF##2146357##82##] used 3 chiropractors who examined 25 asymptomatic subjects and 21 patients with low back pain. They found marginal to good IER of palpation for pain provocation over bony structures (<italic>k </italic>= 0.19 to 0.48) and soft tissues (<italic>k </italic>= 0.10 to 0.59). The strongest IER was found for the L4-5 and L5-S1 segments. Maher and Adams [##REF##8066107##83##] used 2 examiners to assess 90 subjects with low back pain, allowing each examiner to use whatever palpation method he or she chose. The examiners assessed each patient for pain and stiffness. They found that, while the IER of palpation for stiffness was low (intraclass correlation coefficient [ICC] = 0.03–0.37) the IER for pain was good (ICC = 0.67–0.72). Strender, et al [##REF##9106324##84##] used 2 medical physicians and 2 physical therapists to evaluate 71 patients with low back pain. They found moderate agreement (<italic>k </italic>= 0.40) for palpation for tenderness. Lundberg, et al [##UREF##16##85##] used 2 examiners to assess 609 female subjects for segmental mobility and pain provocation through palpation. They found good IER (<italic>k </italic>= 0.67 – 0.71) for this assessment.</p>","<p>Seffinger, et al [##REF##15454722##86##] systematically reviewed the literature regarding the IER of palpatory diagnosis in both neck and back pain. They concluded that palpatory procedures for pain provocation generally have acceptable IER (<italic>k </italic>= 0.40 or greater) and that 64% of studies looking at pain provocation found acceptable IER.</p>","<title>Reliability – Sacroiliac area</title>","<p>With regard to the SI area, the earliest study of IER was that of Potter and Rothstein [##REF##2932746##87##]. They did not use the kappa statistic, but they found that tests that attempt to determine movement abnormality had poor reliability (less than 70% agreement) but the 2 tests that relied on patient response had agreement of 70–90%. Carmichael [##REF##3655566##88##] also found poor IER (<italic>k </italic>= 0.314) of an SI test that assessed for mobility. Freburger and Riddle [##REF##10630282##89##] found poor reliability (<italic>k </italic>= 0.18) of the measurement of SI joint position using handheld calipers. Robinson, et al [##REF##16843031##90##] evaluated the reliability of various pain and SI joint dysfunction tests. The palpation test for joint play showed very poor reliability (<italic>k </italic>= -0.06). Other pain provocation tests demonstrated moderate to good reliability (k = 0.43–0.84). When clustered results of three to five pain provocation tests were used there was also good reliability (<italic>k </italic>= 0.51–0.75). A study by Vincent-Smith and Gibbons [##REF##10509062##91##] evaluated the IER and intra-examiner reliability of the standing flexion test for SI joint dysfunction. Intra-examiner reliability was moderate (<italic>k </italic>= 0.46) while IER was very poor (<italic>k </italic>= 0.052).</p>","<p>Tong, et al [##REF##16943516##92##] tested the hypothesis that combining the test results of various measures of SI joint dysfunction would yield greater reliability than individual tests. They established three methods to be evaluated; Method 1: using the test result with the highest IER; Method 2: requiring at least one test result to be abnormal for the variable to be abnormal, and; Method 3: requiring all test results to be abnormal for the variable to be abnormal. Kappa scores were 0.47, 0.08, and 0.32 using Method 1 for the sacral position, innominate bone position, and side of sacroiliac joint dysfunction, respectively. For Method 2 the values were 0.09, 0.4, and 0.16. For Method 3 the values were 0.16, 0.1, and -0.33.</p>","<p>Laslett and Williams [##REF##8073316##93##] used 2 examiners to evaluate 51 patients using 6 tests designed to identify a painful SI joint. They found moderate to high IER (<italic>k </italic>= 0.69 to 0.82), of several tests. Dreyfuss, et al [##REF##8961447##94##] found moderate IER (<italic>k </italic>= 0.61 to 0.64) for 3 SI pain provocation tests. Kokmeyer, et al [##REF##11898017##95##] found good IER (<italic>k </italic>= 0.70) of a cluster of 5 SI pain provocation tests. Studies that have evaluated tests of SI mobility have generally found poor IER [##REF##10688957##96##].</p>","<title>Validity – lumbar</title>","<p>Young, et al [##REF##14609690##75##] found a correlation between abolishment of pain with facet joint blocks and the absence of a historical report of pain when standing from a sitting position. Revel, et al [##REF##9779530##97##] found that the following characteristics were associated with patients whose pain was relieved by 75% or more with facet joint blocks: age over 65, pain not exacerbated by coughing, pain not worsened by hyperextension, pain not worsened by forward flexion, pain not worsened by rising from forward flexion, pain not worsened by extension-rotation and pain well relieved with recumbency. Similar findings have been found by other authors [##REF##2974632##98##,##REF##1534721##99##]. Laslett, et al [##UREF##17##100##] found that these criteria had low SE (< 0.17), though they did have high SP (0.90). Laslett, et al [##REF##16825041##101##] found that 4 or more out of the following 7 signs carried a SE of 1.00 and SP of 0.87 as compared to single facet joint blocks: Age ≥ 50, symptoms best walking, symptoms best sitting, onset pain is paraspinal, Modified Somatic Perception Questionnaire score > 13, positive extension/rotation test, and absence of centralization signs. So, as will be seen in the SI joint area, ruling out centralization signs is necessary to increase the diagnostic yield in identifying segmental pain provocation signs.</p>","<title>Validity – SI joint area</title>","<p>In the SI joint area, Broadhurst and Bond [##REF##9726305##102##] compared 3 pain provocation tests with anesthetic block and found the SE of single tests ranged from 0.77 to 0.87. The SP of each test was 1.00. Slipman, et al [##REF##9523780##103##] used a cluster of pain provocation tests and used the criteria of at least 3 \"positive\" tests in 50 consecutive patients with LBP. They compared this examination with the Gold Standard of single anesthetic blocks. They estimated the PPV of the examination to be 60%. van der Wurff, et al [##REF##16401431##104##] assessed 140 patients with chronic LBP with a cluster of 5 pain provocation maneuvers for the SI joint. This cluster was the same as that used in the study by Kokmeyer, et al [##REF##11898017##95##] that had found good IER. They considered that 3 out of the 5 tests being pain-producing constituted a \"positive\" test. They compared this regimen with the Gold Standard of double anesthetic blocks. They calculated the SE of the regimen as 0.85 (95% CI, 0.72–0.99) the SP as 0.79 (95% CI, 0.65–0.93), and the PPV and NPV as 0.77 (95% CI, 0.62–0.92) and 0.87 (95% CI, 0.74–0.99), respectively. The PLR was 4.02 (95% CI, 2.04–7.89); the NLR was 0.19 (95% CI, 0.07–0.47). Laslett, et al [##REF##16038856##105##] used these same SI provocation tests and compared these to single anesthetic block. They added to the Gold Standard criteria the reproduction of concordant pain upon infiltration, followed by 80% or more reduction of pain as a result of injection. They found that the presence of 3 positive tests carried a SE of 0.94, a SP of 0.78, a PPV of 0.68, and a NPV of 0.96. Young, et al [##REF##14609690##75##] also found significant (<italic>p </italic>< .001) association between the presence of 3 or more positive pain provocation tests for the SI and positive SI injection and also found positive association between positive SI injection and the following historical factors: pain when arising from a sitting position (<italic>p </italic>= .02), pain being unilateral (<italic>p </italic>= .05) and the absence of midline pain (<italic>p </italic>= .05). They also noted that patients with positive SI injection rarely had pain superior to the L5 level.</p>","<p>Importantly, Laslett, et al [##REF##12775204##106##] found that performing SI provocation maneuvers in the context of the end range loading exam for centralization signs (see below) increases the diagnostic yield of the SI tests. The SP of the SI provocation tests rose from 0.78 to 0.87 and the PLR rose from 4.16 to 6.97.</p>","<p>Slipman, et al [##REF##8902970##107##] compared radionuclide imaging to the Gold Standard of single SI joint block and found this test to have high SP (100%) but very low SE (12.9%).</p>","<title>Neurodynamic signs</title>","<title>Reliability</title>","<p>The standard neurodynamic tests in the lumbar spine are the Straight Leg Raise (SLR), Femoral Nerve Stretch test (FNST – also sometimes referred to as the Prone Knee Bend [##UREF##18##108##]) and the Slump test. Clinicians will often include Bragard's test (adding ankle dorsiflexion to the SLR) and the Well Leg Raise (WLR) test (eliciting pain on the affected side by performing a SLR on the contralateral limb) to serve as sensitizing and differentiating maneuvers for the purpose of increasing the specificity of the examination for lower lumbar nerve root pain [##REF##16038853##109##].</p>","<p>Hunt, et al [##REF##11740361##110##] assessed the IER of the SLR using 2 teams of examiners, each team consisting of one physician and one physical therapist. They found fair IER (<italic>k </italic>= 0.54 for left leg, 0.48 for right leg) but this study used asymptomatic subjects and measured SLR using a goniometer. Vroomen, et al [##REF##10647166##111##], used a neurologist and a neurology resident to assess 338 patients with \"sciatica\". They calculated the IER of a variety historical factors and clinical tests in patients with suspected lumbar radiculopathy. For the standard SLR, they found good IER (<italic>k </italic>= 0.68) when the interpretation of the test findings included the production of \"typically dermatomal pain\". The <italic>k </italic>values for the Bragard's and WLR tests were 0.66 and 0.70, respectively. When historical and examination factors were taken into consideration regarding arriving at a diagnosis of nerve root pain, the <italic>k </italic>value was 0.66. The historical factors with the greatest IER were increased pain with coughing/sneezing/straining (<italic>k </italic>= 0.64), increased pain with walking (<italic>k </italic>= 0.56), coldness in the lower extremity (<italic>k </italic>= 0.56), urinary incontinence (<italic>k </italic>= 0.79) and previous back pain episodes (<italic>k </italic>= 0.67).</p>","<p>McCombe, et al [##REF##2528822##112##] used 2 surgeons to assess 50 patients and found fair agreement for the FNST (<italic>k </italic>= 0.3–0.5). Philip, et al [##UREF##19##113##] used 6 pairs of physiotherapists to examine 93 patients using the Slump test. They found good to perfect IER (<italic>k </italic>= 0.72 to 1.00). Gabbe, et al [##UREF##20##114##] used a physiotherapist and a research student to assess 15 asymptomatic volunteers using the slump test and found excellent reliability (ICC = 0.92, 95% CI 0.77, 0.97).</p>","<title>Validity</title>","<p>Vroomen, et al [##REF##11971050##115##] found that SLR was not predictive of the presence of herniated disc on MRI. They did not assess WLR or Bragard's test. They did note that the historical factors of a dermatomal distribution of pain, increase in pain on coughing, sneezing, or straining, paroxysmal pain, and predominant leg pain were predictive. Using MRI as a \"Gold Standard\" may be questionable because of the potential for false positive findings [##REF##11413431##116##]. Lurie [##REF##15949776##117##] reviewed the literature on diagnostic tests for LBP and found that the SLR has generally been found to have high SE (0.78 to 0.97) but low SP (0.10 to 0.52) in identifying patients with disc herniation. The opposite is found for WLR test, which has been found to have low SE (0.22 to 0.52) and high SP (0.85 to 1.0). He does note, however that \"much of the literature is limited by methodological flaws\". Many clinicians feel that the combination of the SLR and WLR, along with Bragard's test and other \"localizing\" and \"sensitizing\" maneuvers improves the SE and SP of the examination for pain of neural origin [##REF##16038853##109##]. This has not been specifically evaluated.</p>","<p>The validity of the FNST has not been well studied [##REF##15949776##117##].</p>","<p>Stankovic, et al [##REF##10463018##118##] found those patients with the complaint of LBP and/or leg pain whose imaging revealed a herniated disc were more likely to have distal pain in the lower extremity on the performance of the Slump test, although the difference was not statistically significant (<italic>p </italic>< 0.017). No values with regard to SE, SP and PPV and NPV were calculated.</p>","<title>Myofascial Signs</title>","<title>Reliability</title>","<p>Nice, et al [##REF##1307701##119##] used 12 examiners to assess 50 patients with LBP for trigger points, using the standard criteria of the presence of a \"taut band\" and localized \"nodule\", the presence of a \"twitch response\" and the reproduction of familiar pain. They found IER to be poor (<italic>k </italic>= 0.29 to 0.38). Njoo and Van der Does [##REF##7838580##120##] also found poor IER when considering all of the standard criteria of TrP presence. However, when considering only tenderness to palpation, particularly when combined with the identification of concordant pain on the part of the patient, IER increased greatly (<italic>k </italic>> 0.5). Hsieh, et al [##UREF##21##121##] used 1 \"expert\" DC with many years of experience with TrP palpation, 2 DC's with 15 years of practice experience but not with extensive experience with TrP palpation, and several chiropractic and psychiatry residents. They provided all clinicians with 3 2-hour lectures and 3 2-hour hands-on sessions as training in TrP palpation, and compared the agreement between the expert and the others for the presence of taut band, local twitch response and referred pain. They found generally poor IER, concluding that even with experienced clinicians, short term training in TrP palpation is not enough to provide IER.</p>","<p>It would appear that if the examiner places greatest emphasis on tenderness to palpation and reproduction of concordant pain, and less emphasis on the presence of a taut band and a twitch response, the IER of muscle palpation signs will be enhanced. Also, Simons has pointed out [##UREF##22##122##] that those studies using untrained and/or inexperienced examiners have generally found poor IER, whereas those using trained and experienced examiners have generally found favorable IER in TrP examination, indicating the importance of examiners having appropriate training and experience with muscle palpation signs.</p>","<title>Validity</title>","<p>As with the cervical spine, the validity of myofascial signs in the lumbar spine is unknown due to the absence of a Gold Standard for the identification of myofascial pain.</p>","<title>3. What has gone wrong with this person as a whole that would cause the pain experience to develop and persist?</title>","<title>Dynamic instability (impaired motor control)</title>","<title>Reliability</title>","<p>There are 3 tests that have been proposed to identify the presence of dynamic instability in the lumbar spine, and for which there are data on IER. One is the Segmental Instability test [##REF##14669195##123##], which Hicks, et al [##REF##14669195##123##] found to have excellent (<italic>k </italic>= .87) IER between 3 pairs of examiners in 63 subjects. This study [##REF##14669195##123##] found the Standing Flexion test to have moderate IER (<italic>k </italic>= .69). The Hip Extension test [##REF##16762665##124##], was found by Murphy, et al [##REF##16762665##124##] to have good (<italic>k </italic>= 0.72 to 0.76) IER between 2 examiners in 42 subjects.</p>","<title>Reliability – pelvis</title>","<p>The Active Straight Leg Raise (ASLR) test [##UREF##23##125##] is designed to assess dynamic stability in the pelvis. IER of the ASLR has not been evaluated, however, Mens, et al [##REF##11413432##126##] test-retest reliability over the space of one week to be high (Pearson's correlation coefficient = 0.87; ICC = 0.83) in a study of pregnant women.</p>","<title>Validity – lumbar</title>","<p>The only validity study that was found was that of Abbott, et al [##REF##16274487##127##]. This study assessed manual examination using intervertebral motion tests. They compared this with a reference standard using flexion-extension radiographs. They provided SE, SP and PPV data, however, no data were presented with regard to the IER of the manual examination procedures, making interpretation of the validity data difficult.</p>","<title>Validity – pelvis</title>","<p>Mens, et al [##REF##11413432##126##] compared the ASLR test with the Posterior Pelvic Pain Provocation (PPPP) test, a test with good reliability and validity [##REF##11413432##126##] for the identification of painful SI joints. Using the PPPP test as the Gold Standard, they found the ASLR test to have a SE of 0.87 and a SP of 0.94. In another study, Mens, et al [##REF##11805667##128##] compared the ASLR test to the Quebec Back Pain Disability Scale in 200 pregnant patients with posterior pelvic pain. They found a high correlation between the 2 tests (<italic>r </italic>= 0.70). O'Sullivan et al [##REF##11805650##129##] found evidence of altered activity in the diaphragm and the pelvic floor muscles, both of which are thought to play important roles in motor control of the trunk, in patients with a positive ASLR as compared to those with a normal test. No actual measures of pelvic motor control were performed, however.</p>","<title>Central Pain Hypersensitivity (CPH)</title>","<title>Reliability</title>","<p>There is some evidence for the IER of Waddell's nonorganic signs, although this evidence is inconsistent [##REF##12911018##45##].</p>","<title>Validity</title>","<p>Fishbain, et al [##REF##12911018##45##] reviewed the literature on the use of Waddell's nonorganic signs and found consistent evidence that they are associated with decreased functional performance, poor treatment outcome and increased pain perception. Whether the relationship between the presence of these signs and increased pain perception means that these signs are an indication of CPH specifically is unknown. However, until further investigation is undertaken, it appears that these signs may be a useful means to identify increased pain perception that may be related to CPH.</p>","<title>Fear and Catastrophizing</title>","<p>The Fear-Avoidance Beliefs Questionnaire [##REF##8455963##57##], the Tampa Scale for Kinesiophobia [##REF##12586559##58##] and the Fear-Avoidance Pain Scale [##UREF##12##59##] have been demonstrated to be predictive of present LBP as well as future progression of chronicity [##REF##11444718##130##, ####REF##15927382##131##, ##REF##16359797##132##, ##REF##16540870##133##, ##REF##15109970##134####15109970##134##]. Regarding catastrophizing, the Pain Catastrophizing Scale [##REF##16359797##132##,##REF##15109970##134##] has been found to be useful.</p>","<p>These measures have been found to predict decreased physical performance and perceived disability in patients with acute LBP [##REF##16359797##132##], current pain intensity and disability in patients with chronic LBP [##REF##11444718##130##], and reduction in disability after treatment [##REF##15109970##134##].</p>","<title>Passive Coping</title>","<p>The Guarding scale of the Chronic Pain Coping Inventory [##REF##15927382##131##] and the Coping Strategies Questionnaire [##REF##16291293##135##] have been found to be predictive, in part, of chronicity in patients with LBP.</p>","<title>Depression</title>","<p>The Beck Depression Inventory (BDI) has been used for a number of years in patients with spinal pain, and has been demonstrated to have good utility in identifying significant depressive symptoms in LBP patients [##REF##10382925##136##]. Walsh, et al [##REF##16651227##137##] found that a Mental Component Summary cutoff score of 35 on the SF-36 instrument carried a SE of 0.80 and a SP of 0.90 compared to the Gold Standard of the CES-D. Low scores on the SF-36 Mental Health Index are associated both cross-sectionally and longitudinally with low-back pain and disability [##REF##12812821##138##] suggesting that psychological distress may be both a predictor and consequence of spinal pain. The Depression Anxiety Stress Scales (DASS) have been found to have good internal consistency and reliability, and to compare favorably with the BDI [##REF##7726811##139##], although this study was not performed with spinal pain patients. Haggman, et al [##REF##15563256##140##] used receiver operating characteristic curves to compare the administration of a 2 question screening (\"During the past month, have you often been bothered by feeling down, depressed, or hopeless?\" and \"During the past month, have you often been bothered by little interest or pleasure in doing things?\") with the DASS. They found the screening questions accurately predicted DASS scores (Area Under the Curve [AUC] values of 0.77 to 0.81). The PLR reached as high as 5.40 and the NLRs as low as 0.18. Whether this 2-question screening is useful for research purposes is unclear.</p>","<p>As was stated in Part 1, there is significant overlap and interaction between fear, catastrophizing, passive coping and depression [##REF##16428950##141##,##REF##8657437##142##]. Thus, from a clinical standpoint, it may be only necessary to measure 1 or 2 of these constructs in spinal pain patients, rather than having to measure all, however research is needed to determine this for certain.</p>"],"string":"[\n \"<title>Results</title>\",\n \"<p>The search strategy identified 1769 articles, and of these, 138 were deemed relevant. Additional files ##SUPPL##0##1## and ##SUPPL##1##2## provide a breakdown of the number of studies in each area of consideration. Additional files ##SUPPL##2##3## and ##SUPPL##3##4## present the data from those studies that met the inclusion criteria. We have divided the presentation of the literature into those studies that apply to patients with neck pain and those that relate to patients with low back pain (LBP).</p>\",\n \"<title>Neck Pain</title>\",\n \"<title>Question 1. Are the symptoms with which the patient is presenting reflective of a visceral disorder or a serious or potentially life-threatening disease?</title>\",\n \"<p>A detailed review of the literature related to this question is beyond the scope of this paper. However, in general, history, focusing on the presence of symptoms such as GI distress, fever or previous history of cancer, and examination, focusing on vital signs, abdominal examination and examination of peripheral pulses, are useful in raising the level of suspicion as to the presence of a visceral disorder or a serious or potentially life-threatening disease [##REF##17909209##5##]. Imaging and/or special tests such as sedimentation rate can be utilized for further confirmation [##REF##17909209##5##]. Details can be found elsewhere [##REF##17909209##5##, ####UREF##2##6##, ##UREF##3##7####3##7##].</p>\",\n \"<title>Question 2. From where is the patient's pain arising?</title>\",\n \"<title>Centralization signs</title>\",\n \"<p>Centralization signs are detected through methods originally developed by McKenzie [##UREF##4##8##,##UREF##5##9##]. The examination procedure involves moving the spine to end range in various directions and monitoring the mechanical and symptomatic response to these movements.</p>\",\n \"<title>Reliability</title>\",\n \"<p>Clare, et al [##REF##15800512##10##] used 2 physical therapists trained in the McKenzie method to examine 25 patients with cervical pain. They found good inter-examiner reliability (IER) (<italic>kappa</italic>, [<italic>k</italic>] = 0.63 and 93% agreement) for the assessment procedure.</p>\",\n \"<title>Validity</title>\",\n \"<p>No studies were identified that have addressed the validity of centralization signs in the cervical spine.</p>\",\n \"<title>Segmental pain provocation signs</title>\",\n \"<p>A number of studies have examined segmental mobility assessment and have generally found poor IER [##REF##3559420##11##, ####UREF##6##12##, ##REF##12072848##13##, ##UREF##7##14##, ##REF##7659738##15##, ##REF##15994114##16####15994114##16##] and validity [##REF##11896374##17##]. Other studies have examined procedures designed to identify segmental pain (as opposed to mobility impairment).</p>\",\n \"<title>Reliability</title>\",\n \"<p>Hubka and Phelan [##REF##7884328##18##] assessed the IER of palpation for tenderness between 2 practitioners in 30 patients with unilateral neck pain. They found good IER (<italic>k </italic>= 0.68). Jull, et al [##REF##11676679##19##] assessed IER of segmental palpation using 7 examiners and 40 subjects with or without neck pain and headache. The criteria for a positive test were based on resistance to joint movement and pain provocation in response to palpation. Kappa values indicated excellent to perfect IER (<italic>k </italic>= 0.78–1.00) in 6 instances, fair to good (<italic>k </italic>= 0.45–0.65) in 14 instances and poor (<italic>k </italic>= 0.25–0.34) in 5 instances. They point out that, in the instances of poor agreement, the raw data indicated that the examiners had agreed on 13 of 14 decisions. But the calculations of <italic>k </italic>were vulnerable because 12 of the 13 agreements were in the same cell of agreed negative finding. Marcus, et al [##REF##15613190##20##] used 4 physical therapists to examine 72 headache patients and 24 controls. The therapists examined all subjects for \\\"cervical synovial joint abnormalities\\\" in the same manner as described in the study by Jull, et al [##REF##11676679##19##]. They found good IER (<italic>k </italic>= 0.63) between examiners. McPartland and Goodridge [##UREF##8##21##] assessed IER of \\\"TART\\\" exam, described as segmental palpation that focused on three parameters: tissue texture change, restriction of vertebral motion and zygapophyseal (z) joint tenderness. They found the IER of examination that considered all three parameters was poor (<italic>k </italic>= 0.35 for asymptomatic subjects, <italic>k </italic>= 0.34 for symptomatic subjects). But for the parameter of tenderness alone, IER improved (<italic>k </italic>= 0.529). Van Suijlekom, et al [##REF##10940097##22##] used 2 neurologists to examine 24 headache patients and found IER for segmental palpation to be slight to fair (<italic>k </italic>= 0.14 to 0.37). However, the palpation method was poorly described in this study. Also, it is not known as to whether the difference between the findings of this study and those of the other studies reported here relate to the fact that the \\\"negative\\\" IER studies used neurologists, whereas the \\\"positive\\\" IER study used chiropractors or physical therapists. Cleland, et al [##REF##17023251##23##] used 2 examiners and 22 subjects and found highly variable IER between 2 physical therapists for palpation for pain provocation, with <italic>k </italic>ranging from -.52 to .90, depending on the segment involved. They speculated that this high variability related to the clinicians not agreeing on the segmental level being examined, as opposed to lack of agreement on the findings.</p>\",\n \"<title>Validity</title>\",\n \"<p>Jull, et al [##REF##3343953##24##] used diagnostic blocks to identify the presence and location of symptomatic z joints in 20 patients with cervical related pain. The patients were examined by a manipulative physiotherapist who also attempted to identify the presence and location of symptomatic z joints. The definition of a symptomatic joint as determined by palpation was based on abnormal \\\"end feel\\\", increased resistance to motion and reproduction of pain. They found that the SE and SP were both 1.00. That is, the examiner was able to identify 100% of the symptomatic segments as well as all of the subjects whose pain was not abolished by diagnostic block. This study used single, rather than double blind, diagnostic blocks. Regardless, as will be discussed below, the use of diagnostic blocks as a Gold Standard for the presence of z joint pain has been questioned [##REF##17197329##25##]. Treleaven, et al [##REF##7954756##26##] assessed 12 patients with postconcussion headache with segmental palpation. The method of palpation was the same as that used by Jull, et al [##REF##3343953##24##]. They found complete agreement between the examiner and independent report of the patient as to which segments were painful and almost complete agreement as to which segment was most painful. Sandmark and Nisell [##REF##8602474##27##], calculated the SE, SP and PPV and negative predictive value (NPV) of segmental palpation in the cervical spine relative to reported neck pain. They found these values to be 0.82, 0.79, 0.62 and 0.91 respectively. Lord, et al [##REF##7931379##28##], used a double blind anesthetic block to determine the prevalence of pain arising from the C2-3 z joint in patients with the complaint of chronic headache after cervical trauma. These authors demonstrated that the prevalence of C2-3 z-joint pain was 53%, and the only sign that was associated with these patients was tenderness to palpation over the C2-3 z joint. They calculated that palpation had SE of 0.85, a positive likelihood ratio (PLR) of 1.7 and a negative likelihood ratio (NLR) of 0.3. The precise method of palpation was not described. Zito, et al [##REF##16027027##29##] using the palpation method found to be reliable by Jull et al [##REF##11676679##19##] found a significantly higher incidence (p < 0.05) of hypomobile and painful z joints in the upper cervical spine of patients classified according to the International Headache Society criteria as having cervicogenic headache compared to those classified as having migraine with aura. King, et al [##REF##17197328##30##] used \\\"controlled, diagnostic blocks\\\" as a Gold Standard against which segmental palpation that was described as being similar to that of Jull, et al [##REF##3343953##24##]. They found the SE to be 0.88, SP to be 0.39 and PLR to be 1.3. Again, using diagnostic block as a Gold Standard may be questionable [##REF##17197329##25##], leaving open the issue of what should be the Gold Standard for segmental palpation signs. Further work in the area of establishing a true Gold Standard for the identification of zygapophyseal joint pain may be needed before definitive statements regarding the presence or absence of pain from this structure can be made.</p>\",\n \"<title>Neurodynamic signs</title>\",\n \"<title>Reliability</title>\",\n \"<p>The standard neurodynamic test in the cervical spine is the brachial plexus tension test (also known as the upper limb tension test [##REF##10590339##31##]). Wainner, et al [##REF##12544957##32##] found good to excellent IER of this test (<italic>k </italic>= 0.76 to 0.81). They also found good to excellent IER of several historical questions of patients with documented cervical radiculopathy (<italic>k </italic>= 0.53 to .082). They found varying IER of neurologic exam findings, but good to excellent IER of Spurling's test (which they described as bending the seated patient's head toward the side of symptoms, rotating and extending slightly, and applying downward pressure), the cervical distraction test and Valsalva's maneuver. The kappa values for these tests ranged from 0.60 to 0.88.</p>\",\n \"<title>Validity</title>\",\n \"<p>Wainner, et al [##REF##12544957##32##] provide data on the SE, SP PLR and NLR of a variety of historical factors and examination procedures. They found that the cluster of 4 tests – Spurling's test, the upper limb tension test, the cervical distraction test and limited rotation toward the side of symptoms secondary to pain – carried the greatest diagnostic accuracy as compared to the Gold Standard of electromyography. When 3 of these tests were positive, there was a 65% probability of the presence of cervical radiculopathy the SE and SP were 0.39 and 0.94, respectively and a PLR of 6.1. When all 4 tests were positive, there was a 90% probability of the presence of cervical radiculopathy. The SE and SP were 0.24 and 0.99 respectively and the PLR was 30.3.</p>\",\n \"<p>Shah and Rajshekhar [##REF##15799149##33##] also used Spurling's test, the description of which was the same as that in the Wainner, et al study [##REF##12544957##32##], and found it to be useful in identifying \\\"soft disc prolapse\\\" as opposed to \\\"hard disc\\\" (i.e., osteophyte). They calculated the SE and SP to be 0.90 and 1.00, respectively compared to the Gold Standard of operative findings. The PPV was calculated to be 1.00 and the NPV to be 0.71. In patients treated non-surgically, they used MRI as the Gold Standard and calculated the SE and SP to be 0.90 and 0.93, respectively. The PPV was calculated to be 0.90 and the NPV to be 0.93.</p>\",\n \"<title>Muscle palpation signs</title>\",\n \"<title>Reliability</title>\",\n \"<p>Marcus, et al, in the same study cited above [##REF##15613190##20##] found good to perfect IER of TrP palpation in the cervical spine (<italic>k </italic>= 0.74), head (<italic>k </italic>= 0.81) and shoulder (<italic>k </italic>= 1.00). van Suijlekom, et al [##REF##10940097##22##] in the study cited above, found variable IER (<italic>k </italic>= 0.0 – 1.00) of TrP palpation in patients with headache. As was the case with segmental palpation, the method of TrP examination was poorly described. Gerwin, et al [##REF##9060014##34##] performed 2 different experiments to assess IER. In the first, 4 examiners assessed 20 different muscles on each of 25 patients with various symptom presentations. They used a general observer-agreement statistic called the \\\"<italic>S</italic><sub>av</sub>\\\", which they defined as \\\"a generalized version of the Cohen's kappa which reports pairwise judge agreement corrected for chance agreement.\\\" They found poor IER (<italic>S</italic><sub>av </sub>= 0.0–1.0). They then repeated the study after spending a 3-hour session in which the examiners discussed positive findings and palpation techniques. They found good to excellent IER (<italic>S</italic><sub>av </sub>= 0.65 – .95) after the training session. Sciotti, et al [##REF##11514085##35##] found good IER (Generalizability coefficient = 0.83–0.92) between 2 examiners looking for latent trigger points (TrPs) in the upper trapezius muscle. However, the subjects were asymptomatic. On the other hand, Lew, et al [##REF##11485358##36##] found poor IER for TrP palpation in the upper trapezius, although the subjects in that study were also asymptomatic.</p>\",\n \"<title>Validity</title>\",\n \"<p>The validity of muscle palpation signs is unknown, largely due to lack of an appropriate Gold or reference standard.</p>\",\n \"<title>3. What has gone wrong with this person as a whole that would cause the pain experience to develop and persist?</title>\",\n \"<p>As was discussed in the earlier paper describing the DBCDR [##REF##17683556##2##], this third question attempts to identify those factors that may be placing the patient at risk of developing persistent or recurrent spinal pain, or, in the case of chronic patients, have contributed to the establishment of the chronic or recurrent problem. There are a number of factors that have been suggested to be of importance in the perpetuation of chronic spinal pain, although research investigating this area is ongoing.</p>\",\n \"<title>Dynamic instability (impaired motor control)</title>\",\n \"<title>Reliability</title>\",\n \"<p>In the cervical spine, the Craniocervical Flexion (CF) test [##REF##15245706##37##,##REF##10234466##38##] is designed to detect decreased activity in the deep cervical flexor muscles and hyperactivity in the sternocleidomastoid muscles. It is thought that, as the deep cervical flexors are important for stability of the intersegmental joints of the cervical spine, this imbalance in muscle activation compromises cervical spine stability [##REF##15245706##37##]. The CF test measures the motor control capacity of the deep cervical flexors. Jull, et al [##REF##10234466##38##] found good IER (ICC = 0.81 to 0.93) in 50 asymptomatic subjects; Chiu, et al [##REF##16268243##39##] found good IER (<italic>k </italic>= 0.72) in 10 asymptomatic subjects.</p>\",\n \"<p>Recently, 3 studies [##REF##17023251##23##,##REF##16305273##40##,##REF##16461172##41##] have demonstrated IER of a test that uses a similar positioning but, rather than using a pressure cuff, involves practitioner observation of the ability of patients to maintain a position of slight upper cervical flexion in the supine position. Cleland, et al [##REF##17023251##23##] used 2 examiners and 22 subjects and found moderate IER (ICC = 0.57). Harris, et al [##REF##16305273##40##] used 2 examiners and 40 subjects and found moderate IER (ICC = 0.67); Olson, et al [##REF##16461172##41##], using an almost identical test as Harris, et al [##REF##16305273##40##], found excellent IER (<italic>k </italic>= 0.83 to 0.88) between 2 examiners in 27 subjects without neck pain.</p>\",\n \"<title>Validity</title>\",\n \"<p>Treleavan, et al [##REF##7954756##26##] compared 12 patients with postconcussion headache with asymptomatic controls using the CF test. They found a significant (<italic>p </italic>= 0.02) decrease in the duration of time that the test position could be held in patients compared to controls. Jull, et al [##REF##10234466##38##] compared 15 patients with cervicogenic headache and compared them with 15 controls. They found significantly (<italic>p </italic>< 0.001) poorer performance on the CF test in the patients compared to controls. Jull, et al [##REF##15040968##42##] compared patients with neck pain after whiplash, patients with insidious onset neck pain and normal controls in the performance of the CF test. They found significantly poorer performance (<italic>p </italic>< 0.05) in both neck pain groups than in controls. There was no difference between the post-whiplash patients and the insidious onset patients. Falla, et al [##REF##15223935##43##] used the CF test and electromyography (EMG) to demonstrate reduced activity in the deep cervical flexor muscles in patients with chronic neck pain compared to controls. There was also a trend toward increased activity in the sternocleidomastoid and scalene muscles in patients compared to controls. With regard to increased activity in the sternocleidomastoid muscle during the performance of the CF test, this replicated the findings of Jull [##UREF##9##44##].</p>\",\n \"<title>Central Pain Hypersensitivity (CPH)</title>\",\n \"<p>As will be discussed below, there is good evidence that the presence of nonorganic signs is reflective of increased pain perception. [##REF##12911018##45##]</p>\",\n \"<title>Reliability</title>\",\n \"<p>Sobel, et al [##REF##10668770##46##] developed nonorganic signs for patients with neck pain and found excellent to perfect (<italic>k </italic>= 0.80 to 1.00) IER in 26 patients.</p>\",\n \"<title>Validity</title>\",\n \"<p>The validity of cervical nonorganic signs is unknown.</p>\",\n \"<p>Imaging modalities like functional MRI and SPECT have promise in the diagnosis of CPH [##REF##11098696##47##,##REF##15748125##48##]; however, it is not clear as to whether these are viable tools for common use.</p>\",\n \"<title>Oculomotor dysfunction</title>\",\n \"<p>Oculomotor dysfunction has been found in patients with chronic neck pain after whiplash [##REF##8498168##49##] as well as in patients with chronic tension type headache [##UREF##10##50##]. Gimse, et al [##REF##8780953##51##] compared 26 patients with chronic (average 4.7 years) neck pain after whiplash and who had complaints of visual problems or vertigo and compared them with 26 matched controls. They found significantly (<italic>p </italic>< 0.001) poorer performance on tests of oculomotor function in the whiplash group. Tjell, et al [##UREF##11##52##] compared 160 chronic (a minimum of 6 months) neck pain patients whose pain was attributed to whiplash with 122 patients with either non-traumatic neck pain, dizziness related to the cervical spine and fibromyalgia. Using the same method of measurement of oculomotor function used by Gimse, et al [##REF##8780953##51##], they found significantly (<italic>p </italic>< 0.05 to <italic>p </italic>< 0.0001) poorer performance on tests of oculomotor function in the whiplash patients compared to the other groups. There currently are no simple tests for oculomotor reflex function that are practical for the typical clinical setting. However, Heikkilla and Wenngren [##REF##9749689##53##] found significant correlation between the finding of poor performance on oculomotor tests and on a test for head repositioning accuracy, which can be measured in the clinic using Revel's test [##REF##2009044##54##].</p>\",\n \"<p>Revel, et al [##REF##2009044##54##] originally demonstrated that patients with chronic neck pain had significantly (<italic>p </italic>< 0.01) poorer repositioning accuracy compared to a group of 30 asymptomatic controls. Loudon, et al [##REF##9127919##55##] also found significantly (<italic>p </italic>< 0.05) poorer repositioning accuracy in patients with chronic neck pain after whiplash compared to healthy controls; however, the small sample size (11 subjects in each group) makes interpretation problematic. Heikkilla and Wenngren [##REF##9749689##53##] found significantly greater error in patients (n = 27) with chronic neck pain after whiplash compared to 39 controls. As was stated earlier, Heikklla and Wenngren [##REF##9749689##53##] found close correlation (<italic>p </italic>= 0.007) between poor head repositioning accuracy and dysfunction of oculomotor reflexes.</p>\",\n \"<p>Treleaven, et al [##REF##15919229##56##] also found close correlation between head repositioning accuracy (which they termed \\\"joint position error\\\") and oculomotor function. They calculated the SE and SP of using head repositioning accuracy to predict oculomotor dysfunction to be 0.60 and 0.54, respectively and the PPV to be 0.88.</p>\",\n \"<title>Fear and Catastrophizing</title>\",\n \"<p>Several instruments have been used to measure fear and catastrophizing. Regarding fear, the best studied are the Fear-Avoidance Beliefs Questionnaire [##REF##8455963##57##], the Tampa Scale for Kinesiophobia [##REF##12586559##58##] and the Fear-Avoidance Pain Scale [##UREF##12##59##].</p>\",\n \"<p>In patients with neck pain, measures of fear have been found to predict future chronicity in both non-traumatic neck pain [##REF##15031840##60##] and neck pain after whiplash [##REF##15733639##61##,##REF##16527397##62##], although there is some conflicting evidence [##REF##16514328##63##].</p>\",\n \"<title>Passive coping</title>\",\n \"<p>The Vanderbilt Pain Management Inventory has been demonstrated to be a reliable and valid measure of passive coping [##REF##10907651##64##] and this measure has been found to predict slower recovery from whiplash injury [##REF##16644133##65##].</p>\",\n \"<title>Depression</title>\",\n \"<p>The Center for Epidemiologic Studies Depression (CES-D) Scale [##REF##16436016##66##] has been found to have good internal consistency and responsiveness to change over time as well as validity as compared to clinical criteria, self-report criteria, need for services and association with life events [##UREF##13##67##]. Depressive symptoms as measured by the CES-D have been found to contribute to slower recovery from whiplash injury [##REF##16644133##65##].</p>\",\n \"<title>Low Back Pain</title>\",\n \"<title>Question 1. Are the symptoms with which the patient is presenting reflective of a visceral disorder or a serious or potentially life-threatening disease?</title>\",\n \"<p>As stated earlier, a detailed review of the literature related to this question is beyond the scope of this paper. The discussion of this question in the neck pain section of the paper applies to this section as well.</p>\",\n \"<title>Question 2. From where is the patient's pain arising?</title>\",\n \"<title>Centralization signs</title>\",\n \"<title>Reliability</title>\",\n \"<p>Early studies [##REF##8093123##68##,##UREF##14##69##] failed to demonstrated adequate IER of the McKenzie assessment in the lumbar spine. For example, Riddle and Rothstein [##REF##8093123##68##] looked at 363 patients with LBP and used 49 physical therapists at 8 different clinics and found poor IER (<italic>k </italic>= 0.26) of the classification systems of McKenzie. Postgraduate training in the system did not improve IER. However, these studies have been criticized on the grounds that minimally trained therapists were used, the study failed to consider the classification of patients into subsyndromes and, in the case of Kilby, et al [##UREF##14##69##], the protocol included elements that are not a standard part of the McKenzie system [##REF##15800512##10##]. More recent studies have attempted to improve upon the methodology of these earlier studies. Werneke, et al [##REF##10209797##70##] used 5 physical therapists who assessed 289 patients with LBP or neck pain and found IER that ranged from <italic>k </italic>= 0.917 to 1.0. Fritz, et al [##REF##10638877##71##] used 40 physical therapists in practice and 40 physical therapy students and had them watch a video of 12 examinations using the McKenzie method. They found IER coefficients ranging from <italic>k </italic>= 0.763 to 0.823. Razmjou, et al [##REF##10907894##72##] used 2 trained McKenzie therapists and 45 patients with acute, subacute or chronic LBP and found good IER (<italic>k </italic>= 0.70). Kilpikosk, et al [##REF##11935120##73##] looked at 39 patients with low back pain examined by 2 physical therapists trained in the McKenzie method. They found good agreement for the presence of the centralization sign (<italic>k </italic>= 0.7) and excellent agreement for direction preference (<italic>k </italic>= 0.9). Clare, et al [##REF##15800512##10##] found perfect IER (<italic>k </italic>= 1.0) between 2 examiners in 25 patients with LBP.</p>\",\n \"<title>Validity</title>\",\n \"<p>Donelson, et al [##REF##9160470##74##] found that the McKenzie assessment differentiated discogenic from nondiscogenic pain (<italic>p </italic>< 0.001), using discogram as the Gold Standard. Young, et al [##REF##14609690##75##] used the Donelson, et al [##REF##9160470##74##] data and calculated the sensitivity (SE) and specificity (SP) to be 0.94 (95% confidence interval [CI] 0.82, 0.99) and 0.52 (95% CI 0.34, 0.69), respectively. Young, et al [##REF##14609690##75##], using their own original data, calculated the SE and SP of centralization signs to be 0.47 and 1.00, respectively, also using discography as the Gold Standard. They also found that pain upon arising from a sitting position was associated with disc pain (<italic>p </italic>= .017). This historical factor may therefore be useful in identifying the \\\"centralizer\\\", though as will be noted below, pain when arising from sitting is also associated with segmental pain provocation signs in the sacroiliac (SI) area. Laslett, et al [##REF##15996606##76##] also used discogram as the Gold Standard and calculated the SE, SP, and positive likelihood ratio (PLR) and negative likelihood ratio (NLR) for centralization signs to be 40%, 94%, 6.9 and 0.63 respectively. They also used the Roland Morris Disability questionnaire to measure disability and the Distress Risk Assessment Method to measure distress, and found these factors altered the SE, SP and PPV. In the presence of severe disability, these values were 46%, 80%, 3.2 and 0.63 respectively and in the presence of severe distress they were 45%, 89%, 4.1 and 0.61 respectively.</p>\",\n \"<p>It is pointed out by Long, et al [##REF##15564907##77##], that it is not necessary to assume a particular pain generating tissue when using the McKenzie assessment as a means of making treatment decisions. In their study, clinical decisions were made regarding exercise direction based on the findings of the end range loading examination. One group of patients were given exercise maneuvers in the direction of centralization of symptoms, another was given exercises in the direction opposite that of centralization, and a third group was given exercises that did not consider any specific direction. They found significantly greater improvement (<italic>p </italic>< 0.001) in outcome in the patients who were given exercises in the direction of centralization, suggesting that the McKenzie evaluation in the lumbar spine allows clinicians to make treatment decisions that are of ultimate benefit to patients. This may be a more important measure of \\\"validity\\\" than the identification of a certain pain generating tissue (e.g., using a prognostic criterion as a reference standard for the assessment method).</p>\",\n \"<p>Centralization signs have also been found to be predictive of long term outcome. Werneke and Hart [##REF##11295896##78##] found that discriminating between patients who exhibit centralization signs from those who do not allows for prediction of pain, disability and return to work at 1 year. In a separate study, Werneke and Hart [##REF##14984296##79##] compared classification according to centralization signs with classification according to the Quebec Task Force (QTF) criteria [##UREF##15##80##]. They found that examination for centralization signs had greater predictive validity for pain and disability at discharge from care than the QTF criteria. Werneke and Hart have also found that assessing centralization signs over the period of multiple visits allows for more accurate discrimination than a single assessment [##REF##12544933##81##].</p>\",\n \"<title>Segmental pain provocation signs</title>\",\n \"<title>Reliability – lumbar</title>\",\n \"<p>Similar to what was found for the cervical spine, palpation for movement restriction in the lumbar spine has not been shown to be reliable, though palpation for pain has. Keating, et al [##REF##2146357##82##] used 3 chiropractors who examined 25 asymptomatic subjects and 21 patients with low back pain. They found marginal to good IER of palpation for pain provocation over bony structures (<italic>k </italic>= 0.19 to 0.48) and soft tissues (<italic>k </italic>= 0.10 to 0.59). The strongest IER was found for the L4-5 and L5-S1 segments. Maher and Adams [##REF##8066107##83##] used 2 examiners to assess 90 subjects with low back pain, allowing each examiner to use whatever palpation method he or she chose. The examiners assessed each patient for pain and stiffness. They found that, while the IER of palpation for stiffness was low (intraclass correlation coefficient [ICC] = 0.03–0.37) the IER for pain was good (ICC = 0.67–0.72). Strender, et al [##REF##9106324##84##] used 2 medical physicians and 2 physical therapists to evaluate 71 patients with low back pain. They found moderate agreement (<italic>k </italic>= 0.40) for palpation for tenderness. Lundberg, et al [##UREF##16##85##] used 2 examiners to assess 609 female subjects for segmental mobility and pain provocation through palpation. They found good IER (<italic>k </italic>= 0.67 – 0.71) for this assessment.</p>\",\n \"<p>Seffinger, et al [##REF##15454722##86##] systematically reviewed the literature regarding the IER of palpatory diagnosis in both neck and back pain. They concluded that palpatory procedures for pain provocation generally have acceptable IER (<italic>k </italic>= 0.40 or greater) and that 64% of studies looking at pain provocation found acceptable IER.</p>\",\n \"<title>Reliability – Sacroiliac area</title>\",\n \"<p>With regard to the SI area, the earliest study of IER was that of Potter and Rothstein [##REF##2932746##87##]. They did not use the kappa statistic, but they found that tests that attempt to determine movement abnormality had poor reliability (less than 70% agreement) but the 2 tests that relied on patient response had agreement of 70–90%. Carmichael [##REF##3655566##88##] also found poor IER (<italic>k </italic>= 0.314) of an SI test that assessed for mobility. Freburger and Riddle [##REF##10630282##89##] found poor reliability (<italic>k </italic>= 0.18) of the measurement of SI joint position using handheld calipers. Robinson, et al [##REF##16843031##90##] evaluated the reliability of various pain and SI joint dysfunction tests. The palpation test for joint play showed very poor reliability (<italic>k </italic>= -0.06). Other pain provocation tests demonstrated moderate to good reliability (k = 0.43–0.84). When clustered results of three to five pain provocation tests were used there was also good reliability (<italic>k </italic>= 0.51–0.75). A study by Vincent-Smith and Gibbons [##REF##10509062##91##] evaluated the IER and intra-examiner reliability of the standing flexion test for SI joint dysfunction. Intra-examiner reliability was moderate (<italic>k </italic>= 0.46) while IER was very poor (<italic>k </italic>= 0.052).</p>\",\n \"<p>Tong, et al [##REF##16943516##92##] tested the hypothesis that combining the test results of various measures of SI joint dysfunction would yield greater reliability than individual tests. They established three methods to be evaluated; Method 1: using the test result with the highest IER; Method 2: requiring at least one test result to be abnormal for the variable to be abnormal, and; Method 3: requiring all test results to be abnormal for the variable to be abnormal. Kappa scores were 0.47, 0.08, and 0.32 using Method 1 for the sacral position, innominate bone position, and side of sacroiliac joint dysfunction, respectively. For Method 2 the values were 0.09, 0.4, and 0.16. For Method 3 the values were 0.16, 0.1, and -0.33.</p>\",\n \"<p>Laslett and Williams [##REF##8073316##93##] used 2 examiners to evaluate 51 patients using 6 tests designed to identify a painful SI joint. They found moderate to high IER (<italic>k </italic>= 0.69 to 0.82), of several tests. Dreyfuss, et al [##REF##8961447##94##] found moderate IER (<italic>k </italic>= 0.61 to 0.64) for 3 SI pain provocation tests. Kokmeyer, et al [##REF##11898017##95##] found good IER (<italic>k </italic>= 0.70) of a cluster of 5 SI pain provocation tests. Studies that have evaluated tests of SI mobility have generally found poor IER [##REF##10688957##96##].</p>\",\n \"<title>Validity – lumbar</title>\",\n \"<p>Young, et al [##REF##14609690##75##] found a correlation between abolishment of pain with facet joint blocks and the absence of a historical report of pain when standing from a sitting position. Revel, et al [##REF##9779530##97##] found that the following characteristics were associated with patients whose pain was relieved by 75% or more with facet joint blocks: age over 65, pain not exacerbated by coughing, pain not worsened by hyperextension, pain not worsened by forward flexion, pain not worsened by rising from forward flexion, pain not worsened by extension-rotation and pain well relieved with recumbency. Similar findings have been found by other authors [##REF##2974632##98##,##REF##1534721##99##]. Laslett, et al [##UREF##17##100##] found that these criteria had low SE (< 0.17), though they did have high SP (0.90). Laslett, et al [##REF##16825041##101##] found that 4 or more out of the following 7 signs carried a SE of 1.00 and SP of 0.87 as compared to single facet joint blocks: Age ≥ 50, symptoms best walking, symptoms best sitting, onset pain is paraspinal, Modified Somatic Perception Questionnaire score > 13, positive extension/rotation test, and absence of centralization signs. So, as will be seen in the SI joint area, ruling out centralization signs is necessary to increase the diagnostic yield in identifying segmental pain provocation signs.</p>\",\n \"<title>Validity – SI joint area</title>\",\n \"<p>In the SI joint area, Broadhurst and Bond [##REF##9726305##102##] compared 3 pain provocation tests with anesthetic block and found the SE of single tests ranged from 0.77 to 0.87. The SP of each test was 1.00. Slipman, et al [##REF##9523780##103##] used a cluster of pain provocation tests and used the criteria of at least 3 \\\"positive\\\" tests in 50 consecutive patients with LBP. They compared this examination with the Gold Standard of single anesthetic blocks. They estimated the PPV of the examination to be 60%. van der Wurff, et al [##REF##16401431##104##] assessed 140 patients with chronic LBP with a cluster of 5 pain provocation maneuvers for the SI joint. This cluster was the same as that used in the study by Kokmeyer, et al [##REF##11898017##95##] that had found good IER. They considered that 3 out of the 5 tests being pain-producing constituted a \\\"positive\\\" test. They compared this regimen with the Gold Standard of double anesthetic blocks. They calculated the SE of the regimen as 0.85 (95% CI, 0.72–0.99) the SP as 0.79 (95% CI, 0.65–0.93), and the PPV and NPV as 0.77 (95% CI, 0.62–0.92) and 0.87 (95% CI, 0.74–0.99), respectively. The PLR was 4.02 (95% CI, 2.04–7.89); the NLR was 0.19 (95% CI, 0.07–0.47). Laslett, et al [##REF##16038856##105##] used these same SI provocation tests and compared these to single anesthetic block. They added to the Gold Standard criteria the reproduction of concordant pain upon infiltration, followed by 80% or more reduction of pain as a result of injection. They found that the presence of 3 positive tests carried a SE of 0.94, a SP of 0.78, a PPV of 0.68, and a NPV of 0.96. Young, et al [##REF##14609690##75##] also found significant (<italic>p </italic>< .001) association between the presence of 3 or more positive pain provocation tests for the SI and positive SI injection and also found positive association between positive SI injection and the following historical factors: pain when arising from a sitting position (<italic>p </italic>= .02), pain being unilateral (<italic>p </italic>= .05) and the absence of midline pain (<italic>p </italic>= .05). They also noted that patients with positive SI injection rarely had pain superior to the L5 level.</p>\",\n \"<p>Importantly, Laslett, et al [##REF##12775204##106##] found that performing SI provocation maneuvers in the context of the end range loading exam for centralization signs (see below) increases the diagnostic yield of the SI tests. The SP of the SI provocation tests rose from 0.78 to 0.87 and the PLR rose from 4.16 to 6.97.</p>\",\n \"<p>Slipman, et al [##REF##8902970##107##] compared radionuclide imaging to the Gold Standard of single SI joint block and found this test to have high SP (100%) but very low SE (12.9%).</p>\",\n \"<title>Neurodynamic signs</title>\",\n \"<title>Reliability</title>\",\n \"<p>The standard neurodynamic tests in the lumbar spine are the Straight Leg Raise (SLR), Femoral Nerve Stretch test (FNST – also sometimes referred to as the Prone Knee Bend [##UREF##18##108##]) and the Slump test. Clinicians will often include Bragard's test (adding ankle dorsiflexion to the SLR) and the Well Leg Raise (WLR) test (eliciting pain on the affected side by performing a SLR on the contralateral limb) to serve as sensitizing and differentiating maneuvers for the purpose of increasing the specificity of the examination for lower lumbar nerve root pain [##REF##16038853##109##].</p>\",\n \"<p>Hunt, et al [##REF##11740361##110##] assessed the IER of the SLR using 2 teams of examiners, each team consisting of one physician and one physical therapist. They found fair IER (<italic>k </italic>= 0.54 for left leg, 0.48 for right leg) but this study used asymptomatic subjects and measured SLR using a goniometer. Vroomen, et al [##REF##10647166##111##], used a neurologist and a neurology resident to assess 338 patients with \\\"sciatica\\\". They calculated the IER of a variety historical factors and clinical tests in patients with suspected lumbar radiculopathy. For the standard SLR, they found good IER (<italic>k </italic>= 0.68) when the interpretation of the test findings included the production of \\\"typically dermatomal pain\\\". The <italic>k </italic>values for the Bragard's and WLR tests were 0.66 and 0.70, respectively. When historical and examination factors were taken into consideration regarding arriving at a diagnosis of nerve root pain, the <italic>k </italic>value was 0.66. The historical factors with the greatest IER were increased pain with coughing/sneezing/straining (<italic>k </italic>= 0.64), increased pain with walking (<italic>k </italic>= 0.56), coldness in the lower extremity (<italic>k </italic>= 0.56), urinary incontinence (<italic>k </italic>= 0.79) and previous back pain episodes (<italic>k </italic>= 0.67).</p>\",\n \"<p>McCombe, et al [##REF##2528822##112##] used 2 surgeons to assess 50 patients and found fair agreement for the FNST (<italic>k </italic>= 0.3–0.5). Philip, et al [##UREF##19##113##] used 6 pairs of physiotherapists to examine 93 patients using the Slump test. They found good to perfect IER (<italic>k </italic>= 0.72 to 1.00). Gabbe, et al [##UREF##20##114##] used a physiotherapist and a research student to assess 15 asymptomatic volunteers using the slump test and found excellent reliability (ICC = 0.92, 95% CI 0.77, 0.97).</p>\",\n \"<title>Validity</title>\",\n \"<p>Vroomen, et al [##REF##11971050##115##] found that SLR was not predictive of the presence of herniated disc on MRI. They did not assess WLR or Bragard's test. They did note that the historical factors of a dermatomal distribution of pain, increase in pain on coughing, sneezing, or straining, paroxysmal pain, and predominant leg pain were predictive. Using MRI as a \\\"Gold Standard\\\" may be questionable because of the potential for false positive findings [##REF##11413431##116##]. Lurie [##REF##15949776##117##] reviewed the literature on diagnostic tests for LBP and found that the SLR has generally been found to have high SE (0.78 to 0.97) but low SP (0.10 to 0.52) in identifying patients with disc herniation. The opposite is found for WLR test, which has been found to have low SE (0.22 to 0.52) and high SP (0.85 to 1.0). He does note, however that \\\"much of the literature is limited by methodological flaws\\\". Many clinicians feel that the combination of the SLR and WLR, along with Bragard's test and other \\\"localizing\\\" and \\\"sensitizing\\\" maneuvers improves the SE and SP of the examination for pain of neural origin [##REF##16038853##109##]. This has not been specifically evaluated.</p>\",\n \"<p>The validity of the FNST has not been well studied [##REF##15949776##117##].</p>\",\n \"<p>Stankovic, et al [##REF##10463018##118##] found those patients with the complaint of LBP and/or leg pain whose imaging revealed a herniated disc were more likely to have distal pain in the lower extremity on the performance of the Slump test, although the difference was not statistically significant (<italic>p </italic>< 0.017). No values with regard to SE, SP and PPV and NPV were calculated.</p>\",\n \"<title>Myofascial Signs</title>\",\n \"<title>Reliability</title>\",\n \"<p>Nice, et al [##REF##1307701##119##] used 12 examiners to assess 50 patients with LBP for trigger points, using the standard criteria of the presence of a \\\"taut band\\\" and localized \\\"nodule\\\", the presence of a \\\"twitch response\\\" and the reproduction of familiar pain. They found IER to be poor (<italic>k </italic>= 0.29 to 0.38). Njoo and Van der Does [##REF##7838580##120##] also found poor IER when considering all of the standard criteria of TrP presence. However, when considering only tenderness to palpation, particularly when combined with the identification of concordant pain on the part of the patient, IER increased greatly (<italic>k </italic>> 0.5). Hsieh, et al [##UREF##21##121##] used 1 \\\"expert\\\" DC with many years of experience with TrP palpation, 2 DC's with 15 years of practice experience but not with extensive experience with TrP palpation, and several chiropractic and psychiatry residents. They provided all clinicians with 3 2-hour lectures and 3 2-hour hands-on sessions as training in TrP palpation, and compared the agreement between the expert and the others for the presence of taut band, local twitch response and referred pain. They found generally poor IER, concluding that even with experienced clinicians, short term training in TrP palpation is not enough to provide IER.</p>\",\n \"<p>It would appear that if the examiner places greatest emphasis on tenderness to palpation and reproduction of concordant pain, and less emphasis on the presence of a taut band and a twitch response, the IER of muscle palpation signs will be enhanced. Also, Simons has pointed out [##UREF##22##122##] that those studies using untrained and/or inexperienced examiners have generally found poor IER, whereas those using trained and experienced examiners have generally found favorable IER in TrP examination, indicating the importance of examiners having appropriate training and experience with muscle palpation signs.</p>\",\n \"<title>Validity</title>\",\n \"<p>As with the cervical spine, the validity of myofascial signs in the lumbar spine is unknown due to the absence of a Gold Standard for the identification of myofascial pain.</p>\",\n \"<title>3. What has gone wrong with this person as a whole that would cause the pain experience to develop and persist?</title>\",\n \"<title>Dynamic instability (impaired motor control)</title>\",\n \"<title>Reliability</title>\",\n \"<p>There are 3 tests that have been proposed to identify the presence of dynamic instability in the lumbar spine, and for which there are data on IER. One is the Segmental Instability test [##REF##14669195##123##], which Hicks, et al [##REF##14669195##123##] found to have excellent (<italic>k </italic>= .87) IER between 3 pairs of examiners in 63 subjects. This study [##REF##14669195##123##] found the Standing Flexion test to have moderate IER (<italic>k </italic>= .69). The Hip Extension test [##REF##16762665##124##], was found by Murphy, et al [##REF##16762665##124##] to have good (<italic>k </italic>= 0.72 to 0.76) IER between 2 examiners in 42 subjects.</p>\",\n \"<title>Reliability – pelvis</title>\",\n \"<p>The Active Straight Leg Raise (ASLR) test [##UREF##23##125##] is designed to assess dynamic stability in the pelvis. IER of the ASLR has not been evaluated, however, Mens, et al [##REF##11413432##126##] test-retest reliability over the space of one week to be high (Pearson's correlation coefficient = 0.87; ICC = 0.83) in a study of pregnant women.</p>\",\n \"<title>Validity – lumbar</title>\",\n \"<p>The only validity study that was found was that of Abbott, et al [##REF##16274487##127##]. This study assessed manual examination using intervertebral motion tests. They compared this with a reference standard using flexion-extension radiographs. They provided SE, SP and PPV data, however, no data were presented with regard to the IER of the manual examination procedures, making interpretation of the validity data difficult.</p>\",\n \"<title>Validity – pelvis</title>\",\n \"<p>Mens, et al [##REF##11413432##126##] compared the ASLR test with the Posterior Pelvic Pain Provocation (PPPP) test, a test with good reliability and validity [##REF##11413432##126##] for the identification of painful SI joints. Using the PPPP test as the Gold Standard, they found the ASLR test to have a SE of 0.87 and a SP of 0.94. In another study, Mens, et al [##REF##11805667##128##] compared the ASLR test to the Quebec Back Pain Disability Scale in 200 pregnant patients with posterior pelvic pain. They found a high correlation between the 2 tests (<italic>r </italic>= 0.70). O'Sullivan et al [##REF##11805650##129##] found evidence of altered activity in the diaphragm and the pelvic floor muscles, both of which are thought to play important roles in motor control of the trunk, in patients with a positive ASLR as compared to those with a normal test. No actual measures of pelvic motor control were performed, however.</p>\",\n \"<title>Central Pain Hypersensitivity (CPH)</title>\",\n \"<title>Reliability</title>\",\n \"<p>There is some evidence for the IER of Waddell's nonorganic signs, although this evidence is inconsistent [##REF##12911018##45##].</p>\",\n \"<title>Validity</title>\",\n \"<p>Fishbain, et al [##REF##12911018##45##] reviewed the literature on the use of Waddell's nonorganic signs and found consistent evidence that they are associated with decreased functional performance, poor treatment outcome and increased pain perception. Whether the relationship between the presence of these signs and increased pain perception means that these signs are an indication of CPH specifically is unknown. However, until further investigation is undertaken, it appears that these signs may be a useful means to identify increased pain perception that may be related to CPH.</p>\",\n \"<title>Fear and Catastrophizing</title>\",\n \"<p>The Fear-Avoidance Beliefs Questionnaire [##REF##8455963##57##], the Tampa Scale for Kinesiophobia [##REF##12586559##58##] and the Fear-Avoidance Pain Scale [##UREF##12##59##] have been demonstrated to be predictive of present LBP as well as future progression of chronicity [##REF##11444718##130##, ####REF##15927382##131##, ##REF##16359797##132##, ##REF##16540870##133##, ##REF##15109970##134####15109970##134##]. Regarding catastrophizing, the Pain Catastrophizing Scale [##REF##16359797##132##,##REF##15109970##134##] has been found to be useful.</p>\",\n \"<p>These measures have been found to predict decreased physical performance and perceived disability in patients with acute LBP [##REF##16359797##132##], current pain intensity and disability in patients with chronic LBP [##REF##11444718##130##], and reduction in disability after treatment [##REF##15109970##134##].</p>\",\n \"<title>Passive Coping</title>\",\n \"<p>The Guarding scale of the Chronic Pain Coping Inventory [##REF##15927382##131##] and the Coping Strategies Questionnaire [##REF##16291293##135##] have been found to be predictive, in part, of chronicity in patients with LBP.</p>\",\n \"<title>Depression</title>\",\n \"<p>The Beck Depression Inventory (BDI) has been used for a number of years in patients with spinal pain, and has been demonstrated to have good utility in identifying significant depressive symptoms in LBP patients [##REF##10382925##136##]. Walsh, et al [##REF##16651227##137##] found that a Mental Component Summary cutoff score of 35 on the SF-36 instrument carried a SE of 0.80 and a SP of 0.90 compared to the Gold Standard of the CES-D. Low scores on the SF-36 Mental Health Index are associated both cross-sectionally and longitudinally with low-back pain and disability [##REF##12812821##138##] suggesting that psychological distress may be both a predictor and consequence of spinal pain. The Depression Anxiety Stress Scales (DASS) have been found to have good internal consistency and reliability, and to compare favorably with the BDI [##REF##7726811##139##], although this study was not performed with spinal pain patients. Haggman, et al [##REF##15563256##140##] used receiver operating characteristic curves to compare the administration of a 2 question screening (\\\"During the past month, have you often been bothered by feeling down, depressed, or hopeless?\\\" and \\\"During the past month, have you often been bothered by little interest or pleasure in doing things?\\\") with the DASS. They found the screening questions accurately predicted DASS scores (Area Under the Curve [AUC] values of 0.77 to 0.81). The PLR reached as high as 5.40 and the NLRs as low as 0.18. Whether this 2-question screening is useful for research purposes is unclear.</p>\",\n \"<p>As was stated in Part 1, there is significant overlap and interaction between fear, catastrophizing, passive coping and depression [##REF##16428950##141##,##REF##8657437##142##]. Thus, from a clinical standpoint, it may be only necessary to measure 1 or 2 of these constructs in spinal pain patients, rather than having to measure all, however research is needed to determine this for certain.</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":[],"string":"[]","isConversational":false},"conclusion":{"kind":"list like","value":[],"string":"[]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>Spinal pain is a common and often disabling problem. The research on various treatments for spinal pain has, for the most part, suggested that while several interventions have demonstrated mild to moderate short-term benefit, no single treatment has a major impact on either pain or disability. There is great need for more accurate diagnosis in patients with spinal pain. In a previous paper, the theoretical model of a diagnosis-based clinical decision rule was presented. The approach is designed to provide the clinician with a strategy for arriving at a specific working diagnosis from which treatment decisions can be made. It is based on three questions of diagnosis. In the current paper, the literature on the reliability and validity of the assessment procedures that are included in the diagnosis-based clinical decision rule is presented.</p>","<title>Methods</title>","<p>The databases of Medline, Cinahl, Embase and MANTIS were searched for studies that evaluated the reliability and validity of clinic-based diagnostic procedures for patients with spinal pain that have relevance for questions 2 (which investigates characteristics of the pain source) and 3 (which investigates perpetuating factors of the pain experience). In addition, the reference list of identified papers and authors' libraries were searched.</p>","<title>Results</title>","<p>A total of 1769 articles were retrieved, of which 138 were deemed relevant. Fifty-one studies related to reliability and 76 related to validity. One study evaluated both reliability and validity.</p>","<title>Conclusion</title>","<p>Regarding some aspects of the DBCDR, there are a number of studies that allow the clinician to have a reasonable degree of confidence in his or her findings. This is particularly true for centralization signs, neurodynamic signs and psychological perpetuating factors. There are other aspects of the DBCDR in which a lesser degree of confidence is warranted, and in which further research is needed.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>Spinal pain is a common and often disabling problem. The research on various treatments for spinal pain has, for the most part, suggested that while several interventions have demonstrated mild to moderate short-term benefit, no single treatment has a major impact on either pain or disability. There is great need for more accurate diagnosis in patients with spinal pain. In a previous paper, the theoretical model of a diagnosis-based clinical decision rule was presented. The approach is designed to provide the clinician with a strategy for arriving at a specific working diagnosis from which treatment decisions can be made. It is based on three questions of diagnosis. In the current paper, the literature on the reliability and validity of the assessment procedures that are included in the diagnosis-based clinical decision rule is presented.</p>\",\n \"<title>Methods</title>\",\n \"<p>The databases of Medline, Cinahl, Embase and MANTIS were searched for studies that evaluated the reliability and validity of clinic-based diagnostic procedures for patients with spinal pain that have relevance for questions 2 (which investigates characteristics of the pain source) and 3 (which investigates perpetuating factors of the pain experience). In addition, the reference list of identified papers and authors' libraries were searched.</p>\",\n \"<title>Results</title>\",\n \"<p>A total of 1769 articles were retrieved, of which 138 were deemed relevant. Fifty-one studies related to reliability and 76 related to validity. One study evaluated both reliability and validity.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>Regarding some aspects of the DBCDR, there are a number of studies that allow the clinician to have a reasonable degree of confidence in his or her findings. This is particularly true for centralization signs, neurodynamic signs and psychological perpetuating factors. There are other aspects of the DBCDR in which a lesser degree of confidence is warranted, and in which further research is needed.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Summary</title>","<p>In a previous paper the authors presented the conceptual model of a novel approach to the diagnosis and treatment of patients with spinal pain. The specific components of the diagnostic model were described and the decision making process based on the diagnostic approach were discussed. In this paper, the evidence as it currently exists for the reliability and validity of the components of the diagnostic model is presented. Future research will be conducted to investigate those questions that remain unanswered with regard to the ability of clinicians to arrive at a specific diagnosis in patients with spinal pain on which they can base a targeted treatment approach.</p>","<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>DRM conceived of the idea of the diagnosis-based clinical decision rule, led the literature search and review process, and was the principle author of the manuscript. ELH was responsible for help with design and presentation of the systematic review, assisted with the conceptualization of the presented research strategy and contributed to the writing of the manuscript. CFN was responsible for performing literature searches and reviews and contributed to the writing of the manuscript. All authors read and approved the final manuscript.</p>","<title>Supplementary Material</title>"],"string":"[\n \"<title>Summary</title>\",\n \"<p>In a previous paper the authors presented the conceptual model of a novel approach to the diagnosis and treatment of patients with spinal pain. The specific components of the diagnostic model were described and the decision making process based on the diagnostic approach were discussed. In this paper, the evidence as it currently exists for the reliability and validity of the components of the diagnostic model is presented. Future research will be conducted to investigate those questions that remain unanswered with regard to the ability of clinicians to arrive at a specific diagnosis in patients with spinal pain on which they can base a targeted treatment approach.</p>\",\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>DRM conceived of the idea of the diagnosis-based clinical decision rule, led the literature search and review process, and was the principle author of the manuscript. ELH was responsible for help with design and presentation of the systematic review, assisted with the conceptualization of the presented research strategy and contributed to the writing of the manuscript. CFN was responsible for performing literature searches and reviews and contributed to the writing of the manuscript. All authors read and approved the final manuscript.</p>\",\n \"<title>Supplementary Material</title>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>The authors would like to thank Tovah Reis of the Brown University library and Mary Ott of the New York Chiropractic College library for help with information gathering.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>The authors would like to thank Tovah Reis of the Brown University library and Mary Ott of the New York Chiropractic College library for help with information gathering.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Diagnostic algorithm for the application of the DBCDR</bold>.</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Management algorithm for the application of the DBCDR.</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p><bold>Diagnostic algorithm for the application of the DBCDR</bold>.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p>Management algorithm for the application of the DBCDR.</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":[],"string":"[]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":["<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Table 1. Number of studies identified that address factors related to question number 2.</p></caption></supplementary-material>","<supplementary-material content-type=\"local-data\" id=\"S2\"><caption><title>Additional file 2</title><p>Table 2. Number of studies identified that address factors related to question number 3.</p></caption></supplementary-material>","<supplementary-material content-type=\"local-data\" id=\"S3\"><caption><title>Additional file 3</title><p>Table 3. Findings from studies related to question 2.</p></caption></supplementary-material>","<supplementary-material content-type=\"local-data\" id=\"S4\"><caption><title>Additional file 4</title><p>Table 4. Findings from studies related to question 3.</p></caption></supplementary-material>"],"string":"[\n \"<supplementary-material content-type=\\\"local-data\\\" id=\\\"S1\\\"><caption><title>Additional file 1</title><p>Table 1. Number of studies identified that address factors related to question number 2.</p></caption></supplementary-material>\",\n \"<supplementary-material content-type=\\\"local-data\\\" id=\\\"S2\\\"><caption><title>Additional file 2</title><p>Table 2. Number of studies identified that address factors related to question number 3.</p></caption></supplementary-material>\",\n \"<supplementary-material content-type=\\\"local-data\\\" id=\\\"S3\\\"><caption><title>Additional file 3</title><p>Table 3. Findings from studies related to question 2.</p></caption></supplementary-material>\",\n \"<supplementary-material content-type=\\\"local-data\\\" id=\\\"S4\\\"><caption><title>Additional file 4</title><p>Table 4. Findings from studies related to question 3.</p></caption></supplementary-material>\"\n]","isConversational":false},"footnote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1746-1340-16-7-1\"/>","<graphic xlink:href=\"1746-1340-16-7-2\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1746-1340-16-7-1\\\"/>\",\n \"<graphic xlink:href=\\\"1746-1340-16-7-2\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":["<media xlink:href=\"1746-1340-16-7-S1.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>","<media xlink:href=\"1746-1340-16-7-S2.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>","<media xlink:href=\"1746-1340-16-7-S3.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>","<media xlink:href=\"1746-1340-16-7-S4.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>"],"string":"[\n \"<media xlink:href=\\\"1746-1340-16-7-S1.doc\\\" mimetype=\\\"application\\\" mime-subtype=\\\"msword\\\"><caption><p>Click here for file</p></caption></media>\",\n \"<media xlink:href=\\\"1746-1340-16-7-S2.doc\\\" mimetype=\\\"application\\\" mime-subtype=\\\"msword\\\"><caption><p>Click here for file</p></caption></media>\",\n \"<media xlink:href=\\\"1746-1340-16-7-S3.doc\\\" mimetype=\\\"application\\\" mime-subtype=\\\"msword\\\"><caption><p>Click here for file</p></caption></media>\",\n \"<media xlink:href=\\\"1746-1340-16-7-S4.doc\\\" mimetype=\\\"application\\\" mime-subtype=\\\"msword\\\"><caption><p>Click here for file</p></caption></media>\"\n]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Bigos\", \"Bowyer\", \"Braen\"], \"given-names\": [\"S\", \"O\", \"G\"], \"suffix\": [\"Brown K, Deyo R, Haldeman S\"], \"article-title\": [\" Acute Low Back Problems in Adults Clinical Practice Guideline Number 14 AHCPR Pub No 95-0642 Rockville, MD Agency for Health Care Policy and Research, Public Health Service, US Department of Health and Human Services\"], \"source\": [\"US Department of Health and Human Service\"], \"year\": [\"1994\"]}, {\"source\": [\"Australian Acute Musculoskeletal Pain Guidelines Group. Evidence-Based Managment of Acute Musculoskeletal Pain\"], \"year\": [\"2003\"], \"publisher-name\": [\"Bowen Hills, QLD \"]}, {\"surname\": [\"Ferri\"], \"given-names\": [\"FF\"], \"source\": [\"Ferri's Differential Diagnosis - A Practical Guide to the Differential Diagnosis of Symptoms, Signs, and Clinical Disorders \"], \"year\": [\"2006\"], \"publisher-name\": [\"St. Louis , Mosby\"]}, {\"surname\": [\"Swenson\"], \"given-names\": [\"RS\"], \"article-title\": [\"A medical approach to the differential diagnosis of low back pain\"], \"source\": [\"J Neuromusculoskel Sys\"], \"year\": [\"1998\"], \"volume\": [\"6\"], \"fpage\": [\"100\"], \"lpage\": [\"113\"]}, {\"surname\": [\"McKenzie\"], \"given-names\": [\"RA\"], \"source\": [\"The Cervical and Thoracic Spine: Mechanical Diagnosis and Therapy\"], \"year\": [\"2006\"], \"publisher-name\": [\"Waikanae, New Zealand , Spinal Publications\"]}, {\"surname\": [\"McKenzie\"], \"given-names\": [\"RA\"], \"suffix\": [\"May S.\"], \"source\": [\"The Lumbar Spine: Mechanical Diagnosis and Therapy\"], \"year\": [\"2003\"], \"edition\": [\"2nd\"], \"publisher-name\": [\"Waikenae, NZ , Spinal Publications\"]}, {\"surname\": [\"Boline\", \"Keating\", \"Brist\", \"Denver\"], \"given-names\": [\"PD\", \"JC\", \"J\", \"G\"], \"article-title\": [\"Interexaminer reliability of papatory evaluations of the lumbar spine\"], \"source\": [\"AJCM\"], \"year\": [\"1988\"], \"volume\": [\"1\"], \"fpage\": [\"5\"], \"lpage\": [\"11\"]}, {\"surname\": [\"Mior\"], \"given-names\": [\"S\"], \"suffix\": [\"King R, McGregor M, Bernard M\"], \"article-title\": [\"Intra and inter-examiner reliability of motion palpation in the cervical spine\"], \"source\": [\"J Can Chiro Assoc\"], \"year\": [\"1985\"], \"volume\": [\"29\"], \"fpage\": [\"195\"], \"lpage\": [\"199\"]}, {\"surname\": [\"McPartland\"], \"given-names\": [\"JM\"], \"suffix\": [\"Goodridge JP\"], \"article-title\": [\"Counterstrain and traditional osteopathic examination of the cervical spine compared\"], \"source\": [\"J Bodywork Movement Ther\"], \"year\": [\"1997\"], \"volume\": [\"1\"], \"fpage\": [\"173\"], \"lpage\": [\"178\"]}, {\"surname\": [\"Jull\"], \"given-names\": [\"GA\"], \"article-title\": [\"Deep cervical flexor muscle dysfunction in whiplash\"], \"source\": [\"J Musculoskel Pain\"], \"year\": [\"2000\"], \"volume\": [\"8\"], \"fpage\": [\"143\"], \"lpage\": [\"154\"]}, {\"surname\": [\"Rosenhall\", \"Tjell\", \"Carlsson\"], \"given-names\": [\"U\", \"C\", \"J\"], \"article-title\": [\"The effect of neck torsion on smooth pursuit eye movements in tension-type headache patients\"], \"source\": [\"J Audiol Med\"], \"year\": [\"1996\"], \"volume\": [\"5\"], \"fpage\": [\"130\"], \"lpage\": [\"140\"]}, {\"surname\": [\"Tjell\"], \"given-names\": [\"C\"], \"suffix\": [\"Tenenbaum A, Sandstrom S\"], \"article-title\": [\"Smooth pursuit neck torsion test-a specific test for whiplash associated disorders?\"], \"source\": [\"J Whiplash Rel Disord\"], \"year\": [\"2002\"], \"volume\": [\"1\"], \"fpage\": [\"9\"], \"lpage\": [\"24\"]}, {\"surname\": [\"Crowley\", \"Kendall\"], \"given-names\": [\"D\", \"NAS\"], \"article-title\": [\"Development and initial validation of a questionnaire for measuring fear-avoidance associated with pain the fear-avoidance of pain scale\"], \"source\": [\"J Musculoskel Pain\"], \"year\": [\"1999\"], \"volume\": [\"7\"], \"fpage\": [\"3\"], \"lpage\": [\"20\"]}, {\"surname\": [\"Radloff\"], \"given-names\": [\"L\"], \"article-title\": [\"The CES-d scale: a self-report depression scale for research in the general population.\"], \"source\": [\"Appl Psychol Measurement\"], \"year\": [\"1977\"], \"volume\": [\"1\"], \"fpage\": [\"385\\u2013392\"]}, {\"surname\": [\"Kilby\", \"Stigant\", \"Roberts\"], \"given-names\": [\"J\", \"M\", \"A\"], \"article-title\": [\" The reliability of back pain assessment by physiotherapists using a \\\"McKenzie algorithm\\\"\"], \"source\": [\"Physiother\"], \"year\": [\"1990\"], \"volume\": [\" 76\"], \"fpage\": [\"579\"], \"lpage\": [\"583\"]}, {\"surname\": [\"Spitzer\", \"Skovron\", \"Salmi\", \"Cassidy\", \"Duranceau\", \"Suissa\", \"Zeiss\"], \"given-names\": [\"WO\", \"ML\", \"LR\", \"JD\", \"J\", \"S\", \"E\"], \"article-title\": [\"Scientific monograph of the Quebec Task Force on Whiplash-Associated Disorders\"], \"source\": [\"Spine\"], \"year\": [\"1995\"], \"volume\": [\"20\"], \"fpage\": [\"2S\"], \"lpage\": [\"73S\"]}, {\"surname\": [\"Lundberg\"], \"given-names\": [\"G\"], \"suffix\": [\"Gerdle,B\"], \"article-title\": [\"The relationships between spinal sagittal configuration, joint mobility, general low back mobility and segmental mobility in female homecare personnel\"], \"source\": [\"Scand J Rehab Med\"], \"year\": [\"1999\"], \"volume\": [\"31\"], \"fpage\": [\"197\"], \"lpage\": [\"206\"]}, {\"surname\": [\"Laslett\"], \"given-names\": [\"M\"], \"suffix\": [\"Oberg B, April CN, McDonald B\"], \"article-title\": [\"Zygapophysial joint blocks in chronic low back pain: a test of Revel's model as a screening test\"], \"source\": [\"BMC Musculoskel Disord\"], \"year\": [\"2004\"], \"volume\": [\"5\"], \"fpage\": [\"43\"]}, {\"surname\": [\"Butler\"], \"given-names\": [\"DS\"], \"source\": [\"The Sensitive Nervous System\"], \"year\": [\"2000\"], \"publisher-name\": [\"Adelaide, Australia , Noigroup Publications\"]}, {\"surname\": [\"Philip\"], \"given-names\": [\"K\"], \"suffix\": [\"Lew P, Matyas TA\"], \"article-title\": [\"Inter-therapist reliability of the slump test\"], \"source\": [\"Aust J Physiother\"], \"year\": [\"1989\"], \"volume\": [\"35\"], \"fpage\": [\"89\"], \"lpage\": [\"94\"]}, {\"surname\": [\"Gabbe\"], \"given-names\": [\"BJ\"], \"suffix\": [\"Bennel KL, Wajswelner H, Finch CF\"], \"article-title\": [\"Reliability of common lower extremity musculoskeletal screening tests\"], \"source\": [\"Phys Ther Sport\"], \"year\": [\"2004\"], \"volume\": [\"5\"], \"fpage\": [\"90\"], \"lpage\": [\"97\"]}, {\"collab\": [\"Hsieh\", \"CY\", \"Hong\", \"CZ\", \"Adams\", \"A\", \"Platt\", \"K\", \"Tobis\", \"J\"], \"surname\": [\"C\", \"F\"], \"given-names\": [\"D\", \"H\"], \"article-title\": [\"Interexaminer reliability of the palpation of trigger points in the trunk and lower limb muscles\"], \"source\": [\"Arch Phys MedRehabil\"], \"year\": [\"2000\"], \"volume\": [\"81\"], \"fpage\": [\"258\"], \"lpage\": [\"264\"]}, {\"surname\": [\"Simons\"], \"given-names\": [\"DG\"], \"source\": [\"Enigmatic trigger points often cause enigmatic\\nmusculoskeletal pain: Columbus, OH.\\n\\t\\t\\t\\t\\t\"], \"year\": [\"2003\"]}, {\"surname\": [\"Mens\", \"Vleeming AMVSCJDTASR\"], \"given-names\": [\"JMA\"], \"suffix\": [\"Vleeming A, Snijders CJ, Stam HJ\"], \"article-title\": [\"Active straight leg raising test: a clinical approach to the load transfer function of the pelvic girdle\"], \"source\": [\"Movement, Stability and Low Back Pain The Essential Role of the Pelvis\"], \"year\": [\"1997\"], \"publisher-name\": [\"New York , Churchill Livingstone\"], \"fpage\": [\"425\"], \"lpage\": [\"431\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":142,"string":"142"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:37"},"citation":{"kind":"string","value":"Chiropr Osteopat. 2008 Aug 11; 16:7"},"package_file":{"kind":"string","value":"oa_package/49/60/PMC2538525.tar.gz"}}},{"rowIdx":119690,"cells":{"accession_id":{"kind":"string","value":"PMC2538526"},"pmid":{"kind":"string","value":"18778467"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>With an ageing population, the prevalence of chronic disease is increasing. Osteoarthritis of the knee is a widespread chronic condition and one of the most common causes of musculoskeletal disability [##REF##11030685##1##]. Complementary to conventional medical care, self-management interventions are considered to be beneficial in the management of people with chronic illness [##REF##11769298##2##,##REF##12173574##3##]. These interventions are designed to assist people to effectively manage their condition (between physicians visits), by teaching them how to cope with their symptoms, including the physical and psychological consequences of living with a chronic disease.</p>","<p>Approaches to self-management vary [##REF##15302634##4##]. The majority of self-management interventions are led by health professionals (HP) in a group setting where all participants are affected by the same condition. Health professionals are a credible source of information for participants and have the knowledge to provide factual disease-specific education and respond to queries where required. When all members of a group have the same condition, all components of the intervention can be tailored to the specific needs of the group.</p>","<p>Notable exceptions to this approach are the Chronic Diseases and Arthritis Self-Management Programs (ASMP) developed at Stanford University [##REF##11769298##2##,##UREF##0##5##]. These programs are also delivered in a group setting but are led by trained lay tutors. They have a more generic approach as they are catering for participants with a variety of different conditions in the one group. This approach is cheaper to deliver but cost-effectiveness is yet to be established [##UREF##1##6##,##REF##15300966##7##]. Participants in the arthritis groups may include people with a variety of different rheumatic diseases.</p>","<p>The Arthritis Self-Management Program has been tested widely with the majority of studies conducted in the USA or UK. Many, but not all of these studies have found the program to be effective. Overall, Warsi et al (2004), in their systematic review of self-management interventions for various chronic diseases, found a trend towards a small benefit from arthritis programs, the majority being ASMP or ASMP derivatives, but the results were not significant and there was suggestion of publication bias [##REF##15302634##4##].</p>","<p>In view of the high prevalence of OA knee in the community, we considered the development of a specific program to be justified. The goals of the program were to reduce pain, improve physical function and increase general well being. The program was designed to be delivered by HP's including physiotherapists, nurses and occupational therapists. It included disease specific education, including precise information on medications and analgesia as well as the importance of exercise and weight management. A social cognitive theory approach incorporating goal setting, problem solving and cognitive techniques was adopted to improve self-efficacy and facilitate long-term change in behaviour. Participants were encouraged to include exercise and effective pain management as well as specific information learned during the sessions in their weekly goal setting. This approach is a means of encouraging participants to incorporate specific education learned from week to week relevant to their disease [##REF##9973156##8##,##UREF##2##9##]. The HP leaders can provide support and specific feedback for any problems that were encountered.</p>","<p>The newly developed OAK program was implemented as a clinical service of the Arthritis Foundation of Western Australia (WA). We report here the progress of participants during the implementation phase and 12 month follow up. The aim was to determine whether participants had experienced improvements in quality of life, pain, stiffness, and physical function, and whether these improvements would be maintained for 12 months.</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>With an ageing population, the prevalence of chronic disease is increasing. Osteoarthritis of the knee is a widespread chronic condition and one of the most common causes of musculoskeletal disability [##REF##11030685##1##]. Complementary to conventional medical care, self-management interventions are considered to be beneficial in the management of people with chronic illness [##REF##11769298##2##,##REF##12173574##3##]. These interventions are designed to assist people to effectively manage their condition (between physicians visits), by teaching them how to cope with their symptoms, including the physical and psychological consequences of living with a chronic disease.</p>\",\n \"<p>Approaches to self-management vary [##REF##15302634##4##]. The majority of self-management interventions are led by health professionals (HP) in a group setting where all participants are affected by the same condition. Health professionals are a credible source of information for participants and have the knowledge to provide factual disease-specific education and respond to queries where required. When all members of a group have the same condition, all components of the intervention can be tailored to the specific needs of the group.</p>\",\n \"<p>Notable exceptions to this approach are the Chronic Diseases and Arthritis Self-Management Programs (ASMP) developed at Stanford University [##REF##11769298##2##,##UREF##0##5##]. These programs are also delivered in a group setting but are led by trained lay tutors. They have a more generic approach as they are catering for participants with a variety of different conditions in the one group. This approach is cheaper to deliver but cost-effectiveness is yet to be established [##UREF##1##6##,##REF##15300966##7##]. Participants in the arthritis groups may include people with a variety of different rheumatic diseases.</p>\",\n \"<p>The Arthritis Self-Management Program has been tested widely with the majority of studies conducted in the USA or UK. Many, but not all of these studies have found the program to be effective. Overall, Warsi et al (2004), in their systematic review of self-management interventions for various chronic diseases, found a trend towards a small benefit from arthritis programs, the majority being ASMP or ASMP derivatives, but the results were not significant and there was suggestion of publication bias [##REF##15302634##4##].</p>\",\n \"<p>In view of the high prevalence of OA knee in the community, we considered the development of a specific program to be justified. The goals of the program were to reduce pain, improve physical function and increase general well being. The program was designed to be delivered by HP's including physiotherapists, nurses and occupational therapists. It included disease specific education, including precise information on medications and analgesia as well as the importance of exercise and weight management. A social cognitive theory approach incorporating goal setting, problem solving and cognitive techniques was adopted to improve self-efficacy and facilitate long-term change in behaviour. Participants were encouraged to include exercise and effective pain management as well as specific information learned during the sessions in their weekly goal setting. This approach is a means of encouraging participants to incorporate specific education learned from week to week relevant to their disease [##REF##9973156##8##,##UREF##2##9##]. The HP leaders can provide support and specific feedback for any problems that were encountered.</p>\",\n \"<p>The newly developed OAK program was implemented as a clinical service of the Arthritis Foundation of Western Australia (WA). We report here the progress of participants during the implementation phase and 12 month follow up. The aim was to determine whether participants had experienced improvements in quality of life, pain, stiffness, and physical function, and whether these improvements would be maintained for 12 months.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<p>This case series quality assurance project was conducted within the clinical services provided at Arthritis Western Australia. Public awareness of the programs offered by Arthritis WA is often generated via General Practitioner referral or suggestion from friends or family. Programs and services are also advertised in community newspapers; quarterly Arthritis WA magazines; and local radio stations, often linked to health or scientific articles.</p>","<p>This quality assurance project was given Institutional approval by the Board of Arthritis WA and the OA Knee Advisory Committee and complies with National Health and Medical Research Council (Australia) criteria for quality assurance programs [##UREF##3##10##].</p>","<title>Participants</title>","<p>People with OA knee enquiring consecutively to Arthritis WA about access to appropriate services were invited to participate in the new disease specific self-management program. Those who were not interested in the OAK program, did not meet the selection criteria, or were not confident they would be able to participate fully were encouraged to utilize other appropriate services of Arthritis WA.</p>","<p>Only those with a diagnosis of OA of the knee were enrolled. It was a requirement that the diagnosis was confirmed by the participant's medical practitioner. Diagnostic criteria were at the discretion of the doctor. Disease severity was not a selection criterion. Unilateral total knee replacement did not preclude enrolment. Other criteria for ineligibility was age greater than 85 years; inability to walk 300 meters; inflammatory joint disease including rheumatoid arthritis; major concurrent illness such as cancer; bilateral knee replacement; knee surgery scheduled within 6 months of commencing the program; or physical impairments that precluded fulfilling the requirements of the program. Those people were referred to other available services.</p>","<p>This project was consistent with the National Health and Medical Research of Australia definition for a quality assurance project [##UREF##4##11##]. The OAK program and the associated clinical assessments were clearly described to all volunteers who had the opportunity to have all questions answered and provided verbal consent to participate.</p>","<title>Intervention</title>","<p>Groups of 8–10 participants attended 6 education sessions (one 2.5-hour session per week). Participants were provided with written material relevant to the information component discussed each week. The program used a holistic approach, including a range of aspects of care such as:</p>","<p>• Pain management strategies</p>","<p>• Exercise advice</p>","<p>• Joint protection</p>","<p>• Medication/analgesia</p>","<p>• Balance and falls prevention</p>","<p>• Coping with negative emotions</p>","<p>• Fatigue</p>","<p>• Self-management skills (goal setting, problem solving, cognitive techniques)</p>","<p>The fidelity of the OAK program was maintained by the use of a facilitator's manual with modules for program delivery each week. The program was delivered by 2 nurses and assessments were performed by 3 physiotherapists who had no contact with the participants other than during the assessment sessions. Participants were assessed by the same physiotherapist whenever possible to ensure consistency. The assessors did not participate in the facilitation of the program. It was a requirement that health professionals who delivered the program meet minimum musculoskeletal knowledge requirements.</p>","<p>Attendance was recorded at each of the 6 intervention sessions and at each assessment time-point.</p>","<title>Response to Intervention</title>","<p>Participants were assessed at baseline, immediately post-intervention at 8 weeks, and at 6 and 12 months after the program. In addition, pain was assessed on a week-to-week basis during the first 8 weeks using a VAS.</p>","<title>Assessments included</title>","<p><italic>Health status </italic>was assessed using both a disease specific and a generic index as follows:</p>","<p>• The disease specific WOMAC Osteoarthritis Index (WOMAC LK3.0) assesses pain, stiffness and physical function in people with OA of the hip or knee [##REF##3068365##12##]. Validity and reliability of the WOMAC pain, physical function and stiffness subscales are well established and the questionnaire is sufficiently sensitive to detect changes in health status in response to intervention [##REF##3068365##12##].</p>","<p>• The generic Medical Outcomes Study Short Form 36 Version 1 questionnaire (SF-36). The SF-36 was designed to provide a profile of scores that would be useful in understanding the health burden in chronic diseases and the effect of treatment on general health status. It includes 8 component sub-scales that correspond to aspects of physical and mental health and well being [##UREF##5##13##]. Adequate reliability for between group comparisons has been demonstrated in numerous studies and an English version of the questionnaire has been developed and validated specifically for use in Australia [##REF##1583936##14##]. For people with OA, an improvement of 5 points on the physical component score of the SF-36 is considered to be clinically significant [##UREF##6##15##].</p>","<p><italic>Pain </italic>was assessed using pain scales included in the WOMAC and SF-36 indices. During the intervention period, pain was monitored on a week-to-week basis (Figure ##FIG##0##1##) using a 100 mm VAS. The left hand anchor was \"No Pain\", and the right hand anchor \"Worst Pain\". The VAS is well established in clinical practice for measuring pain levels post-surgery, following drug therapy and other interventions in arthritis populations [##REF##10451078##16##]. A reduction of 30% or 2 points in VAS is considered to represent a clinically important difference [##REF##11690728##17##,##REF##15608297##18##].</p>","<p><italic>Active range of motion </italic>of knee flexion and extension were measured using a long armed goniometer [##REF##3809242##19##]. The reliability and validity of the goniometer is well established for measurement of active knee flexion and extension [##REF##3809242##19##,##REF##1989012##20##].</p>","<p><italic>Balance </italic>was assessed using a timed single leg balance test. This simple test assesses the length of time, to a maximum of 10 seconds, a person can stand on one leg. It is a good predictor of falls in the elderly [##UREF##7##21##] and is reliable and valid [##UREF##8##22##].</p>","<title>Statistical Analysis</title>","<p>Data were analysed using SPSS v16 for Macintosh. One-way (repeated measures) analysis of variance with <italic>time </italic>(baseline, 8 weeks, 6 months and 12 months) as the independent variable was used to assess changes in the variables of interest. Where the ANOVA was significant pair-wise differences between baseline and 12 months were compared using paired t-tests and mean change and 95% confidence interval for were calculated. The effect size for the pair wise comparison was calculated using Cohen's <italic>d </italic>(the difference between the means: M<sub>1 </sub>- M<sub>2 </sub>divided by the standard deviation). Improvement is represented as a positive difference: small, <italic>d </italic>= 0.2; medium <italic>d </italic>= 0.5; large <italic>d </italic>= 0.8 [##UREF##9##23##] allowing the comparison of outcomes across the intervention. Separate models were constructed for each outcome variable. Normal distribution and homogeneity of the variance were confirmed prior to further analysis. Statistical significance was inferred at a 2-tailed p < 0.05.</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<p>This case series quality assurance project was conducted within the clinical services provided at Arthritis Western Australia. Public awareness of the programs offered by Arthritis WA is often generated via General Practitioner referral or suggestion from friends or family. Programs and services are also advertised in community newspapers; quarterly Arthritis WA magazines; and local radio stations, often linked to health or scientific articles.</p>\",\n \"<p>This quality assurance project was given Institutional approval by the Board of Arthritis WA and the OA Knee Advisory Committee and complies with National Health and Medical Research Council (Australia) criteria for quality assurance programs [##UREF##3##10##].</p>\",\n \"<title>Participants</title>\",\n \"<p>People with OA knee enquiring consecutively to Arthritis WA about access to appropriate services were invited to participate in the new disease specific self-management program. Those who were not interested in the OAK program, did not meet the selection criteria, or were not confident they would be able to participate fully were encouraged to utilize other appropriate services of Arthritis WA.</p>\",\n \"<p>Only those with a diagnosis of OA of the knee were enrolled. It was a requirement that the diagnosis was confirmed by the participant's medical practitioner. Diagnostic criteria were at the discretion of the doctor. Disease severity was not a selection criterion. Unilateral total knee replacement did not preclude enrolment. Other criteria for ineligibility was age greater than 85 years; inability to walk 300 meters; inflammatory joint disease including rheumatoid arthritis; major concurrent illness such as cancer; bilateral knee replacement; knee surgery scheduled within 6 months of commencing the program; or physical impairments that precluded fulfilling the requirements of the program. Those people were referred to other available services.</p>\",\n \"<p>This project was consistent with the National Health and Medical Research of Australia definition for a quality assurance project [##UREF##4##11##]. The OAK program and the associated clinical assessments were clearly described to all volunteers who had the opportunity to have all questions answered and provided verbal consent to participate.</p>\",\n \"<title>Intervention</title>\",\n \"<p>Groups of 8–10 participants attended 6 education sessions (one 2.5-hour session per week). Participants were provided with written material relevant to the information component discussed each week. The program used a holistic approach, including a range of aspects of care such as:</p>\",\n \"<p>• Pain management strategies</p>\",\n \"<p>• Exercise advice</p>\",\n \"<p>• Joint protection</p>\",\n \"<p>• Medication/analgesia</p>\",\n \"<p>• Balance and falls prevention</p>\",\n \"<p>• Coping with negative emotions</p>\",\n \"<p>• Fatigue</p>\",\n \"<p>• Self-management skills (goal setting, problem solving, cognitive techniques)</p>\",\n \"<p>The fidelity of the OAK program was maintained by the use of a facilitator's manual with modules for program delivery each week. The program was delivered by 2 nurses and assessments were performed by 3 physiotherapists who had no contact with the participants other than during the assessment sessions. Participants were assessed by the same physiotherapist whenever possible to ensure consistency. The assessors did not participate in the facilitation of the program. It was a requirement that health professionals who delivered the program meet minimum musculoskeletal knowledge requirements.</p>\",\n \"<p>Attendance was recorded at each of the 6 intervention sessions and at each assessment time-point.</p>\",\n \"<title>Response to Intervention</title>\",\n \"<p>Participants were assessed at baseline, immediately post-intervention at 8 weeks, and at 6 and 12 months after the program. In addition, pain was assessed on a week-to-week basis during the first 8 weeks using a VAS.</p>\",\n \"<title>Assessments included</title>\",\n \"<p><italic>Health status </italic>was assessed using both a disease specific and a generic index as follows:</p>\",\n \"<p>• The disease specific WOMAC Osteoarthritis Index (WOMAC LK3.0) assesses pain, stiffness and physical function in people with OA of the hip or knee [##REF##3068365##12##]. Validity and reliability of the WOMAC pain, physical function and stiffness subscales are well established and the questionnaire is sufficiently sensitive to detect changes in health status in response to intervention [##REF##3068365##12##].</p>\",\n \"<p>• The generic Medical Outcomes Study Short Form 36 Version 1 questionnaire (SF-36). The SF-36 was designed to provide a profile of scores that would be useful in understanding the health burden in chronic diseases and the effect of treatment on general health status. It includes 8 component sub-scales that correspond to aspects of physical and mental health and well being [##UREF##5##13##]. Adequate reliability for between group comparisons has been demonstrated in numerous studies and an English version of the questionnaire has been developed and validated specifically for use in Australia [##REF##1583936##14##]. For people with OA, an improvement of 5 points on the physical component score of the SF-36 is considered to be clinically significant [##UREF##6##15##].</p>\",\n \"<p><italic>Pain </italic>was assessed using pain scales included in the WOMAC and SF-36 indices. During the intervention period, pain was monitored on a week-to-week basis (Figure ##FIG##0##1##) using a 100 mm VAS. The left hand anchor was \\\"No Pain\\\", and the right hand anchor \\\"Worst Pain\\\". The VAS is well established in clinical practice for measuring pain levels post-surgery, following drug therapy and other interventions in arthritis populations [##REF##10451078##16##]. A reduction of 30% or 2 points in VAS is considered to represent a clinically important difference [##REF##11690728##17##,##REF##15608297##18##].</p>\",\n \"<p><italic>Active range of motion </italic>of knee flexion and extension were measured using a long armed goniometer [##REF##3809242##19##]. The reliability and validity of the goniometer is well established for measurement of active knee flexion and extension [##REF##3809242##19##,##REF##1989012##20##].</p>\",\n \"<p><italic>Balance </italic>was assessed using a timed single leg balance test. This simple test assesses the length of time, to a maximum of 10 seconds, a person can stand on one leg. It is a good predictor of falls in the elderly [##UREF##7##21##] and is reliable and valid [##UREF##8##22##].</p>\",\n \"<title>Statistical Analysis</title>\",\n \"<p>Data were analysed using SPSS v16 for Macintosh. One-way (repeated measures) analysis of variance with <italic>time </italic>(baseline, 8 weeks, 6 months and 12 months) as the independent variable was used to assess changes in the variables of interest. Where the ANOVA was significant pair-wise differences between baseline and 12 months were compared using paired t-tests and mean change and 95% confidence interval for were calculated. The effect size for the pair wise comparison was calculated using Cohen's <italic>d </italic>(the difference between the means: M<sub>1 </sub>- M<sub>2 </sub>divided by the standard deviation). Improvement is represented as a positive difference: small, <italic>d </italic>= 0.2; medium <italic>d </italic>= 0.5; large <italic>d </italic>= 0.8 [##UREF##9##23##] allowing the comparison of outcomes across the intervention. Separate models were constructed for each outcome variable. Normal distribution and homogeneity of the variance were confirmed prior to further analysis. Statistical significance was inferred at a 2-tailed p < 0.05.</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<p>141 people expressed interest in the OAK program. Recruitment for the project was discontinued when 8 groups of eligible participants (19 men, 60 women, mean (SD) age 66 (9) had enrolled in the program. Of these, 68 participants completed the program and returned for all the follow-up assessments to 12 months. Those who were absent or likely to be absent for more than 2 of the 6 sessions were deferred to the next group (Table ##TAB##0##1##). All the participants included in the analyses attended at least 4 of the 6 self-management sessions with the average attendance being 5.8 sessions. The reasons cited for withdrawal were overseas relocation and work, family, and time commitments. Close to 90% of participants had other co-existing disease (Table ##TAB##0##1##).</p>","<p>Socio-economic status was estimated according to residential address postcodes using a method developed by the Australian Bureau of Statistics – \"The Index of Relative Socio-Economic Disadvantage\" [##UREF##10##24##]. This index provides a weighted value that includes variables that reflect or measure disadvantage. These variables include: low-income, low educational attainment, high unemployment, and low skilled occupations. A low index value represents disadvantage and a high index value represents advantage in an area. Participants in the OAK program were over represented in the highest group (Table ##TAB##0##1##).</p>","<p>There was a significant improvement (<italic>p </italic>< 0.05) in each of the dimensions of health status (pain, stiffness, physical function and total) measured by the WOMAC questionnaire (Table ##TAB##1##2##). These improvements were evident by the completion of the intervention phase and were maintained until the 12 month follow-up (Table ##TAB##1##2##). There were also significant improvements in all of the 8 quality of life domains measured using the SF-36 (Table ##TAB##2##3##).</p>","<p>During the 6-week intervention, pain levels (VAS) decreased significantly from a mean (SE) 5.61(2.3) to 4.1(2.6) (baseline to week 8).</p>","<p>At baseline knee flexion range of motion was 117 degrees (range 70 to 145 degrees) and extension range of motion was 180 degrees (range 165 to 195 degrees). At the 12 month follow-up flexion range of motion had increased 4 degrees (95% CI 0 to 8 degrees). Mean change in extension range of motion was 2 degrees (95%CI 0 to 3.8 degrees).</p>","<p>At baseline 47% of participants were able to achieve the target time of 10 seconds single leg balance thus creating a ceiling effect, therefore no improvement could be obtained. This proportion was unchanged at the completion of the study. The other participants who were unable to balance for 10 seconds at baseline (and could potentially improve) achieved a mean of 3 seconds for both legs with a mean improvement of 3 seconds (95%CI right leg 2.1 to 4.3 seconds; left leg 1.9 to 4.5 seconds).</p>"],"string":"[\n \"<title>Results</title>\",\n \"<p>141 people expressed interest in the OAK program. Recruitment for the project was discontinued when 8 groups of eligible participants (19 men, 60 women, mean (SD) age 66 (9) had enrolled in the program. Of these, 68 participants completed the program and returned for all the follow-up assessments to 12 months. Those who were absent or likely to be absent for more than 2 of the 6 sessions were deferred to the next group (Table ##TAB##0##1##). All the participants included in the analyses attended at least 4 of the 6 self-management sessions with the average attendance being 5.8 sessions. The reasons cited for withdrawal were overseas relocation and work, family, and time commitments. Close to 90% of participants had other co-existing disease (Table ##TAB##0##1##).</p>\",\n \"<p>Socio-economic status was estimated according to residential address postcodes using a method developed by the Australian Bureau of Statistics – \\\"The Index of Relative Socio-Economic Disadvantage\\\" [##UREF##10##24##]. This index provides a weighted value that includes variables that reflect or measure disadvantage. These variables include: low-income, low educational attainment, high unemployment, and low skilled occupations. A low index value represents disadvantage and a high index value represents advantage in an area. Participants in the OAK program were over represented in the highest group (Table ##TAB##0##1##).</p>\",\n \"<p>There was a significant improvement (<italic>p </italic>< 0.05) in each of the dimensions of health status (pain, stiffness, physical function and total) measured by the WOMAC questionnaire (Table ##TAB##1##2##). These improvements were evident by the completion of the intervention phase and were maintained until the 12 month follow-up (Table ##TAB##1##2##). There were also significant improvements in all of the 8 quality of life domains measured using the SF-36 (Table ##TAB##2##3##).</p>\",\n \"<p>During the 6-week intervention, pain levels (VAS) decreased significantly from a mean (SE) 5.61(2.3) to 4.1(2.6) (baseline to week 8).</p>\",\n \"<p>At baseline knee flexion range of motion was 117 degrees (range 70 to 145 degrees) and extension range of motion was 180 degrees (range 165 to 195 degrees). At the 12 month follow-up flexion range of motion had increased 4 degrees (95% CI 0 to 8 degrees). Mean change in extension range of motion was 2 degrees (95%CI 0 to 3.8 degrees).</p>\",\n \"<p>At baseline 47% of participants were able to achieve the target time of 10 seconds single leg balance thus creating a ceiling effect, therefore no improvement could be obtained. This proportion was unchanged at the completion of the study. The other participants who were unable to balance for 10 seconds at baseline (and could potentially improve) achieved a mean of 3 seconds for both legs with a mean improvement of 3 seconds (95%CI right leg 2.1 to 4.3 seconds; left leg 1.9 to 4.5 seconds).</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>This SM program differs from others as the intervention is specific not only to their pathology (OA), but also to the joint affected (knee). Health professionals use their expertise to deliver information and education covering a wide spectrum of topics, while utilising the constructs of SM to enable participants to take control of their OA and to improve their self-efficacy.</p>","<p>The outcomes of this clinical intervention were a decrease in pain, improvement in quality of life, and an improvement in OA specific health status. These findings have a number of important implications for the management of patients with OA.</p>","<p>Patients with OA of the knee have identified pain and problems with daily activities as the most important problems associated with their condition [##REF##14635301##25##]; hence the results of this study are well matched to their priorities. Moreover, the aim of this multidisciplinary SM program, to empower people to manage their condition [##REF##11030685##1##], is consistent with the preference of patients to actively manage their own condition [##REF##14635301##25##], and this approach is likely to have benefits in terms of both disease and financial outcomes.</p>","<p>Although SM in chronic illness has been studied extensively, most arthritis programs have been designed to be delivered by lay facilitators and are generic in their focus. This study targeted a specific site – the knee, and a single pathology (OA), while using health professionals to provide disease education, exercise advice in keeping with principles of joint protection, healthy life style options, and relevant information within the self-management construct to achieve these positive short and medium term results. As arthritis SM programs designed to be delivered by health professional leaders have rarely been conducted or evaluated, the results of this case series project are likely to be important in the future planning of SM programs.</p>","<p>We suggest that the improvements demonstrated in this study may be a result of a number of different factors. HP's provided modelling potential [##UREF##11##26##] with the orientation towards skills and expertise as well as support rather than a support and empathy orientated framework offered by lay leaders.</p>","<p>The delivery of specific information, education and direction in an easily digestible format allowed participants to understand the rational behind the theory included in the program [##UREF##1##6##]. Understanding the reason for the adoption of concepts in the program allowed participants to be self-motivated to change behaviour and therefore be more compliant long term [##REF##10606196##27##]. An example of this is exercise. As participants increased their exercise level over the 8-week intervention period, most had a reduction of pain, improved wellbeing and feelings of accomplishment that motivated them to continue. What was previously negative reinforcement (pain) changed to become positive reinforcement (less pain and improved well being) [##REF##17893380##28##].</p>","<p>Education in the correct use of medication and analgesia is linked to the point above. Fear of pain is often a greater limiter than pain itself – hence the fear of developing pain will inhibit people from attempting certain activities. Most people attending this QA program did not take analgesia to adequately control their pain. When participants felt confident that they could control their pain, they became more confident that aspect of their OA was manageable (and would exercise more, for example) [##REF##15302634##4##]. Cognitive pain management was also part of the program syllabus and complemented pharmacological pain management.</p>","<p>Developing problem solving skills was encouraged. HP's skilled in musculoskeletal conditions offered advice or alternatives when hurdles were encountered so that participants achieved solutions rather than giving up, thereby improving SMART goal success and consequently improving self-efficacy [##UREF##11##26##]. Subsequent problems encountered were more likely to be problem solved rather than met with a defeatist attitude [##UREF##1##6##].</p>","<p>Using a self-management format to embrace HP skills, expertise and knowledge to deliver education in a format that participants could relate to in everyday life was hoped to improve self-efficacy in areas across the OA spectrum. It was thought that this would promote healthy life style and behaviour changes that would improve pain, physical function and quality of life.</p>","<title>Pain</title>","<p>In this study pain was measured in a number of ways, all demonstrating an improvement. A number of aspects of the self-management intervention may have contributed to the reduced pain levels reported by participants. Both aerobic and resistance exercise in a home-based exercise program have been shown to significantly reduce knee pain in-patients with OA [##REF##12098707##29##,##REF##15146420##30##]. An important component of the OAK intervention is discussion on the formulation of a comprehensive home exercise program that incorporates strengthening, endurance, balance and flexibility components. Participants were not taken into a gym or given individual personal training; however they were encouraged to pursue that option independently.</p>","<p>The exercise component was not controlled and participants freely chose the type of exercise/s and the degree to which they would comply. By providing a number of exercise alternatives, it was hoped that exercise routines would become habitual by the end of the 6-week program. In accordance with self-management principles, participants were motivated to use their \"library\" of exercise choices when planning their weekly goals. The use of goal setting with participants promoted good adherence to the exercise program, as reported each week, but data regarding adherence were not collected for this study.</p>","<p>As well as exercise instruction and cognitive therapies, medication usage and therapeutic dosing principles in particular for analgesia were taught to encourage medication compliance and effective pain management. The average age of participants was 66 years and most had several co-morbidities requiring medication (Table ##TAB##0##1##). Many participants had an aversion to medications and delayed taking analgesia until their pain was acute and therefore more difficult to control. Pain management guidelines were discussed with the aim of determining patterns of pain. For example short term \"around the clock\" analgesia dosing for acute pain, or \"as needed\" analgesia for intermittent pain.</p>","<p>It is likely that the OAK intervention has facilitated better pain-coping skills that are important predictors of disability associated with OA. Previous studies have reported that catastrophizing and negative self-statements are associated with increased knee pain [##REF##11255208##31##]. In the OAK intervention, participants were taught strategies for cognitive symptom management such as distraction, guided imagery, relaxation and thought challenging techniques that are considered to be important additional measures of pain management in people with OA [##REF##15146420##30##,##REF##17572915##32##].</p>","<title>Health Status</title>","<p>Participants reported considerable improvements in physical function. Like pain, functional improvements were reflected by changes in a number of the parameters measured. It is generally accepted that the WOMAC questionnaire has greater specificity and consequently better responsiveness for people with OA [##REF##10513507##33##], nonetheless, the SF-36 also reflected these changes.</p>","<p>Interpreting these results requires some understanding of the value patients place on improvements of this magnitude. Establishing this can be difficult. A number of methods, each with strengths and limitations, have been used but findings are not entirely consistent. Improvements of 9% to 10% in WOMAC scores in response to rofecoxib or ibuprofen were perceptible to patients with OA knee [##REF##15694571##34##] when anchored against a patient global assessment of response to therapy. Changes observed in our study were generally more than twice this magnitude. On the other hand the 21.6% improvement in WOMAC function was somewhat less than 26%, the minimal level suggested by Tubach et al [##UREF##12##35##] as clinically important.</p>","<p>Expressed as effect sizes in standard deviation units the improvements in the WOMAC pain and SF-36 bodily pain domains would be considered moderate [##UREF##9##23##]. The consistency of this effect between different outcome tools supports the validity of the change. Effect sizes for the WOMAC functional domain and for the SF-36 mental health domains were slightly lower at 0.4. Notably these effect sizes are larger or comparable to the pooled effect sizes for general pain from systematic reviews of NSAID therapy [##REF##14760807##36##] and aerobic walking [##UREF##13##37##] (0.33 and 0.52 respectively), although larger effects are often observed in uncontrolled studies. Further context for interpretation of the improvements we observed in quality of life measured by the SF-36 may be provided by considering the average decline of 2.1 points over 12 months reported in people with OA in this age group [##UREF##6##15##].</p>","<title>Limitations</title>","<p>The subjects who attended this quality assurance program were typical of those who attend self-management programs run by Arthritis WA. Over representation in the highest socio-economic group (Table ##TAB##0##1##) may affect the reproducibility of this program, however, the demographics of the area this program was conducted in are consistent with this attendance statistic. These results should be interpreted with caution as this limits the generalization to other socio-economic groups. Testing the OAK program with other socio-economic groups was outside the limitations of this QA program.</p>","<p>It is important to note that no control period or control group were available for comparison. Consequently, the clinical improvements observed in this cohort should be interpreted with caution. Despite this, improvements in response to this disease specific self-management program delivered by health professionals are encouraging and have interest. We therefore propose to further evaluate the benefits of this program using a more rigorous study design.</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>This SM program differs from others as the intervention is specific not only to their pathology (OA), but also to the joint affected (knee). Health professionals use their expertise to deliver information and education covering a wide spectrum of topics, while utilising the constructs of SM to enable participants to take control of their OA and to improve their self-efficacy.</p>\",\n \"<p>The outcomes of this clinical intervention were a decrease in pain, improvement in quality of life, and an improvement in OA specific health status. These findings have a number of important implications for the management of patients with OA.</p>\",\n \"<p>Patients with OA of the knee have identified pain and problems with daily activities as the most important problems associated with their condition [##REF##14635301##25##]; hence the results of this study are well matched to their priorities. Moreover, the aim of this multidisciplinary SM program, to empower people to manage their condition [##REF##11030685##1##], is consistent with the preference of patients to actively manage their own condition [##REF##14635301##25##], and this approach is likely to have benefits in terms of both disease and financial outcomes.</p>\",\n \"<p>Although SM in chronic illness has been studied extensively, most arthritis programs have been designed to be delivered by lay facilitators and are generic in their focus. This study targeted a specific site – the knee, and a single pathology (OA), while using health professionals to provide disease education, exercise advice in keeping with principles of joint protection, healthy life style options, and relevant information within the self-management construct to achieve these positive short and medium term results. As arthritis SM programs designed to be delivered by health professional leaders have rarely been conducted or evaluated, the results of this case series project are likely to be important in the future planning of SM programs.</p>\",\n \"<p>We suggest that the improvements demonstrated in this study may be a result of a number of different factors. HP's provided modelling potential [##UREF##11##26##] with the orientation towards skills and expertise as well as support rather than a support and empathy orientated framework offered by lay leaders.</p>\",\n \"<p>The delivery of specific information, education and direction in an easily digestible format allowed participants to understand the rational behind the theory included in the program [##UREF##1##6##]. Understanding the reason for the adoption of concepts in the program allowed participants to be self-motivated to change behaviour and therefore be more compliant long term [##REF##10606196##27##]. An example of this is exercise. As participants increased their exercise level over the 8-week intervention period, most had a reduction of pain, improved wellbeing and feelings of accomplishment that motivated them to continue. What was previously negative reinforcement (pain) changed to become positive reinforcement (less pain and improved well being) [##REF##17893380##28##].</p>\",\n \"<p>Education in the correct use of medication and analgesia is linked to the point above. Fear of pain is often a greater limiter than pain itself – hence the fear of developing pain will inhibit people from attempting certain activities. Most people attending this QA program did not take analgesia to adequately control their pain. When participants felt confident that they could control their pain, they became more confident that aspect of their OA was manageable (and would exercise more, for example) [##REF##15302634##4##]. Cognitive pain management was also part of the program syllabus and complemented pharmacological pain management.</p>\",\n \"<p>Developing problem solving skills was encouraged. HP's skilled in musculoskeletal conditions offered advice or alternatives when hurdles were encountered so that participants achieved solutions rather than giving up, thereby improving SMART goal success and consequently improving self-efficacy [##UREF##11##26##]. Subsequent problems encountered were more likely to be problem solved rather than met with a defeatist attitude [##UREF##1##6##].</p>\",\n \"<p>Using a self-management format to embrace HP skills, expertise and knowledge to deliver education in a format that participants could relate to in everyday life was hoped to improve self-efficacy in areas across the OA spectrum. It was thought that this would promote healthy life style and behaviour changes that would improve pain, physical function and quality of life.</p>\",\n \"<title>Pain</title>\",\n \"<p>In this study pain was measured in a number of ways, all demonstrating an improvement. A number of aspects of the self-management intervention may have contributed to the reduced pain levels reported by participants. Both aerobic and resistance exercise in a home-based exercise program have been shown to significantly reduce knee pain in-patients with OA [##REF##12098707##29##,##REF##15146420##30##]. An important component of the OAK intervention is discussion on the formulation of a comprehensive home exercise program that incorporates strengthening, endurance, balance and flexibility components. Participants were not taken into a gym or given individual personal training; however they were encouraged to pursue that option independently.</p>\",\n \"<p>The exercise component was not controlled and participants freely chose the type of exercise/s and the degree to which they would comply. By providing a number of exercise alternatives, it was hoped that exercise routines would become habitual by the end of the 6-week program. In accordance with self-management principles, participants were motivated to use their \\\"library\\\" of exercise choices when planning their weekly goals. The use of goal setting with participants promoted good adherence to the exercise program, as reported each week, but data regarding adherence were not collected for this study.</p>\",\n \"<p>As well as exercise instruction and cognitive therapies, medication usage and therapeutic dosing principles in particular for analgesia were taught to encourage medication compliance and effective pain management. The average age of participants was 66 years and most had several co-morbidities requiring medication (Table ##TAB##0##1##). Many participants had an aversion to medications and delayed taking analgesia until their pain was acute and therefore more difficult to control. Pain management guidelines were discussed with the aim of determining patterns of pain. For example short term \\\"around the clock\\\" analgesia dosing for acute pain, or \\\"as needed\\\" analgesia for intermittent pain.</p>\",\n \"<p>It is likely that the OAK intervention has facilitated better pain-coping skills that are important predictors of disability associated with OA. Previous studies have reported that catastrophizing and negative self-statements are associated with increased knee pain [##REF##11255208##31##]. In the OAK intervention, participants were taught strategies for cognitive symptom management such as distraction, guided imagery, relaxation and thought challenging techniques that are considered to be important additional measures of pain management in people with OA [##REF##15146420##30##,##REF##17572915##32##].</p>\",\n \"<title>Health Status</title>\",\n \"<p>Participants reported considerable improvements in physical function. Like pain, functional improvements were reflected by changes in a number of the parameters measured. It is generally accepted that the WOMAC questionnaire has greater specificity and consequently better responsiveness for people with OA [##REF##10513507##33##], nonetheless, the SF-36 also reflected these changes.</p>\",\n \"<p>Interpreting these results requires some understanding of the value patients place on improvements of this magnitude. Establishing this can be difficult. A number of methods, each with strengths and limitations, have been used but findings are not entirely consistent. Improvements of 9% to 10% in WOMAC scores in response to rofecoxib or ibuprofen were perceptible to patients with OA knee [##REF##15694571##34##] when anchored against a patient global assessment of response to therapy. Changes observed in our study were generally more than twice this magnitude. On the other hand the 21.6% improvement in WOMAC function was somewhat less than 26%, the minimal level suggested by Tubach et al [##UREF##12##35##] as clinically important.</p>\",\n \"<p>Expressed as effect sizes in standard deviation units the improvements in the WOMAC pain and SF-36 bodily pain domains would be considered moderate [##UREF##9##23##]. The consistency of this effect between different outcome tools supports the validity of the change. Effect sizes for the WOMAC functional domain and for the SF-36 mental health domains were slightly lower at 0.4. Notably these effect sizes are larger or comparable to the pooled effect sizes for general pain from systematic reviews of NSAID therapy [##REF##14760807##36##] and aerobic walking [##UREF##13##37##] (0.33 and 0.52 respectively), although larger effects are often observed in uncontrolled studies. Further context for interpretation of the improvements we observed in quality of life measured by the SF-36 may be provided by considering the average decline of 2.1 points over 12 months reported in people with OA in this age group [##UREF##6##15##].</p>\",\n \"<title>Limitations</title>\",\n \"<p>The subjects who attended this quality assurance program were typical of those who attend self-management programs run by Arthritis WA. Over representation in the highest socio-economic group (Table ##TAB##0##1##) may affect the reproducibility of this program, however, the demographics of the area this program was conducted in are consistent with this attendance statistic. These results should be interpreted with caution as this limits the generalization to other socio-economic groups. Testing the OAK program with other socio-economic groups was outside the limitations of this QA program.</p>\",\n \"<p>It is important to note that no control period or control group were available for comparison. Consequently, the clinical improvements observed in this cohort should be interpreted with caution. Despite this, improvements in response to this disease specific self-management program delivered by health professionals are encouraging and have interest. We therefore propose to further evaluate the benefits of this program using a more rigorous study design.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>Improvements in pain, health status and physical function were observed in response to our SM education program specifically designed for people with OA knee, delivered by health professionals. Health professionals providing the program enabled inclusion of disease specific content, not found in other arthritis SM programs, to be incorporated in the OAK program. The long-term gains demonstrated in OAK are not reflected in other arthritis SM programs. Furthermore rigorous investigation of the benefits of this approach to treatment is warranted.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>Improvements in pain, health status and physical function were observed in response to our SM education program specifically designed for people with OA knee, delivered by health professionals. Health professionals providing the program enabled inclusion of disease specific content, not found in other arthritis SM programs, to be incorporated in the OAK program. The long-term gains demonstrated in OAK are not reflected in other arthritis SM programs. Furthermore rigorous investigation of the benefits of this approach to treatment is warranted.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>Self-management (SM) programs are effective for some chronic conditions, however the evidence for arthritis SM is inconclusive. The aim of this case series project was to determine whether a newly developed specific self-management program for people with osteoarthritis of the knee (OAK), implemented by health professionals could achieve and maintain clinically meaningful improvements.</p>","<title>Methods</title>","<p><italic>Participants: </italic>79 participants enrolled; mean age 66, with established osteoarthritis of the knee. People with coexisting inflammatory joint disease or serious co-morbidities were excluded.</p>","<p><italic>Intervention: </italic>6-week disease (OA) and site (knee) specific self-management education program that included disease education, exercise advice, information on healthy lifestyle and relevant information within the constructs of self-management. This program was conducted in a community health care setting and was delivered by health professionals thereby utilising their knowledge and expertise.</p>","<p><italic>Measurements: </italic>Pain, physical function and mental health scales were assessed at baseline, 8 weeks, 6 and 12 months using WOMAC and SF-36 questionnaires. Changes in pain during the 8-week intervention phase were monitored with VAS.</p>","<title>Results</title>","<p>Pain improved during the intervention phase: mean (95% CI) change 15 (8 to 22) mm. Improvements (0.3 to 0.5 standard deviation units) in indices of pain, mental health and physical functioning, assessed by SF-36 and WOMAC questionnaires were demonstrated from baseline to 12 months.</p>","<title>Conclusion</title>","<p>This disease and site-specific self-management education program improved health status of people with osteoarthritis of the knee in the short and medium term.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>Self-management (SM) programs are effective for some chronic conditions, however the evidence for arthritis SM is inconclusive. The aim of this case series project was to determine whether a newly developed specific self-management program for people with osteoarthritis of the knee (OAK), implemented by health professionals could achieve and maintain clinically meaningful improvements.</p>\",\n \"<title>Methods</title>\",\n \"<p><italic>Participants: </italic>79 participants enrolled; mean age 66, with established osteoarthritis of the knee. People with coexisting inflammatory joint disease or serious co-morbidities were excluded.</p>\",\n \"<p><italic>Intervention: </italic>6-week disease (OA) and site (knee) specific self-management education program that included disease education, exercise advice, information on healthy lifestyle and relevant information within the constructs of self-management. This program was conducted in a community health care setting and was delivered by health professionals thereby utilising their knowledge and expertise.</p>\",\n \"<p><italic>Measurements: </italic>Pain, physical function and mental health scales were assessed at baseline, 8 weeks, 6 and 12 months using WOMAC and SF-36 questionnaires. Changes in pain during the 8-week intervention phase were monitored with VAS.</p>\",\n \"<title>Results</title>\",\n \"<p>Pain improved during the intervention phase: mean (95% CI) change 15 (8 to 22) mm. Improvements (0.3 to 0.5 standard deviation units) in indices of pain, mental health and physical functioning, assessed by SF-36 and WOMAC questionnaires were demonstrated from baseline to 12 months.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>This disease and site-specific self-management education program improved health status of people with osteoarthritis of the knee in the short and medium term.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Abbreviations</title>","<p>SM: self-management; OAK: osteoarthritis of the knee; OA: osteoarthritis; HP: health professional; QA: quality assurance; WOMAC: Western Ontario and McMaster Universities Osteoarthritis Index; VAS: visual analogue scale; CI: confidence interval; ASMP: Arthritis Self-Management Program; SF-36: Medical Outcomes Short Form 36 Questionnaire; SMART: <bold>s</bold>pecific, measurable, achievable, realistic, timely; NSAID: non-steroidal antiinflammatory drug</p>","<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>SC, RP, GC, JM contributed to study design. SC and HC were responsible for the acquisition of data and SC the data-entry. All authors contributed to analysis and interpretation of the data. KB and SC contributed to manuscript preparation. All authors have approved the final version of the manuscript.</p>","<title>Pre-publication history</title>","<p>The pre-publication history for this paper can be accessed here:</p>","<p><ext-link ext-link-type=\"uri\" xlink:href=\"http://www.biomedcentral.com/1471-2474/9/117/prepub\"/></p>"],"string":"[\n \"<title>Abbreviations</title>\",\n \"<p>SM: self-management; OAK: osteoarthritis of the knee; OA: osteoarthritis; HP: health professional; QA: quality assurance; WOMAC: Western Ontario and McMaster Universities Osteoarthritis Index; VAS: visual analogue scale; CI: confidence interval; ASMP: Arthritis Self-Management Program; SF-36: Medical Outcomes Short Form 36 Questionnaire; SMART: <bold>s</bold>pecific, measurable, achievable, realistic, timely; NSAID: non-steroidal antiinflammatory drug</p>\",\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>SC, RP, GC, JM contributed to study design. SC and HC were responsible for the acquisition of data and SC the data-entry. All authors contributed to analysis and interpretation of the data. KB and SC contributed to manuscript preparation. All authors have approved the final version of the manuscript.</p>\",\n \"<title>Pre-publication history</title>\",\n \"<p>The pre-publication history for this paper can be accessed here:</p>\",\n \"<p><ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www.biomedcentral.com/1471-2474/9/117/prepub\\\"/></p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>Arthritis Foundation of WA and the Department of Health Western Australia for funding for the OAK program.</p>","<p>Jessica Rose for assistance with editing.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>Arthritis Foundation of WA and the Department of Health Western Australia for funding for the OAK program.</p>\",\n \"<p>Jessica Rose for assistance with editing.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Flow chart time-points with number of participants attending</bold>. Baseline to week 8 (intervention), 6 months and 12 months (follow-up assessments)</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p><bold>Flow chart time-points with number of participants attending</bold>. Baseline to week 8 (intervention), 6 months and 12 months (follow-up assessments)</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Characteristics of participants enrolled in OAK program</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Gender (F:M)</bold></td><td align=\"center\"><bold>60:19</bold></td></tr><tr><td align=\"left\"><bold>Age: mean (SD) years</bold></td><td align=\"center\"><bold>66 (9)</bold></td></tr></thead><tbody><tr><td align=\"left\"><bold>Socio-Economic Index by Post Code </bold>[##UREF##10##24##]</td><td align=\"center\"><bold>Number (%)</bold></td></tr><tr><td colspan=\"2\"><hr/></td></tr><tr><td align=\"left\">Index measured in quintile ranges</td><td/></tr><tr><td align=\"left\">Top 25%</td><td align=\"center\">59 (74.6)</td></tr><tr><td align=\"left\">50–75%</td><td align=\"center\">7 (8.8)</td></tr><tr><td align=\"left\">25–50%</td><td align=\"center\">7 (8.8)</td></tr><tr><td align=\"left\">10–25%</td><td align=\"center\">3 (3.8)</td></tr><tr><td align=\"left\">Bottom 10%</td><td align=\"center\">3 (3.8)</td></tr><tr><td colspan=\"2\"><hr/></td></tr><tr><td align=\"left\"><bold>Coexisting disease</bold></td><td align=\"center\"><bold>n (%)*</bold></td></tr><tr><td colspan=\"2\"><hr/></td></tr><tr><td align=\"left\">Cardiovascular, n (%)</td><td align=\"center\">48 (45)</td></tr><tr><td align=\"left\">Mental Health, n (%)</td><td align=\"center\">9 (11)</td></tr><tr><td align=\"left\">Gastrointestinal, n (%)</td><td align=\"center\">27 (30)</td></tr><tr><td align=\"left\">Endocrine, n (%)</td><td align=\"center\">15 (18)</td></tr><tr><td align=\"left\">Musculoskeletal, n (%)</td><td align=\"center\">16 (20)</td></tr><tr><td align=\"left\">Osteoporosis, n (%)</td><td align=\"center\">14 (18)</td></tr><tr><td align=\"left\">Multiple co-morbidities, n (%)</td><td align=\"center\">51 (64.5)</td></tr><tr><td align=\"left\">Other, n (%)</td><td align=\"center\">31 (61)</td></tr><tr><td align=\"left\">No co-morbidities, n (%)</td><td align=\"center\">12 (15)</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T2\"><label>Table 2</label><caption><p>WOMAC scores at baseline, 8 weeks, 6 months and 12 months</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"left\">BL<break/></td><td align=\"left\">8 wks<break/></td><td align=\"left\">6 mths<break/></td><td align=\"left\">12 mths<break/></td><td align=\"left\">F (df)<break/></td><td align=\"left\"><italic>p</italic>-value<break/></td><td align=\"left\">Change at 12 mths <break/>Mean (95% CI)</td><td align=\"center\">Effect size (d)<break/></td></tr></thead><tbody><tr><td align=\"left\"><bold>WOMAC</bold></td><td/><td/><td/><td/><td/><td/><td/><td/></tr><tr><td align=\"left\">Pain (0 to 20)</td><td align=\"left\">7.91 (0.46)</td><td align=\"left\">6.57 (0.36)</td><td align=\"left\">6.30 (0.39)</td><td align=\"left\">5.95 (0.46)</td><td align=\"left\">11.01<sub>(3,201)</sub></td><td align=\"left\">< 0.001</td><td align=\"left\">1.95 (1.1 to 2.7)</td><td align=\"center\">0.5</td></tr><tr><td align=\"left\">Stiffness (0 to 8)</td><td align=\"left\">3.88 (0.21)</td><td align=\"left\">3.16 (0.19)</td><td align=\"left\">3.19 (0.17)</td><td align=\"left\">3.13 (0.19)</td><td align=\"left\">6.19<sub>(3,201)</sub></td><td align=\"left\">< 0.001</td><td align=\"left\">0.75 (0.3 to 1.1)</td><td align=\"center\">0.4</td></tr><tr><td align=\"left\">Function (0 to 68)</td><td align=\"left\">24.98 (1.41)</td><td align=\"left\">20.66 (1.28)</td><td align=\"left\">19.86 (1.37)</td><td align=\"left\">19.63 (1.44)</td><td align=\"left\">10.02<sub>(3,201)</sub></td><td align=\"left\">< 0.001</td><td align=\"left\">5.35 (2.8 to 7.8)</td><td align=\"center\">0.4</td></tr><tr><td align=\"left\">Total (0 to 96)</td><td align=\"left\">36.77 (1.94)</td><td align=\"left\">30.29 (1.66)</td><td align=\"left\">29.39 (1.84)</td><td align=\"left\">28.72 (2.00)</td><td align=\"left\">12.25<sub>(3,201)</sub></td><td align=\"left\">< 0.001</td><td align=\"left\">8.06 (4.6 to 11.4)</td><td align=\"center\">0.5</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T3\"><label>Table 3</label><caption><p>SF-36 scores at baseline, 8 weeks, 6 months and 12 months</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>SF-36 </bold>(0 to 100)</td><td align=\"left\"><bold>BL</bold></td><td align=\"left\"><bold>8 wks</bold></td><td align=\"left\"><bold>6 mths</bold></td><td align=\"left\"><bold>12 mths</bold></td><td align=\"left\"><bold>F (df)</bold></td><td align=\"left\"><bold><italic>p</italic>-value</bold></td><td align=\"left\"><bold>Change at 12 mths Mean (95% CI)</bold></td><td align=\"center\"><bold>Effect size (d)</bold></td></tr></thead><tbody><tr><td align=\"left\">Physical Function</td><td align=\"left\">47.36 (2.49)</td><td align=\"left\">52.00 (2.62)</td><td align=\"left\">56.13 (2.62)</td><td align=\"left\">55.66 (3.13)</td><td align=\"left\">5.47<sub>(3,201)</sub></td><td align=\"left\">< 0.001</td><td align=\"left\">7.73 (2.70 to 12.70)</td><td align=\"center\">0.3</td></tr><tr><td align=\"left\">Role Physical</td><td align=\"left\">29.77 (4.54)</td><td align=\"left\">41.54 (4.87)</td><td align=\"left\">43.01 (4.99)</td><td align=\"left\">46.69 (5.23)</td><td align=\"left\">4.48<sub>(3,201)</sub></td><td align=\"left\">0.004</td><td align=\"left\">16.91 (7.20 to 26.50)</td><td align=\"center\">0.4</td></tr><tr><td align=\"left\">Bodily Pain</td><td align=\"left\">35.50 (1.85)</td><td align=\"left\">40.39 (2.06)</td><td align=\"left\">41.52 (2.52)</td><td align=\"left\">43.64 (2.49)</td><td align=\"left\">3.49<sub>(3,201)</sub></td><td align=\"left\">0.017</td><td align=\"left\">8.14 (3.03 to 13.20)</td><td align=\"center\">0.5</td></tr><tr><td align=\"left\">General Health</td><td align=\"left\">63.72 (2.58)</td><td align=\"left\">67.05 (2.25)</td><td align=\"left\">69.13 (2.57)</td><td align=\"left\">69.79 (2.50)</td><td align=\"left\">3.42<sub>(3,201)</sub></td><td align=\"left\">0.018</td><td align=\"left\">6.07 (1.50 to 10.50)</td><td align=\"center\">0.3</td></tr><tr><td align=\"left\">Vitality</td><td align=\"left\">50.41 (2.73)</td><td align=\"left\">56.38 (2.10)</td><td align=\"left\">57.30 (2.41)</td><td align=\"left\">60.73 (2.58)</td><td align=\"left\">7.64<sub>(3,201)</sub></td><td align=\"left\">< 0.001</td><td align=\"left\">10.30 (5.20 to 15.30)</td><td align=\"center\">0.4</td></tr><tr><td align=\"left\">Social Function</td><td align=\"left\">69.64 (3.04)</td><td align=\"left\">78.67 (2.46)</td><td align=\"left\">76.72 (2.81)</td><td align=\"left\">79.98 (2.72)</td><td align=\"left\">5.16<sub>(3,201)</sub></td><td align=\"left\">0.002</td><td align=\"left\">10.30 (4.80 to 15.70)</td><td align=\"center\">0.4</td></tr><tr><td align=\"left\">Role Emotional</td><td align=\"left\">53.97 (5.31)</td><td align=\"left\">66.14 (4.81)</td><td align=\"left\">71.05 (4.98)</td><td align=\"left\">73.01 (4.80)</td><td align=\"left\">5.27<sub>(3,201)</sub></td><td align=\"left\">0.002</td><td align=\"left\">19.04 (9.10 to 28.90)</td><td align=\"center\">0.4</td></tr><tr><td align=\"left\">Mental Health</td><td align=\"left\">71.02 (2.25)</td><td align=\"left\">77.11 (1.70)</td><td align=\"left\">79.00 (1.90)</td><td align=\"left\">78.73 (2.11)</td><td align=\"left\">9.34<sub>(3,201)</sub></td><td align=\"left\">< 0.001</td><td align=\"left\">7.70 (3.60 to 11.70)</td><td align=\"center\">0.4</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Characteristics of participants enrolled in OAK program</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\"><bold>Gender (F:M)</bold></td><td align=\\\"center\\\"><bold>60:19</bold></td></tr><tr><td align=\\\"left\\\"><bold>Age: mean (SD) years</bold></td><td align=\\\"center\\\"><bold>66 (9)</bold></td></tr></thead><tbody><tr><td align=\\\"left\\\"><bold>Socio-Economic Index by Post Code </bold>[##UREF##10##24##]</td><td align=\\\"center\\\"><bold>Number (%)</bold></td></tr><tr><td colspan=\\\"2\\\"><hr/></td></tr><tr><td align=\\\"left\\\">Index measured in quintile ranges</td><td/></tr><tr><td align=\\\"left\\\">Top 25%</td><td align=\\\"center\\\">59 (74.6)</td></tr><tr><td align=\\\"left\\\">50–75%</td><td align=\\\"center\\\">7 (8.8)</td></tr><tr><td align=\\\"left\\\">25–50%</td><td align=\\\"center\\\">7 (8.8)</td></tr><tr><td align=\\\"left\\\">10–25%</td><td align=\\\"center\\\">3 (3.8)</td></tr><tr><td align=\\\"left\\\">Bottom 10%</td><td align=\\\"center\\\">3 (3.8)</td></tr><tr><td colspan=\\\"2\\\"><hr/></td></tr><tr><td align=\\\"left\\\"><bold>Coexisting disease</bold></td><td align=\\\"center\\\"><bold>n (%)*</bold></td></tr><tr><td colspan=\\\"2\\\"><hr/></td></tr><tr><td align=\\\"left\\\">Cardiovascular, n (%)</td><td align=\\\"center\\\">48 (45)</td></tr><tr><td align=\\\"left\\\">Mental Health, n (%)</td><td align=\\\"center\\\">9 (11)</td></tr><tr><td align=\\\"left\\\">Gastrointestinal, n (%)</td><td align=\\\"center\\\">27 (30)</td></tr><tr><td align=\\\"left\\\">Endocrine, n (%)</td><td align=\\\"center\\\">15 (18)</td></tr><tr><td align=\\\"left\\\">Musculoskeletal, n (%)</td><td align=\\\"center\\\">16 (20)</td></tr><tr><td align=\\\"left\\\">Osteoporosis, n (%)</td><td align=\\\"center\\\">14 (18)</td></tr><tr><td align=\\\"left\\\">Multiple co-morbidities, n (%)</td><td align=\\\"center\\\">51 (64.5)</td></tr><tr><td align=\\\"left\\\">Other, n (%)</td><td align=\\\"center\\\">31 (61)</td></tr><tr><td align=\\\"left\\\">No co-morbidities, n (%)</td><td align=\\\"center\\\">12 (15)</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T2\\\"><label>Table 2</label><caption><p>WOMAC scores at baseline, 8 weeks, 6 months and 12 months</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td/><td align=\\\"left\\\">BL<break/></td><td align=\\\"left\\\">8 wks<break/></td><td align=\\\"left\\\">6 mths<break/></td><td align=\\\"left\\\">12 mths<break/></td><td align=\\\"left\\\">F (df)<break/></td><td align=\\\"left\\\"><italic>p</italic>-value<break/></td><td align=\\\"left\\\">Change at 12 mths <break/>Mean (95% CI)</td><td align=\\\"center\\\">Effect size (d)<break/></td></tr></thead><tbody><tr><td align=\\\"left\\\"><bold>WOMAC</bold></td><td/><td/><td/><td/><td/><td/><td/><td/></tr><tr><td align=\\\"left\\\">Pain (0 to 20)</td><td align=\\\"left\\\">7.91 (0.46)</td><td align=\\\"left\\\">6.57 (0.36)</td><td align=\\\"left\\\">6.30 (0.39)</td><td align=\\\"left\\\">5.95 (0.46)</td><td align=\\\"left\\\">11.01<sub>(3,201)</sub></td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">1.95 (1.1 to 2.7)</td><td align=\\\"center\\\">0.5</td></tr><tr><td align=\\\"left\\\">Stiffness (0 to 8)</td><td align=\\\"left\\\">3.88 (0.21)</td><td align=\\\"left\\\">3.16 (0.19)</td><td align=\\\"left\\\">3.19 (0.17)</td><td align=\\\"left\\\">3.13 (0.19)</td><td align=\\\"left\\\">6.19<sub>(3,201)</sub></td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">0.75 (0.3 to 1.1)</td><td align=\\\"center\\\">0.4</td></tr><tr><td align=\\\"left\\\">Function (0 to 68)</td><td align=\\\"left\\\">24.98 (1.41)</td><td align=\\\"left\\\">20.66 (1.28)</td><td align=\\\"left\\\">19.86 (1.37)</td><td align=\\\"left\\\">19.63 (1.44)</td><td align=\\\"left\\\">10.02<sub>(3,201)</sub></td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">5.35 (2.8 to 7.8)</td><td align=\\\"center\\\">0.4</td></tr><tr><td align=\\\"left\\\">Total (0 to 96)</td><td align=\\\"left\\\">36.77 (1.94)</td><td align=\\\"left\\\">30.29 (1.66)</td><td align=\\\"left\\\">29.39 (1.84)</td><td align=\\\"left\\\">28.72 (2.00)</td><td align=\\\"left\\\">12.25<sub>(3,201)</sub></td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">8.06 (4.6 to 11.4)</td><td align=\\\"center\\\">0.5</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T3\\\"><label>Table 3</label><caption><p>SF-36 scores at baseline, 8 weeks, 6 months and 12 months</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\"><bold>SF-36 </bold>(0 to 100)</td><td align=\\\"left\\\"><bold>BL</bold></td><td align=\\\"left\\\"><bold>8 wks</bold></td><td align=\\\"left\\\"><bold>6 mths</bold></td><td align=\\\"left\\\"><bold>12 mths</bold></td><td align=\\\"left\\\"><bold>F (df)</bold></td><td align=\\\"left\\\"><bold><italic>p</italic>-value</bold></td><td align=\\\"left\\\"><bold>Change at 12 mths Mean (95% CI)</bold></td><td align=\\\"center\\\"><bold>Effect size (d)</bold></td></tr></thead><tbody><tr><td align=\\\"left\\\">Physical Function</td><td align=\\\"left\\\">47.36 (2.49)</td><td align=\\\"left\\\">52.00 (2.62)</td><td align=\\\"left\\\">56.13 (2.62)</td><td align=\\\"left\\\">55.66 (3.13)</td><td align=\\\"left\\\">5.47<sub>(3,201)</sub></td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">7.73 (2.70 to 12.70)</td><td align=\\\"center\\\">0.3</td></tr><tr><td align=\\\"left\\\">Role Physical</td><td align=\\\"left\\\">29.77 (4.54)</td><td align=\\\"left\\\">41.54 (4.87)</td><td align=\\\"left\\\">43.01 (4.99)</td><td align=\\\"left\\\">46.69 (5.23)</td><td align=\\\"left\\\">4.48<sub>(3,201)</sub></td><td align=\\\"left\\\">0.004</td><td align=\\\"left\\\">16.91 (7.20 to 26.50)</td><td align=\\\"center\\\">0.4</td></tr><tr><td align=\\\"left\\\">Bodily Pain</td><td align=\\\"left\\\">35.50 (1.85)</td><td align=\\\"left\\\">40.39 (2.06)</td><td align=\\\"left\\\">41.52 (2.52)</td><td align=\\\"left\\\">43.64 (2.49)</td><td align=\\\"left\\\">3.49<sub>(3,201)</sub></td><td align=\\\"left\\\">0.017</td><td align=\\\"left\\\">8.14 (3.03 to 13.20)</td><td align=\\\"center\\\">0.5</td></tr><tr><td align=\\\"left\\\">General Health</td><td align=\\\"left\\\">63.72 (2.58)</td><td align=\\\"left\\\">67.05 (2.25)</td><td align=\\\"left\\\">69.13 (2.57)</td><td align=\\\"left\\\">69.79 (2.50)</td><td align=\\\"left\\\">3.42<sub>(3,201)</sub></td><td align=\\\"left\\\">0.018</td><td align=\\\"left\\\">6.07 (1.50 to 10.50)</td><td align=\\\"center\\\">0.3</td></tr><tr><td align=\\\"left\\\">Vitality</td><td align=\\\"left\\\">50.41 (2.73)</td><td align=\\\"left\\\">56.38 (2.10)</td><td align=\\\"left\\\">57.30 (2.41)</td><td align=\\\"left\\\">60.73 (2.58)</td><td align=\\\"left\\\">7.64<sub>(3,201)</sub></td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">10.30 (5.20 to 15.30)</td><td align=\\\"center\\\">0.4</td></tr><tr><td align=\\\"left\\\">Social Function</td><td align=\\\"left\\\">69.64 (3.04)</td><td align=\\\"left\\\">78.67 (2.46)</td><td align=\\\"left\\\">76.72 (2.81)</td><td align=\\\"left\\\">79.98 (2.72)</td><td align=\\\"left\\\">5.16<sub>(3,201)</sub></td><td align=\\\"left\\\">0.002</td><td align=\\\"left\\\">10.30 (4.80 to 15.70)</td><td align=\\\"center\\\">0.4</td></tr><tr><td align=\\\"left\\\">Role Emotional</td><td align=\\\"left\\\">53.97 (5.31)</td><td align=\\\"left\\\">66.14 (4.81)</td><td align=\\\"left\\\">71.05 (4.98)</td><td align=\\\"left\\\">73.01 (4.80)</td><td align=\\\"left\\\">5.27<sub>(3,201)</sub></td><td align=\\\"left\\\">0.002</td><td align=\\\"left\\\">19.04 (9.10 to 28.90)</td><td align=\\\"center\\\">0.4</td></tr><tr><td align=\\\"left\\\">Mental Health</td><td align=\\\"left\\\">71.02 (2.25)</td><td align=\\\"left\\\">77.11 (1.70)</td><td align=\\\"left\\\">79.00 (1.90)</td><td align=\\\"left\\\">78.73 (2.11)</td><td align=\\\"left\\\">9.34<sub>(3,201)</sub></td><td align=\\\"left\\\">< 0.001</td><td align=\\\"left\\\">7.70 (3.60 to 11.70)</td><td align=\\\"center\\\">0.4</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":["<table-wrap-foot><p>*Percentage adds > 100 as some participants have more than one coexisting disease</p></table-wrap-foot>","<table-wrap-foot><p>Values are mean (SE). Lower scores indicate improvement; F-values and p-values are for repeated measures ANOVA. Change at 12 months values are mean (95% CI). Effect size is for pair wise comparison between baseline and 12 month scores.</p></table-wrap-foot>","<table-wrap-foot><p>Values are mean (SE). Higher scores indicate improvement; F-values and p-values are for repeated measures ANOVA. Change at 12 months values are mean (95% CI). Effect size is for pair wise comparison between baseline and 12 month scores.</p></table-wrap-foot>"],"string":"[\n \"<table-wrap-foot><p>*Percentage adds > 100 as some participants have more than one coexisting disease</p></table-wrap-foot>\",\n \"<table-wrap-foot><p>Values are mean (SE). Lower scores indicate improvement; F-values and p-values are for repeated measures ANOVA. Change at 12 months values are mean (95% CI). Effect size is for pair wise comparison between baseline and 12 month scores.</p></table-wrap-foot>\",\n \"<table-wrap-foot><p>Values are mean (SE). Higher scores indicate improvement; F-values and p-values are for repeated measures ANOVA. Change at 12 months values are mean (95% CI). Effect size is for pair wise comparison between baseline and 12 month scores.</p></table-wrap-foot>\"\n]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1471-2474-9-117-1\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1471-2474-9-117-1\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Lorig\", \"Mazonson\", \"Holman\"], \"given-names\": [\"K\", \"P\", \"H\"], \"article-title\": [\"Evidence suggesting that health education for self-management in patients with chronic arthritis has sustained health benefits while reducing health care costs\"], \"source\": [\"Arthritis and Rheumatism\"], \"year\": [\"1993\"], \"volume\": [\"36\"], \"fpage\": [\"493\"], \"lpage\": [\"496\"], \"pub-id\": [\"10.1002/art.1780360403\"]}, {\"surname\": [\"Newman\", \"Steed\", \"Mulligan\"], \"given-names\": [\"S\", \"L\", \"K\"], \"article-title\": [\"Self-management interventions for chronic illness\"], \"source\": [\"The Lancet\"], \"year\": [\"2004\"], \"volume\": [\"364\"], \"fpage\": [\"1523\"], \"lpage\": [\"1538\"], \"pub-id\": [\"10.1016/S0140-6736(04)17277-2\"]}, {\"surname\": [\"Barlow\", \"Wright\", \"Sheasby\", \"Turner\", \"Hainsworth\"], \"given-names\": [\"J\", \"C\", \"J\", \"A\", \"J\"], \"article-title\": [\"Self-management approaches for people with chronic conditions: a review\"], \"source\": [\"Patient Education and Counselling\"], \"year\": [\"2002\"], \"volume\": [\"48\"], \"fpage\": [\"177\"], \"lpage\": [\"187\"], \"pub-id\": [\"10.1016/S0738-3991(02)00032-0\"]}, {\"collab\": [\"National Health and Medical Research Council\"], \"article-title\": [\"When does Quality Assurance in Health Care Require Independent Ethical Review?\"], \"year\": [\"2003\"]}, {\"collab\": [\"National Health and Medical Research Council\"], \"surname\": [\"Australian Government\"], \"article-title\": [\"National Statement on Ethical Conduct in Human Research\"], \"source\": [\"NHMRC Ethics Guidelines\"], \"year\": [\"2007\"], \"volume\": [\"2007\"], \"publisher-name\": [\"Canberra: Australian Government\"]}, {\"surname\": [\"Ware\", \"Kosinski\", \"Gandek\"], \"given-names\": [\"JE\", \"MA\", \"B\"], \"suffix\": [\"Jr\"], \"source\": [\"SF-36 Health Survey Manual & Interpretation Guide\"], \"year\": [\"2002\"], \"publisher-name\": [\"Lincoln RI: QualityMetric Inc\"]}, {\"surname\": [\"Ware\", \"Kosinski\"], \"given-names\": [\"JE\", \"MA\"], \"suffix\": [\"Jr\"], \"source\": [\"SF-36 Physical & Mental Health Summary Scales: A Manual for Users of Version1\"], \"year\": [\"2002\"], \"edition\": [\"Second\"], \"publisher-name\": [\"Lincoln, Rhode Island: QualityMetric Inc\"]}, {\"surname\": [\"Vellas\", \"Wayne\", \"Romero\", \"Baumgartner\", \"Rubenstein\", \"Garry\"], \"given-names\": [\"B\", \"S\", \"L\", \"R\", \"L\", \"P\"], \"article-title\": [\"One-legged balance is an important predictor of injurious falls in older persons\"], \"source\": [\"Journal of American Geriatric Society\"], \"year\": [\"1997\"], \"volume\": [\"45\"], \"fpage\": [\"735\"], \"lpage\": [\"738\"]}, {\"surname\": [\"Curb\", \"Ceria-Ulep\", \"Rodriguez\", \"Grove\", \"Guralnik\", \"Willcox\", \"Donlon\", \"Masaki\", \"Chen\"], \"given-names\": [\"J\", \"C\", \"B\", \"J\", \"J\", \"B\", \"T\", \"M\", \"R\"], \"article-title\": [\"Performance-based measures of function for high-function populations\"], \"source\": [\"Journal of American Geriatric Society\"], \"year\": [\"2006\"], \"volume\": [\"54\"], \"fpage\": [\"737\"], \"lpage\": [\"742\"], \"pub-id\": [\"10.1111/j.1532-5415.2006.00700.x\"]}, {\"surname\": [\"Cohen\"], \"given-names\": [\"J\"], \"source\": [\"Statistical Power Analysis for the Behavioral Sciences\"], \"year\": [\"1988\"], \"edition\": [\"2\"], \"publisher-name\": [\"Hillsdale, NJ: Lawrence Erlbaum Associates\"]}, {\"collab\": [\"Australian Bureau of Statistics\"], \"source\": [\"Census of Population and Housing: Socio-Economic Indexes for Area's (SEIFA)\"], \"year\": [\"2001\"], \"publisher-name\": [\"Australian Bureau of Statistics\"], \"fpage\": [\"1\"], \"lpage\": [\"90\"]}, {\"surname\": [\"Bandura\"], \"given-names\": [\"A\"], \"source\": [\"Self-efficacy\"], \"year\": [\"1994\"], \"volume\": [\"4\"], \"publisher-name\": [\"New York: Academic Press\"]}, {\"surname\": [\"Tubach\", \"Ravaud\", \"Baron\", \"Falissard\", \"Logeart\", \"N\", \"Bombardier\", \"Felson\", \"Hochberg\", \"Heijde\", \"Dougados\"], \"given-names\": [\"F\", \"P\", \"G\", \"B\", \"I\", \"B\", \"C\", \"D\", \"M\", \"D van der\", \"M\"], \"article-title\": [\"Evaluation of clinically relevant changes in patient-reported outcomes in knee and hip osteoarthritis: the minimally clinically important improvement\"], \"source\": [\"Annals of Rheumatic Disease, online 101136/ard2004022905\"], \"year\": [\"2005\"]}, {\"surname\": [\"Roddy\", \"Zhang\", \"Doherty\"], \"given-names\": [\"E\", \"W\", \"M\"], \"article-title\": [\"Aerobic walking or strengthening exercise for osteoarthritis of the knee? A systematic review\"], \"source\": [\"Annals of Rheumatic Diseases\"], \"year\": [\"2005\"], \"volume\": [\"64\"], \"fpage\": [\"544\"], \"lpage\": [\"548\"], \"pub-id\": [\"10.1136/ard.2004.028746\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":37,"string":"37"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:38"},"citation":{"kind":"string","value":"BMC Musculoskelet Disord. 2008 Sep 8; 9:117"},"package_file":{"kind":"string","value":"oa_package/09/f1/PMC2538526.tar.gz"}}},{"rowIdx":119691,"cells":{"accession_id":{"kind":"string","value":"PMC2538527"},"pmid":{"kind":"string","value":"18752669"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>Interferons (IFNs) are cytokines with major therapeutic applications based on their antiviral, antiproliferative, and immunomodulatory activities. Type I IFNs (IFNα/β) are massively produced in most cell types in response to viral and other microbial infections, and play a vital role in innate resistance to a wide variety of viruses [##REF##17544197##1##]. The IFNα2 locus comprises three variants, IFNα2a, IFNα2b and IFNα2c, IFNα2b being the predominant one detected in human genomic DNA [##REF##7976860##2##,##REF##7648441##3##]. Some of the many diseases treated with IFNα2b, alone or in combination, include type B [##REF##16883349##4##] and C hepatitis [##REF##10622585##5##], several cancers such as melanoma [##REF##16469753##6##, ####REF##11095409##7##, ##REF##16198768##8####16198768##8##], Kaposi's sarcoma [##REF##10975552##9##], chronic myeloid lymphoma [##REF##15075898##10##,##REF##11698293##11##], and angioblastoma [##REF##11826247##12##]. In the particular case of hepatitis C, a disease affecting over 170 million individuals worldwide, the combination of IFNα and the viral inhibitor ribavirin has become the standard treatment [##REF##15336584##13##, ####REF##11583749##14##, ##REF##17151366##15####17151366##15##]. The rising incidence of certain cancers and viral hepatitis [##REF##16831687##16##,##REF##16799618##17##], in addition to ongoing investigations of novel therapeutic applications [##REF##12727570##18##] are increasing the needs for human recombinant IFNα2b.</p>","<p>Human recombinant IFNα2b used in the clinic is synthesized in bacterial systems. When <italic>E. coli </italic>are grown in optimal conditions, a few grams (3 to 5) of recombinant human IFNα per litre of culture can be produced [##REF##10919322##19##, ####REF##11389671##20##, ##REF##15866717##21####15866717##21##]. Bacterially produced recombinant human IFNα2b is misfolded and therefore requires refolding into its native conformation. Once purified and refolded, the recoveries are typically lower than 20% [##REF##10919322##19##,##REF##11389671##20##]. This refolding process also often results in loss of specific activity. In addition, bacterially produced recombinant human IFNα2b lacks the post-translational O-glycosylation present on the naturally synthesized protein. This non-glycosylated form of human recombinant IFNα2b has a shorter serum half-life than the glycosylated form [##REF##12369859##22##]. The chemical conjugation of polyethylene glycol (PEG) molecules to the core peptide (pegylation) has improved the pharmacodynamics and pharmacokinetics of IFNα2b by increasing the serum half-life [##REF##11103758##23##]. However, the pegylation of IFNα2b has been reported in some cases to reduce its biological activity [##REF##12806274##24##]. It has also been shown that the size of PEG molecules and sites of attachment differentially interfere with the interaction and binding of IFNα2b to its receptor [##REF##15596441##25##]. Nevertheless, the US Food and Drug Administration approved PEG-IFNα2b in 2001 and PEG-IFNα2a in 2002 for the treatment of chronic hepatitis C virus infection. Another common problem associated with the use of refolded and pegylated IFNα (PEG-IFNα) is the formation of neutralizing antibodies. Antibody formation against PEG-IFNα in HCV-infected patients has been associated with treatment failure [##REF##8033418##26##,##REF##16554542##27##]. In mice, the presence of contaminating partially unfolded IFN species appears to play a key role in the appearance of these antibodies [##REF##9358564##28##]</p>","<p>Human and other mammalian cells are expression systems of choice for the production of secreted recombinant proteins such as antibodies, sometimes yielding up to hundreds of milligram to gram quantities of purified product per liter of culture [##REF##14574701##29##, ####REF##12765023##30##, ##REF##15529164##31####15529164##31##]. However, the volumetric productivity of human cells for given proteins such as cytokines (i.e. IFNα2b) is often lower by several orders of magnitude. Originally, IFNα for therapeutic use was purified from the human lymphoblastoid Namalwa cell line following induction with Sendai virus. Despite the production of an IFNα with high biological activity, Namalwa cells were abandoned due to a limited productivity unable to satisfy an ever-growing demand. Other systems have been tested for the production of IFNα2b. For example, avian eggs have been used for the production of human recombinant IFNα2b [##REF##17416111##32##,##REF##14601655##33##], although the glycosylation pattern significantly differs from IFNα2b produced by human peripheral blood leucocytes. Glycosylated IFNα2b can also be produced in insect cells, but glycosylation is of the potentially immunogenic high-mannose type and lacks sialylation [##REF##8223649##34##]. These limitations suggest that mammalian cells are preferable hosts for the production of fully glycosylated IFNα2b. Chinese hamster ovary (CHO) cells have been used for the production of various human recombinant interferons. Glycosylated and biologically active mouse IFNα [##REF##3981134##35##] can be produced in CHO cells. Similarly, Rossman <italic>et al </italic>have reported the production of 120 μg/mL of IFNα2b using a glutamine synthase-amplified vector in the mouse myeloma cell line NS0 [##REF##8776749##36##]. This is the highest level of glycosylated recombinant human IFNα2b produced in a mammalian system reported to date. <italic>In vitro</italic>, the biological activity of NS0-produced IFNα2b is very similar to that produced by Namalwa cells.</p>","<p>Here we have successfully engineered a non-amplified IFN-producing clone derived from the HEK293 mammalian cell line that produces hundreds of milligrams of IFNα2b per liter of serum-free media. The volumetric production of IFNα2b reproducibly exceeds 200 mg/L in batch culture and remains stable in the absence of selection for more than four months in culture. The purified IFNα2b is glycosylated and biologically active. Together these results demonstrate that cost-effective production and purification of glycosylated IFNα2b from human cells can be achieved.</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>Interferons (IFNs) are cytokines with major therapeutic applications based on their antiviral, antiproliferative, and immunomodulatory activities. Type I IFNs (IFNα/β) are massively produced in most cell types in response to viral and other microbial infections, and play a vital role in innate resistance to a wide variety of viruses [##REF##17544197##1##]. The IFNα2 locus comprises three variants, IFNα2a, IFNα2b and IFNα2c, IFNα2b being the predominant one detected in human genomic DNA [##REF##7976860##2##,##REF##7648441##3##]. Some of the many diseases treated with IFNα2b, alone or in combination, include type B [##REF##16883349##4##] and C hepatitis [##REF##10622585##5##], several cancers such as melanoma [##REF##16469753##6##, ####REF##11095409##7##, ##REF##16198768##8####16198768##8##], Kaposi's sarcoma [##REF##10975552##9##], chronic myeloid lymphoma [##REF##15075898##10##,##REF##11698293##11##], and angioblastoma [##REF##11826247##12##]. In the particular case of hepatitis C, a disease affecting over 170 million individuals worldwide, the combination of IFNα and the viral inhibitor ribavirin has become the standard treatment [##REF##15336584##13##, ####REF##11583749##14##, ##REF##17151366##15####17151366##15##]. The rising incidence of certain cancers and viral hepatitis [##REF##16831687##16##,##REF##16799618##17##], in addition to ongoing investigations of novel therapeutic applications [##REF##12727570##18##] are increasing the needs for human recombinant IFNα2b.</p>\",\n \"<p>Human recombinant IFNα2b used in the clinic is synthesized in bacterial systems. When <italic>E. coli </italic>are grown in optimal conditions, a few grams (3 to 5) of recombinant human IFNα per litre of culture can be produced [##REF##10919322##19##, ####REF##11389671##20##, ##REF##15866717##21####15866717##21##]. Bacterially produced recombinant human IFNα2b is misfolded and therefore requires refolding into its native conformation. Once purified and refolded, the recoveries are typically lower than 20% [##REF##10919322##19##,##REF##11389671##20##]. This refolding process also often results in loss of specific activity. In addition, bacterially produced recombinant human IFNα2b lacks the post-translational O-glycosylation present on the naturally synthesized protein. This non-glycosylated form of human recombinant IFNα2b has a shorter serum half-life than the glycosylated form [##REF##12369859##22##]. The chemical conjugation of polyethylene glycol (PEG) molecules to the core peptide (pegylation) has improved the pharmacodynamics and pharmacokinetics of IFNα2b by increasing the serum half-life [##REF##11103758##23##]. However, the pegylation of IFNα2b has been reported in some cases to reduce its biological activity [##REF##12806274##24##]. It has also been shown that the size of PEG molecules and sites of attachment differentially interfere with the interaction and binding of IFNα2b to its receptor [##REF##15596441##25##]. Nevertheless, the US Food and Drug Administration approved PEG-IFNα2b in 2001 and PEG-IFNα2a in 2002 for the treatment of chronic hepatitis C virus infection. Another common problem associated with the use of refolded and pegylated IFNα (PEG-IFNα) is the formation of neutralizing antibodies. Antibody formation against PEG-IFNα in HCV-infected patients has been associated with treatment failure [##REF##8033418##26##,##REF##16554542##27##]. In mice, the presence of contaminating partially unfolded IFN species appears to play a key role in the appearance of these antibodies [##REF##9358564##28##]</p>\",\n \"<p>Human and other mammalian cells are expression systems of choice for the production of secreted recombinant proteins such as antibodies, sometimes yielding up to hundreds of milligram to gram quantities of purified product per liter of culture [##REF##14574701##29##, ####REF##12765023##30##, ##REF##15529164##31####15529164##31##]. However, the volumetric productivity of human cells for given proteins such as cytokines (i.e. IFNα2b) is often lower by several orders of magnitude. Originally, IFNα for therapeutic use was purified from the human lymphoblastoid Namalwa cell line following induction with Sendai virus. Despite the production of an IFNα with high biological activity, Namalwa cells were abandoned due to a limited productivity unable to satisfy an ever-growing demand. Other systems have been tested for the production of IFNα2b. For example, avian eggs have been used for the production of human recombinant IFNα2b [##REF##17416111##32##,##REF##14601655##33##], although the glycosylation pattern significantly differs from IFNα2b produced by human peripheral blood leucocytes. Glycosylated IFNα2b can also be produced in insect cells, but glycosylation is of the potentially immunogenic high-mannose type and lacks sialylation [##REF##8223649##34##]. These limitations suggest that mammalian cells are preferable hosts for the production of fully glycosylated IFNα2b. Chinese hamster ovary (CHO) cells have been used for the production of various human recombinant interferons. Glycosylated and biologically active mouse IFNα [##REF##3981134##35##] can be produced in CHO cells. Similarly, Rossman <italic>et al </italic>have reported the production of 120 μg/mL of IFNα2b using a glutamine synthase-amplified vector in the mouse myeloma cell line NS0 [##REF##8776749##36##]. This is the highest level of glycosylated recombinant human IFNα2b produced in a mammalian system reported to date. <italic>In vitro</italic>, the biological activity of NS0-produced IFNα2b is very similar to that produced by Namalwa cells.</p>\",\n \"<p>Here we have successfully engineered a non-amplified IFN-producing clone derived from the HEK293 mammalian cell line that produces hundreds of milligrams of IFNα2b per liter of serum-free media. The volumetric production of IFNα2b reproducibly exceeds 200 mg/L in batch culture and remains stable in the absence of selection for more than four months in culture. The purified IFNα2b is glycosylated and biologically active. Together these results demonstrate that cost-effective production and purification of glycosylated IFNα2b from human cells can be achieved.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<title>Material</title>","<p>The expression plasmid was purified with a maxi-prep plasmid purification kit (Qiagen, Mississauga, ON, Canada). F17 serum-free culture media and blasticidin were obtained from Invitrogen (Carlsbad, CA). Pluronic F68 and glutamine were from Sigma-Aldrich (St. Louis, MO) and Tryptone N1 from Organotechnie (La Courneuve, France). Reagents for IFNα2b purification and electrophoresis include anhydrous citric acid and tri-Na citrate (EMD Chemicals Inc, Darmstadt, Germany), 0.45 μm filtering units (Millipore, Bedford, MA), NaCl (Sigma-Aldrich, St. Louis, MO), Fractogel* SO3<sup>- </sup>(M) (Merck KGaA, Darmstadt, Germany), Econo-Pac<sup>® </sup>10 columns (Bio-Rad Laboratories), Bradford Reagent (Biorad, Hercules, CA), 2 μm filters (Pall Corp, Ann Arbor, MI), NuPAGE Bis Tris 4–12% gradient gels, MES 20× buffer (Invitrogen, Carlsbad, CA), and Coomassie R250 stain (Sigma-Aldrich, St. Louis, MO). Trypsin (Promega, Madison WI), neuraminidase, dithiothreitol, iodoacetamide and guanidine HCl (Sigma-Aldrich, St. Louis, MO), O-glycosidase (Roche), Tris HCl, (Bio-Rad, Mississauga, ON), high purity acetonitrile, formic acid and ammonium bicarbonate (VWR International, Montreal, QC) and Centricon 3,000 MWL centrifugal filters (Millipore, Bedford, MA) were used for glycosylation analysis. The IFNα antibody and ELISA kit are from PBL InterferonSource (Piscataway, NJ, USA) and bacterially produced IFNα2b from Cell Sciences Inc (Norwood, MA, USA). pNifty2-56K-SEAP plasmid is from Invivogen (San Diego, USA).</p>","<title>IFNα2b expression plasmid</title>","<p>The IFNα2b gene was synthesized with human-optimized codons (Geneart AG, Regensburg, Germany) according to the Genebank sequence no. AY255838. The synthetic cDNA was inserted as a BamHI/EcoRI fragment downstream of the cytomegalovirus (CMV) promoter into the pYD7 expression plasmid. This plasmid is a derivative of the previously described pTT vector [##REF##11788735##37##] encoding the original functional elements in addition to a blasticidin resistance cassette.</p>","<title>Engineering of a HEK293 clone stably expressing IFNα2b and fed-batch production</title>","<p>A HEK293 cell line constitutively expressing the EBNA1 protein of EBV (clone 6E) was used to generate IFN-producing clones. HEK293-6E and IFN-producing clone are grown in suspension in serum-free F17 culture media supplemented with 0.1% pluronic F68. Cultures were grown at 37°C and 5% CO<sub>2 </sub>under constant agitation (120 rpm). HEK293-6E were transfected as previously described [##REF##11788735##37##] with PvuI-linearized pYD7/IFNα2b and selected in the presence of 2 μg/mL of blasticidin. The blasticidin resistant cells were next seeded into 96 well plates at 1 cell/well without blasticidin. After 3–4 weeks, emerging clones were expanded (in the absence of blasticidin) and tested for IFNα2b expression by dot blot. The selection of IFN-producing clones was based on the levels of IFNα2b expression and growth properties of the clones. The highest producers were amplified as suspension cultures and tested for IFNα2b accumulation over a 4 days culture. One clone, identified as D9, was selected because it is stably producing high IFNα2b levels while maintaining a high growth rate (doubling time of 26 hours<sup>-1</sup>). For IFNα2b production, cells were seeded at a density of 0,25 × 10<sup>6 </sup>cells/mL in F17 antibiotic-free media in shaker flasks. Twenty-four hours post-seeding, the cultures were fed with 0,5% peptones [##REF##11788735##37##,##REF##15803471##49##] and left in the incubator for an additional 7–8 days. Optional addition of 20 mM glucose and 5 mM glutamine was performed 4 days post seeding where indicated.</p>","<title>Purification of IFNα2b</title>","<p>The culture medium of a fed-batch culture was collected by centrifugation at 1000 g for 10 min. The supernatant was then acidified to pH 3.6–3.8 with 1 M citric acid. Acidification caused the formation of a precipitate which was removed by centrifugation. The clarified supernatant was then filtered on a 0.45 μm filtering unit. Purification of IFNα2b from the filtered supernatant was performed on an ÄKTA Explorer system (GE healthcare, Baie D'Urfé, QC, Canada). The supernatant was loaded at a flow rate of 10 mL/min on a Fractogel SO3-cation exchange column, previously equilibrated with 0,1 M Tri-Na citrate buffer pH 3,5 containing 0,35 M NaCl. Following a wash with 2 column volumes of the equilibration buffer, the IFNα2b was then eluted with a pH gradient. The pH of the mobile phase was increased from pH 3,5 to pH 6,0 with 0,1 M Tri-Na citrate buffer pH 6.0, plus 0,35 M NaCl. The fractions containing IFNα2b were pooled. An additional desalting step was performed on Econo-Pac<sup>® </sup>10 columns according to the manufacturer's specifications. For the determination of glycosylation by enzymatic digestion, the purified IFNα2b was desalted in 0.1 M NH<sub>4</sub>HCO<sub>3 </sub>buffer pH 5 and lyophilized, whereas for bioassays, the purified IFNα2b was desalted in PBS and sterile filtered.</p>","<title>Quantification and purity of IFNα2b</title>","<p>IFNα2b recovered from the SO3<sup>- </sup>column was quantified by measuring absorption at 280 in a spectrophotometer, with a Nanodrop ND-1000 (Fisher Scientific, Montreal, QC, Canada), with a Bradford assay and by ELISA according to the manufacturer's protocol. The concentration in the harvest was measured with ELISA and used to calculate the percent recovery. To assess the purity level of IFNα2b, 3 μg were analyzed by SDS-PAGE followed by Coomassie staining.</p>","<title>N-terminal sequencing and enzymatic determination of glycosylation of purified IFNα2b</title>","<p>As HEK293-produced IFNα2b migrates as two bands on SDS-PAGE, N-terminal amino acid sequences from both bands were obtained by automated sequencing performed at our sequencing facility. Enzymatic treatments with neuraminidase and O-glycosidase were performed to remove sialic acid and O-linked sugars respectively. Sequential digestions were performed in 50 mM phosphate buffer pH 5,0 on 100 μg of purified/desalted IFNα2b. Removal of sialic acid was done with 0.5 IU of neuraminidase for 1 h at 37°C followed by addition of 15 mU of O-glycosidase. Non-glycosylated recombinant IFNα2b from <italic>E. coli </italic>and glycosylated and deglycosylated HEK293-produced IFNα2b were resolved on SDS-PAGE in parallel to compare migration profiles. Migration profiles of glycosylated and deglycosylated HEK293-produced IFNα2b were compared to non-glycosylated IFNα2b produced in <italic>E. coli</italic>.</p>","<title>Analysis of intact IFNα2b by mass spectrometry</title>","<p>The protein solution (~1 μg/μL in PBS buffer) was desalted by filtration on a 3 000 MWL Centricon filter and diluted to its original concentration with deionized water. The solution was adjusted to 20% acetonitrile, 0.2% formic acid just prior to infusion at 1 μL/min into the electrospray interface of a Q-TOF 2 hybrid quadrupole time-of-flight mass spectrometer (Waters, Milford, MA). The mass spectrometer was set to acquire one spectrum every 2 seconds over the mass range, m/z 800–2600. The protein molecular weight profile was generated from the mass spectrum using MaxEnt (Waters).</p>","<title>Sequence analysis of the tryptic glycopeptides from purified IFNα2b</title>","<p>Purified IFNα2b was reduced, alkylated and digested with trypsin according to standard protocols. In summary, approximately 100 μg of the protein was dissolved in 1M Tris HCl, 6M guanidine HCl, pH 7.5 containing 2 mM dithiothreitol (DTT) and incubated at 50°C for 1 hour. The reduced cysteines were converted to carboxyamidomethyl derivatives using 10-fold excess of iodoacetamide over DTT. The protein solution was then concentrated on a 3 000 MWL Centricon and diluted to 100 μL using 50 mM ammonium bicarbonate. This process was repeated a second time. Trypsin (5 ug) was added to the sample, which was then incubated overnight at 37°C.</p>","<p>The tryptic digest was analyzed and fractionated by LC-MS using an Agilent 1100 HPLC system coupled with the Q-TOF2 mass spectrometer. Approximately 60 μg of the protein digest was injected onto a 4.6 mm × 250 cm Jupiter, 5 μm, 300 Å, C18 column (Phenomenex, Torrance, CA) and resolved using the following gradient conditions: 5% to 60% acetonitrile, 0.2% formic acid in 45 minutes, increasing to 95% after 50 minutes (1 mL/min flow rate). Approximately, 60 μL/min of the HPLC eluate was directed to the mass spectrometer while the remainder was collected in 1 minute fractions. The Q-TOF2 mass spectrometer was set to acquire 1 spectrum per second (m/z 150–2000) whilst cycling between a low and high offset voltage within the collision cell (10 V and 35V, respectively). This enabled the simultaneous detection of intact peptide and glycopeptide ions in the higher m/z regions (low offset mode) as well as the unique glycan oxonium ions in the lower regions of the spectrum (high offset mode). By screening the fractions in this manner it was possible to determine that only two of them (fractions 25–26 and 26–27 minutes, respectively) contained glycopeptides.</p>","<p>Glycopeptides were interrogated by collision induced dissociation (CID) to determine their amino acid sequence and glycan composition and by electron transfer dissociation (ETD) to identify the site of linkage. ETD preserves delicate modifications intact during the fragmentation process and is ideal for identifying the linkage sites of O-glycans [##REF##15983376##50##, ####REF##15822944##51##, ##REF##15210983##52####15210983##52##]. The glycopeptide-containing fractions were infused at 1 μL/min into the electrospray ionization source of a LTQ XL linear ion trap (Thermo Fisher Scientific) capable of performing ETD. The CID collision voltage was adjusted for optimum production of peptide fragment ions from the multiply charge glycopeptide precursor ions (typically 25–30 V). ETD was performed using fluoranthene as the anionic reagent and with supplementary activation enabled. The optimal ETD reaction time for these glycopeptides was 350 msec.</p>","<title>Biological activity</title>","<p>A SEAP reporter gene assay based on expression plasmid containing an IFN-inducible promoter (pNiFty2) was used to assess the biological activity of glycosylated HEK293-produced IFNα2b in comparison to non-glycosylated IFNα2b. HEK293 cells were transfected with the pNiFty2 reporter plasmid, which encodes the secreted embryonic alkaline phosphatase (SEAP) under the control of the human ISG56 promoter. Transfected cells were plated in 96 well plates at a cell density of 10<sup>5 </sup>cells/mL and stimulated, 24 h post-transfection, with IFNα2b at the indicated concentrations. Following an additional 48 h period of incubation, the supernatants were collected and assayed for SEAP activity. The hydrolysis of paranitrophenyl phosphate (pNPP) was measured as a function of time to determine SEAP activity induced with IFN treatments, as previously described [##REF##10964415##53##]. The SEAP activity is expressed as the increase in absorbance units at 410 nm per minute.</p>","<p>Antiviral assays were carried out by PBL InterferonSource (Piscataway, NJ) using Madin-Darby Bovine Kidney (MDBK) cells challenged by Vesicular stomatitis virus or human A549 cells challenged with encephalomyocarditis virus [##REF##6163873##54##]. Cells were incubated with two-fold serial dilutions of IFNα2b standard (PBL InterferonSource), 293-IFNα2b, or control (Media). After 24 h incubation with the virus, cell viability was determined via crystal violet staining (570 nm absorbance). The sample titer (IC50), calculated by SigmaPlot software (SPSS Inc., Point Richmond, CA), was based on the 50% cytopathic effect of the assay. Units of anti-viral activity were based on the titer of a PBL lab standard, which was determined against the NIH reference standard for human IFNα2b (Gxa01-901-535).</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<title>Material</title>\",\n \"<p>The expression plasmid was purified with a maxi-prep plasmid purification kit (Qiagen, Mississauga, ON, Canada). F17 serum-free culture media and blasticidin were obtained from Invitrogen (Carlsbad, CA). Pluronic F68 and glutamine were from Sigma-Aldrich (St. Louis, MO) and Tryptone N1 from Organotechnie (La Courneuve, France). Reagents for IFNα2b purification and electrophoresis include anhydrous citric acid and tri-Na citrate (EMD Chemicals Inc, Darmstadt, Germany), 0.45 μm filtering units (Millipore, Bedford, MA), NaCl (Sigma-Aldrich, St. Louis, MO), Fractogel* SO3<sup>- </sup>(M) (Merck KGaA, Darmstadt, Germany), Econo-Pac<sup>® </sup>10 columns (Bio-Rad Laboratories), Bradford Reagent (Biorad, Hercules, CA), 2 μm filters (Pall Corp, Ann Arbor, MI), NuPAGE Bis Tris 4–12% gradient gels, MES 20× buffer (Invitrogen, Carlsbad, CA), and Coomassie R250 stain (Sigma-Aldrich, St. Louis, MO). Trypsin (Promega, Madison WI), neuraminidase, dithiothreitol, iodoacetamide and guanidine HCl (Sigma-Aldrich, St. Louis, MO), O-glycosidase (Roche), Tris HCl, (Bio-Rad, Mississauga, ON), high purity acetonitrile, formic acid and ammonium bicarbonate (VWR International, Montreal, QC) and Centricon 3,000 MWL centrifugal filters (Millipore, Bedford, MA) were used for glycosylation analysis. The IFNα antibody and ELISA kit are from PBL InterferonSource (Piscataway, NJ, USA) and bacterially produced IFNα2b from Cell Sciences Inc (Norwood, MA, USA). pNifty2-56K-SEAP plasmid is from Invivogen (San Diego, USA).</p>\",\n \"<title>IFNα2b expression plasmid</title>\",\n \"<p>The IFNα2b gene was synthesized with human-optimized codons (Geneart AG, Regensburg, Germany) according to the Genebank sequence no. AY255838. The synthetic cDNA was inserted as a BamHI/EcoRI fragment downstream of the cytomegalovirus (CMV) promoter into the pYD7 expression plasmid. This plasmid is a derivative of the previously described pTT vector [##REF##11788735##37##] encoding the original functional elements in addition to a blasticidin resistance cassette.</p>\",\n \"<title>Engineering of a HEK293 clone stably expressing IFNα2b and fed-batch production</title>\",\n \"<p>A HEK293 cell line constitutively expressing the EBNA1 protein of EBV (clone 6E) was used to generate IFN-producing clones. HEK293-6E and IFN-producing clone are grown in suspension in serum-free F17 culture media supplemented with 0.1% pluronic F68. Cultures were grown at 37°C and 5% CO<sub>2 </sub>under constant agitation (120 rpm). HEK293-6E were transfected as previously described [##REF##11788735##37##] with PvuI-linearized pYD7/IFNα2b and selected in the presence of 2 μg/mL of blasticidin. The blasticidin resistant cells were next seeded into 96 well plates at 1 cell/well without blasticidin. After 3–4 weeks, emerging clones were expanded (in the absence of blasticidin) and tested for IFNα2b expression by dot blot. The selection of IFN-producing clones was based on the levels of IFNα2b expression and growth properties of the clones. The highest producers were amplified as suspension cultures and tested for IFNα2b accumulation over a 4 days culture. One clone, identified as D9, was selected because it is stably producing high IFNα2b levels while maintaining a high growth rate (doubling time of 26 hours<sup>-1</sup>). For IFNα2b production, cells were seeded at a density of 0,25 × 10<sup>6 </sup>cells/mL in F17 antibiotic-free media in shaker flasks. Twenty-four hours post-seeding, the cultures were fed with 0,5% peptones [##REF##11788735##37##,##REF##15803471##49##] and left in the incubator for an additional 7–8 days. Optional addition of 20 mM glucose and 5 mM glutamine was performed 4 days post seeding where indicated.</p>\",\n \"<title>Purification of IFNα2b</title>\",\n \"<p>The culture medium of a fed-batch culture was collected by centrifugation at 1000 g for 10 min. The supernatant was then acidified to pH 3.6–3.8 with 1 M citric acid. Acidification caused the formation of a precipitate which was removed by centrifugation. The clarified supernatant was then filtered on a 0.45 μm filtering unit. Purification of IFNα2b from the filtered supernatant was performed on an ÄKTA Explorer system (GE healthcare, Baie D'Urfé, QC, Canada). The supernatant was loaded at a flow rate of 10 mL/min on a Fractogel SO3-cation exchange column, previously equilibrated with 0,1 M Tri-Na citrate buffer pH 3,5 containing 0,35 M NaCl. Following a wash with 2 column volumes of the equilibration buffer, the IFNα2b was then eluted with a pH gradient. The pH of the mobile phase was increased from pH 3,5 to pH 6,0 with 0,1 M Tri-Na citrate buffer pH 6.0, plus 0,35 M NaCl. The fractions containing IFNα2b were pooled. An additional desalting step was performed on Econo-Pac<sup>® </sup>10 columns according to the manufacturer's specifications. For the determination of glycosylation by enzymatic digestion, the purified IFNα2b was desalted in 0.1 M NH<sub>4</sub>HCO<sub>3 </sub>buffer pH 5 and lyophilized, whereas for bioassays, the purified IFNα2b was desalted in PBS and sterile filtered.</p>\",\n \"<title>Quantification and purity of IFNα2b</title>\",\n \"<p>IFNα2b recovered from the SO3<sup>- </sup>column was quantified by measuring absorption at 280 in a spectrophotometer, with a Nanodrop ND-1000 (Fisher Scientific, Montreal, QC, Canada), with a Bradford assay and by ELISA according to the manufacturer's protocol. The concentration in the harvest was measured with ELISA and used to calculate the percent recovery. To assess the purity level of IFNα2b, 3 μg were analyzed by SDS-PAGE followed by Coomassie staining.</p>\",\n \"<title>N-terminal sequencing and enzymatic determination of glycosylation of purified IFNα2b</title>\",\n \"<p>As HEK293-produced IFNα2b migrates as two bands on SDS-PAGE, N-terminal amino acid sequences from both bands were obtained by automated sequencing performed at our sequencing facility. Enzymatic treatments with neuraminidase and O-glycosidase were performed to remove sialic acid and O-linked sugars respectively. Sequential digestions were performed in 50 mM phosphate buffer pH 5,0 on 100 μg of purified/desalted IFNα2b. Removal of sialic acid was done with 0.5 IU of neuraminidase for 1 h at 37°C followed by addition of 15 mU of O-glycosidase. Non-glycosylated recombinant IFNα2b from <italic>E. coli </italic>and glycosylated and deglycosylated HEK293-produced IFNα2b were resolved on SDS-PAGE in parallel to compare migration profiles. Migration profiles of glycosylated and deglycosylated HEK293-produced IFNα2b were compared to non-glycosylated IFNα2b produced in <italic>E. coli</italic>.</p>\",\n \"<title>Analysis of intact IFNα2b by mass spectrometry</title>\",\n \"<p>The protein solution (~1 μg/μL in PBS buffer) was desalted by filtration on a 3 000 MWL Centricon filter and diluted to its original concentration with deionized water. The solution was adjusted to 20% acetonitrile, 0.2% formic acid just prior to infusion at 1 μL/min into the electrospray interface of a Q-TOF 2 hybrid quadrupole time-of-flight mass spectrometer (Waters, Milford, MA). The mass spectrometer was set to acquire one spectrum every 2 seconds over the mass range, m/z 800–2600. The protein molecular weight profile was generated from the mass spectrum using MaxEnt (Waters).</p>\",\n \"<title>Sequence analysis of the tryptic glycopeptides from purified IFNα2b</title>\",\n \"<p>Purified IFNα2b was reduced, alkylated and digested with trypsin according to standard protocols. In summary, approximately 100 μg of the protein was dissolved in 1M Tris HCl, 6M guanidine HCl, pH 7.5 containing 2 mM dithiothreitol (DTT) and incubated at 50°C for 1 hour. The reduced cysteines were converted to carboxyamidomethyl derivatives using 10-fold excess of iodoacetamide over DTT. The protein solution was then concentrated on a 3 000 MWL Centricon and diluted to 100 μL using 50 mM ammonium bicarbonate. This process was repeated a second time. Trypsin (5 ug) was added to the sample, which was then incubated overnight at 37°C.</p>\",\n \"<p>The tryptic digest was analyzed and fractionated by LC-MS using an Agilent 1100 HPLC system coupled with the Q-TOF2 mass spectrometer. Approximately 60 μg of the protein digest was injected onto a 4.6 mm × 250 cm Jupiter, 5 μm, 300 Å, C18 column (Phenomenex, Torrance, CA) and resolved using the following gradient conditions: 5% to 60% acetonitrile, 0.2% formic acid in 45 minutes, increasing to 95% after 50 minutes (1 mL/min flow rate). Approximately, 60 μL/min of the HPLC eluate was directed to the mass spectrometer while the remainder was collected in 1 minute fractions. The Q-TOF2 mass spectrometer was set to acquire 1 spectrum per second (m/z 150–2000) whilst cycling between a low and high offset voltage within the collision cell (10 V and 35V, respectively). This enabled the simultaneous detection of intact peptide and glycopeptide ions in the higher m/z regions (low offset mode) as well as the unique glycan oxonium ions in the lower regions of the spectrum (high offset mode). By screening the fractions in this manner it was possible to determine that only two of them (fractions 25–26 and 26–27 minutes, respectively) contained glycopeptides.</p>\",\n \"<p>Glycopeptides were interrogated by collision induced dissociation (CID) to determine their amino acid sequence and glycan composition and by electron transfer dissociation (ETD) to identify the site of linkage. ETD preserves delicate modifications intact during the fragmentation process and is ideal for identifying the linkage sites of O-glycans [##REF##15983376##50##, ####REF##15822944##51##, ##REF##15210983##52####15210983##52##]. The glycopeptide-containing fractions were infused at 1 μL/min into the electrospray ionization source of a LTQ XL linear ion trap (Thermo Fisher Scientific) capable of performing ETD. The CID collision voltage was adjusted for optimum production of peptide fragment ions from the multiply charge glycopeptide precursor ions (typically 25–30 V). ETD was performed using fluoranthene as the anionic reagent and with supplementary activation enabled. The optimal ETD reaction time for these glycopeptides was 350 msec.</p>\",\n \"<title>Biological activity</title>\",\n \"<p>A SEAP reporter gene assay based on expression plasmid containing an IFN-inducible promoter (pNiFty2) was used to assess the biological activity of glycosylated HEK293-produced IFNα2b in comparison to non-glycosylated IFNα2b. HEK293 cells were transfected with the pNiFty2 reporter plasmid, which encodes the secreted embryonic alkaline phosphatase (SEAP) under the control of the human ISG56 promoter. Transfected cells were plated in 96 well plates at a cell density of 10<sup>5 </sup>cells/mL and stimulated, 24 h post-transfection, with IFNα2b at the indicated concentrations. Following an additional 48 h period of incubation, the supernatants were collected and assayed for SEAP activity. The hydrolysis of paranitrophenyl phosphate (pNPP) was measured as a function of time to determine SEAP activity induced with IFN treatments, as previously described [##REF##10964415##53##]. The SEAP activity is expressed as the increase in absorbance units at 410 nm per minute.</p>\",\n \"<p>Antiviral assays were carried out by PBL InterferonSource (Piscataway, NJ) using Madin-Darby Bovine Kidney (MDBK) cells challenged by Vesicular stomatitis virus or human A549 cells challenged with encephalomyocarditis virus [##REF##6163873##54##]. Cells were incubated with two-fold serial dilutions of IFNα2b standard (PBL InterferonSource), 293-IFNα2b, or control (Media). After 24 h incubation with the virus, cell viability was determined via crystal violet staining (570 nm absorbance). The sample titer (IC50), calculated by SigmaPlot software (SPSS Inc., Point Richmond, CA), was based on the 50% cytopathic effect of the assay. Units of anti-viral activity were based on the titer of a PBL lab standard, which was determined against the NIH reference standard for human IFNα2b (Gxa01-901-535).</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<title>Generation of a stable IFNα2b-expressing HEK293 cell clone and production in fed-batch cultures</title>","<p>The expression plasmid pYD7 encoding the human IFNα2b gene codon-optimized for expression in human cells (Fig. ##FIG##0##1A##) is derived from the previously described pTT vector [##REF##11788735##37##]. The signal peptide sequence, cysteine residues involved in intramolecular cystine formation, and the threonine of the consensus sequence for O-glycosylation of human IFNα2b are highlighted (Fig. ##FIG##0##1B##). The calculated molecular weight of the mature core protein (a.a. 24–188) of IFNα2b is 19,269 Da. In order to generate IFNα2b-producing cells, HEK293 were transfected with linearized pYD7-IFNα2b and selected in the presence of blasticidin. The D9 clone, which stably produces IFNα2b was isolated as described in material and methods. The production of IFNα2b with the D9 clone was performed in fed-batch culture. Daily samples from the culture media taken over a period of 9 days were analysed by Coomassie blue-stained gel (Fig. ##FIG##1##2A##). The gel shows that cell-derived contaminating proteins begin to accumulate significantly after day 5. A decline in cell viability was also notable after day 7 (Fig. ##FIG##1##2B##). Fed-batch cultivation was terminated and the culture medium harvested. It is noteworthy that early during production, HEK293-derived IFNα2b migrates with an apparent molecular weight of 2 kDa greater than its predicted mass calculated from the amino acid sequence (19,3 kDa), while at around day 4, a less abundant band of ~19,5 kDa appears. In order to ascertain that this band is also IFNα2b, N-terminal sequencing was performed on both products. The sequences obtained were identical and read NH<sub>2</sub>-C-D-L-P-Q-T, as expected for N-terminal sequence of human IFNα2b having a correctly processed signal peptide, therefore suggesting that heterogeneous posttranslational modifications may account for differences in electrophoretic mobilities of these two IFNα2b species.</p>","<title>Purification of recombinant IFNα2b by cation exchange chromatography and analysis by gel filtration and SDS-PAGE</title>","<p>At the end of the production phase, the IFNα2b is purified as described in the Methods section. The IFNα2b eluted in a single peak at pH 4,5–4,6 from the cation exchange column (Fig. ##FIG##2##3A##). The electrophoretic profiles of proteins contained in the harvest, the acid precipitate, the clarified harvest and eluted fractions, are shown on a Coomassie blue-stained gel (Fig. ##FIG##2##3B##). The acidification step was selective in removing protein contaminants, as the concentration of IFNα2b in the clarified media was greater than 95% of that quantified in the harvest. The absence of IFNα2b in the flow through and in the wash suggests that IFNα2b strongly binds to the SO3<sup>- </sup>column. According to a conservative estimate performed by densitometric analysis of the SDS-PAGE resolved purified material, the purity of IFNα2b exceeds 98% after the SO3<sup>- </sup>column and the final desalting step.</p>","<p>Following desalting in PBS, purified IFNα2b was loaded on a Superdex 75 gel filtration column. The protein eluted as a single peak with elution volume identical to that of ovalbumin, a 44 kDa protein, indicating that purified HEK293-IFNα2b is not aggregated and suggesting that it may form dimers at neutral pH (Fig. ##FIG##3##4A##). A Coomassie blue-stained gel of IFN-containing fractions shows diffuse wide bands as observed with non-purified material (Fig. ##FIG##3##4B##). These species with different electrophoretic mobilities reflect glycosylation heterogeneity, which was later confirmed by mass spectroscopy and glycosylation analysis. Under reducing conditions, purified IFNα2b migrates as a major band of approximately 21 kDa and a less abundant band of lower molecular weight. Mass spectroscopy analysis indicates variations in the molecular weight between 19,922 and 20,659 Da (Fig. ##FIG##5##6B##). Under non-reducing conditions, IFNα2b migrates with an apparent molecular weight of ~17 kDa, a greater electrophoretic mobility typical of the presence of intramolecular disulfide bridges (Fig. ##FIG##3##4C##). The absence of dimers (i.e. ~42 kDa band) in non-reducing conditions indicates that the probable formation of dimers as suggested by gel filtration analysis is independent of intermolecular disulfide bridges. This non-covalent dimeric form of interferon has already been described and involves coordination of a zinc ion by two adjacent glutamic acid residues (E<sub>41 </sub>and E<sub>42</sub>) from each of two IFN molecules [##REF##8994971##38##].</p>","<title>The D9 clone produces hundreds of milligrams of IFNα2b per liter of culture that are efficiently recovered</title>","<p>IFNα2b in the crude harvests of fed-batch cultures was quantified by ELISA. The average concentration from two independent productions is 237 ± 11 mg/L, and this was increased to 301 ± 25 mg/L when glucose and glutamine feeds were added during production (Table ##TAB##0##1##). IFNα2b recovered from the SO3<sup>- </sup>column measured by ELISA correlated well with measures obtained with a Bradford assay and by absorbance at 280 nm using IFNα2b molar extinction coefficient. The concentrations of IFNα2b measured by ELISA in the harvest and in the recovered fraction from the SO3<sup>- </sup>column were used to determine the recovery. The mean concentration of IFNα2b shows that between 70 and 80% of the IFNα2b produced could be recovered, for two independent productions for each condition (Table ##TAB##0##1##). These results were comparable in terms of volumetric productivity and recovery to some productions of non-glycosylated IFNα2b performed in <italic>E. coli </italic>and in the methylotrophic yeast <italic>Pichia pastoris </italic>(Table ##TAB##1##2##).</p>","<title>IFNα2b produced in HEK293 is O-glycosylated, highly sialylated and biologically active</title>","<p>One of the major interests for producing IFNα2b in mammalian cells is to generate a glycosylated active protein. The apparent molecular weight of IFNα2b observed on SDS-PAGE suggests that IFNα2b produced in HEK293 undergoes post-translational modifications. There is also a less abundant product of around 19,5 kDa on SDS-PAGE.</p>","<p>We next determined whether IFNα2b produced in HEK293 is O-glycosylated [##REF##2049076##39##] and sialylated as previously reported for IFNα2b produced by human peripheral blood leucocytes [##REF##9654101##40##]. We performed a sequential digestion of purified IFNα2b with neuraminidase and O-glycosidase to respectively remove sialic acid residues and O-linked saccharides. Each digestion successively increases the electrophoretic mobility of purified IFNα2b to generate a deglycosylated product that migrates as fast as non-glycosylated recombinant IFNα2b produced <italic>E. coli </italic>(Fig. ##FIG##4##5##). This suggests that IFNα2b produced in HEK293 cells is O-glycosylated and sialylated. Note here the quasi absence of the lower ~19,5 kDa product in the lane containing the non-digested IFN. We found that the majority of this product is lost during the purification process, as most of it remains bound to the column (data not shown). A minor band with lower electrophoretic mobility was still visible after glycosidases treatment, suggesting that this species might be Core 2 type glycan.</p>","<p>A detailed mass analysis and glycosylation pattern of the purified IFNα2b was next performed by mass spectroscopy. Electrospray ionization (ESI) mass spectrum exhibiting the glycoform profiles associated with each charge state of purified IFNα2b is shown (Fig. ##FIG##5##6A##). The masses of the principal glycoform of this protein correspond to the mature IFNα2b peptide chain plus the glycans indicated (Fig. ##FIG##5##6B##). The most intense peak at 20 213 Da appears to be composed of the mature peptide chain plus a single core type-1 disialylated glycan (Hex<sub>1</sub>HexNAc<sub>1</sub>SA<sub>2</sub>). A MS/MS analysis of the tryptic glycopeptides confirms the composition of this glycan. The sialylated (mono and disialylated) glycoforms appear to constitute 75% of the total species. This percentage is likely to be underestimated, as some of the other peaks that cannot be assigned easily may be sialylated as well. The disialylated type 1 glycoform represents 50% of the total peak area while the monosialylated glycoform is 10% of the total. Using electron transfer dissociation, we also show that the glycan is linked to the expected threonine residue at position 106 (Fig. ##FIG##6##7##).</p>","<p>Finally, we tested the purified glycosylated IFNα2b produced in HEK293 for <italic>in vitro </italic>biological activity in comparison to non-glycosylated form produced in <italic>E. coli</italic>. Using a reporter gene assay we show that HEK-produced IFNα2b is biologically active as it induces the production of a secreted alkaline phosphatase (SEAP) reporter enzyme under the control of the human ISG56 promoter (Fig. ##FIG##7##8##). This assay shows that HEK-produced IFNα2b is as active <italic>in vitro </italic>as bacterially produced IFNα2b. In addition, viral challenges using Vesicular stomatitis virus (VSV) on Madin-Darby Bovine Kidney (MDBK) cells or using Encephalomyocarditis virus (EMCV) on human A549 cells demonstrated very good antiviral activity of purified IFNα2b with titres ranging from 4.1 to 12.2 × 10<sup>8 </sup>IU/mg for two independent batches (Table ##TAB##2##3##).</p>"],"string":"[\n \"<title>Results</title>\",\n \"<title>Generation of a stable IFNα2b-expressing HEK293 cell clone and production in fed-batch cultures</title>\",\n \"<p>The expression plasmid pYD7 encoding the human IFNα2b gene codon-optimized for expression in human cells (Fig. ##FIG##0##1A##) is derived from the previously described pTT vector [##REF##11788735##37##]. The signal peptide sequence, cysteine residues involved in intramolecular cystine formation, and the threonine of the consensus sequence for O-glycosylation of human IFNα2b are highlighted (Fig. ##FIG##0##1B##). The calculated molecular weight of the mature core protein (a.a. 24–188) of IFNα2b is 19,269 Da. In order to generate IFNα2b-producing cells, HEK293 were transfected with linearized pYD7-IFNα2b and selected in the presence of blasticidin. The D9 clone, which stably produces IFNα2b was isolated as described in material and methods. The production of IFNα2b with the D9 clone was performed in fed-batch culture. Daily samples from the culture media taken over a period of 9 days were analysed by Coomassie blue-stained gel (Fig. ##FIG##1##2A##). The gel shows that cell-derived contaminating proteins begin to accumulate significantly after day 5. A decline in cell viability was also notable after day 7 (Fig. ##FIG##1##2B##). Fed-batch cultivation was terminated and the culture medium harvested. It is noteworthy that early during production, HEK293-derived IFNα2b migrates with an apparent molecular weight of 2 kDa greater than its predicted mass calculated from the amino acid sequence (19,3 kDa), while at around day 4, a less abundant band of ~19,5 kDa appears. In order to ascertain that this band is also IFNα2b, N-terminal sequencing was performed on both products. The sequences obtained were identical and read NH<sub>2</sub>-C-D-L-P-Q-T, as expected for N-terminal sequence of human IFNα2b having a correctly processed signal peptide, therefore suggesting that heterogeneous posttranslational modifications may account for differences in electrophoretic mobilities of these two IFNα2b species.</p>\",\n \"<title>Purification of recombinant IFNα2b by cation exchange chromatography and analysis by gel filtration and SDS-PAGE</title>\",\n \"<p>At the end of the production phase, the IFNα2b is purified as described in the Methods section. The IFNα2b eluted in a single peak at pH 4,5–4,6 from the cation exchange column (Fig. ##FIG##2##3A##). The electrophoretic profiles of proteins contained in the harvest, the acid precipitate, the clarified harvest and eluted fractions, are shown on a Coomassie blue-stained gel (Fig. ##FIG##2##3B##). The acidification step was selective in removing protein contaminants, as the concentration of IFNα2b in the clarified media was greater than 95% of that quantified in the harvest. The absence of IFNα2b in the flow through and in the wash suggests that IFNα2b strongly binds to the SO3<sup>- </sup>column. According to a conservative estimate performed by densitometric analysis of the SDS-PAGE resolved purified material, the purity of IFNα2b exceeds 98% after the SO3<sup>- </sup>column and the final desalting step.</p>\",\n \"<p>Following desalting in PBS, purified IFNα2b was loaded on a Superdex 75 gel filtration column. The protein eluted as a single peak with elution volume identical to that of ovalbumin, a 44 kDa protein, indicating that purified HEK293-IFNα2b is not aggregated and suggesting that it may form dimers at neutral pH (Fig. ##FIG##3##4A##). A Coomassie blue-stained gel of IFN-containing fractions shows diffuse wide bands as observed with non-purified material (Fig. ##FIG##3##4B##). These species with different electrophoretic mobilities reflect glycosylation heterogeneity, which was later confirmed by mass spectroscopy and glycosylation analysis. Under reducing conditions, purified IFNα2b migrates as a major band of approximately 21 kDa and a less abundant band of lower molecular weight. Mass spectroscopy analysis indicates variations in the molecular weight between 19,922 and 20,659 Da (Fig. ##FIG##5##6B##). Under non-reducing conditions, IFNα2b migrates with an apparent molecular weight of ~17 kDa, a greater electrophoretic mobility typical of the presence of intramolecular disulfide bridges (Fig. ##FIG##3##4C##). The absence of dimers (i.e. ~42 kDa band) in non-reducing conditions indicates that the probable formation of dimers as suggested by gel filtration analysis is independent of intermolecular disulfide bridges. This non-covalent dimeric form of interferon has already been described and involves coordination of a zinc ion by two adjacent glutamic acid residues (E<sub>41 </sub>and E<sub>42</sub>) from each of two IFN molecules [##REF##8994971##38##].</p>\",\n \"<title>The D9 clone produces hundreds of milligrams of IFNα2b per liter of culture that are efficiently recovered</title>\",\n \"<p>IFNα2b in the crude harvests of fed-batch cultures was quantified by ELISA. The average concentration from two independent productions is 237 ± 11 mg/L, and this was increased to 301 ± 25 mg/L when glucose and glutamine feeds were added during production (Table ##TAB##0##1##). IFNα2b recovered from the SO3<sup>- </sup>column measured by ELISA correlated well with measures obtained with a Bradford assay and by absorbance at 280 nm using IFNα2b molar extinction coefficient. The concentrations of IFNα2b measured by ELISA in the harvest and in the recovered fraction from the SO3<sup>- </sup>column were used to determine the recovery. The mean concentration of IFNα2b shows that between 70 and 80% of the IFNα2b produced could be recovered, for two independent productions for each condition (Table ##TAB##0##1##). These results were comparable in terms of volumetric productivity and recovery to some productions of non-glycosylated IFNα2b performed in <italic>E. coli </italic>and in the methylotrophic yeast <italic>Pichia pastoris </italic>(Table ##TAB##1##2##).</p>\",\n \"<title>IFNα2b produced in HEK293 is O-glycosylated, highly sialylated and biologically active</title>\",\n \"<p>One of the major interests for producing IFNα2b in mammalian cells is to generate a glycosylated active protein. The apparent molecular weight of IFNα2b observed on SDS-PAGE suggests that IFNα2b produced in HEK293 undergoes post-translational modifications. There is also a less abundant product of around 19,5 kDa on SDS-PAGE.</p>\",\n \"<p>We next determined whether IFNα2b produced in HEK293 is O-glycosylated [##REF##2049076##39##] and sialylated as previously reported for IFNα2b produced by human peripheral blood leucocytes [##REF##9654101##40##]. We performed a sequential digestion of purified IFNα2b with neuraminidase and O-glycosidase to respectively remove sialic acid residues and O-linked saccharides. Each digestion successively increases the electrophoretic mobility of purified IFNα2b to generate a deglycosylated product that migrates as fast as non-glycosylated recombinant IFNα2b produced <italic>E. coli </italic>(Fig. ##FIG##4##5##). This suggests that IFNα2b produced in HEK293 cells is O-glycosylated and sialylated. Note here the quasi absence of the lower ~19,5 kDa product in the lane containing the non-digested IFN. We found that the majority of this product is lost during the purification process, as most of it remains bound to the column (data not shown). A minor band with lower electrophoretic mobility was still visible after glycosidases treatment, suggesting that this species might be Core 2 type glycan.</p>\",\n \"<p>A detailed mass analysis and glycosylation pattern of the purified IFNα2b was next performed by mass spectroscopy. Electrospray ionization (ESI) mass spectrum exhibiting the glycoform profiles associated with each charge state of purified IFNα2b is shown (Fig. ##FIG##5##6A##). The masses of the principal glycoform of this protein correspond to the mature IFNα2b peptide chain plus the glycans indicated (Fig. ##FIG##5##6B##). The most intense peak at 20 213 Da appears to be composed of the mature peptide chain plus a single core type-1 disialylated glycan (Hex<sub>1</sub>HexNAc<sub>1</sub>SA<sub>2</sub>). A MS/MS analysis of the tryptic glycopeptides confirms the composition of this glycan. The sialylated (mono and disialylated) glycoforms appear to constitute 75% of the total species. This percentage is likely to be underestimated, as some of the other peaks that cannot be assigned easily may be sialylated as well. The disialylated type 1 glycoform represents 50% of the total peak area while the monosialylated glycoform is 10% of the total. Using electron transfer dissociation, we also show that the glycan is linked to the expected threonine residue at position 106 (Fig. ##FIG##6##7##).</p>\",\n \"<p>Finally, we tested the purified glycosylated IFNα2b produced in HEK293 for <italic>in vitro </italic>biological activity in comparison to non-glycosylated form produced in <italic>E. coli</italic>. Using a reporter gene assay we show that HEK-produced IFNα2b is biologically active as it induces the production of a secreted alkaline phosphatase (SEAP) reporter enzyme under the control of the human ISG56 promoter (Fig. ##FIG##7##8##). This assay shows that HEK-produced IFNα2b is as active <italic>in vitro </italic>as bacterially produced IFNα2b. In addition, viral challenges using Vesicular stomatitis virus (VSV) on Madin-Darby Bovine Kidney (MDBK) cells or using Encephalomyocarditis virus (EMCV) on human A549 cells demonstrated very good antiviral activity of purified IFNα2b with titres ranging from 4.1 to 12.2 × 10<sup>8 </sup>IU/mg for two independent batches (Table ##TAB##2##3##).</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>We describe here the generation of a HEK293 cell clone (D9) able to stably produce glycosylated human recombinant IFNα2b for culture periods up to 4 months in the absence of selection. The volumetric production per litre of serum-free culture can reach more than 300 mg/L, and is the highest volumetric production of IFNα2b reported for a mammalian system. We have further developed a rapid and reliable method for its efficient recovery and show that HEK-derived IFNα2b is O-glycosylated, sialylated and biologically active.</p>","<p>Gel filtration analysis of purified IFNα2b suggests that it may exist as a dimer in PBS at neutral pH. A zinc-dependent dimeric form of hIFNα2b as already been observed [##REF##8994971##38##] and was also reported for the structurally homologous human IFNβ [##REF##9342320##41##]. It is believed that interferon is biologically active as a monomer and the biological significance of zinc-mediated dimerization is currently unknown. The fact that our IFN is biologically active suggests that at the low concentration used in the bioactivity assays, it may exist in solution as a monomer.</p>","<p>To date, the production of recombinant IFNα2b and other cytokines in mammalian systems, particularly the development of clones stably expressing a cytokine of interest, has not been well exploited due to limitations in the volumetric productivity. One of the possible causes maybe that many cytokines exhibit strong anti-proliferative and cytotoxic activities on diverse cell lines [##REF##16375608##42##,##REF##16979568##43##], therefore strongly selecting against clones that show high cytokine expression levels. The D9 clone nonetheless grew almost as well as parental cells indicating that HEK293 cells can adapt to proliferate in the presence of high levels of IFNα2b. This adaptability of HEK293 cells to a growth inhibitory cytokine suggests that they may be suitable for the large-scale production of other interferons and cytokines.</p>","<p>To our knowledge, no comparable expression system exists in order to contrast the volumetric productivity of our HEK293 clone. However, this clone performs very well compared to other reported eukaryotic expression systems (see table ##TAB##1##2## for an overview of IFNα2b expression systems). Nevertheless, a much greater volumetric production can be obtained from <italic>E. coli </italic>expression systems. Although we believe that the production capacity of HEK293 cells for IFNα2b can be improved, we doubt that such productivity can ever be achieved in mammalian cells, at least for a cytokine. It is obvious however that the difficulty in obtaining high recovery of refolded IFNα2b is still an important challenge with <italic>E. coli</italic>. In general, purifications of recombinant proteins from prokaryotes usually require extraction from inclusion bodies and complex refolding procedures, which reduce recovery yields [##REF##15529165##44##]. Protein refolding is a critical step in the processing of biotherapeutics, as incompletely refolded species lower specific activity and may trigger an immune response. Antibodies to recombinant prokaryotic IFNα2b have been detected in HCV patients with acquired resistance to IFNα2b treatment [##REF##8033418##26##,##REF##16554542##27##], although it is not clear whether denatured IFNα2b played a role in this case.</p>","<p>Because the vast majority of biotherapeutics including growth factors, cytokines and antibodies are secreted proteins, mammalian systems, unlike prokaryotes, allow for production in perfusion as well as for the development of non-denaturing purification procedures. The first and foremost advantage of producing human recombinant proteins in mammalian systems is to generate proteins with the necessary posttranslational modifications required for full biological activity. N-glycosylation in particular, is often required for proper protein folding [##REF##17510649##45##], protein-protein interactions, stability and optimal pharmacokinetics [##REF##17391433##46##]. Although O-glycosylation is less critical for structure and function of proteins, it has been shown for example to increase the serum half-life of IGFBP6 by 2,3 folds over the non-glycosylated protein [##REF##10802531##47##] and to protect against proteolysis [##REF##10951195##48##]. In a recent randomized study, O-glycosylated IFNα2b was shown to have an increased serum half life in comparison to non-glycosylated IFNα2b [##REF##17416111##32##]. We show here that human recombinant IFNα2b produced in HEK293 cells is O-glycosylated and extensively sialylated. Despite heterogeneity in the glycan structures, the nature and distribution of glycan moieties are quite similar to IFNα2b naturally produced by human leukocytes [##REF##9654101##40##]. Approximately 50% of the purified protein is disialylated, while another 10% is monosialylated, in comparison to 50% and 30% respectively for leukocyte-derived IFN. As expected from its biochemical structure, we show that HEK293-produced IFNα2b has a biological activity comparable to that of non-glycosylated <italic>E. coli</italic>-produced IFNα2b by means of an <italic>in vitro </italic>reporter-gene assay, indicating that IFNα2b is not inactivated by the purification process. This was also confirmed by the high specific activity ranging from 4.1 to 12.2 × 10<sup>8 </sup>IU/mg using two different batches of purified IFN and two antiviral assays.</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>We describe here the generation of a HEK293 cell clone (D9) able to stably produce glycosylated human recombinant IFNα2b for culture periods up to 4 months in the absence of selection. The volumetric production per litre of serum-free culture can reach more than 300 mg/L, and is the highest volumetric production of IFNα2b reported for a mammalian system. We have further developed a rapid and reliable method for its efficient recovery and show that HEK-derived IFNα2b is O-glycosylated, sialylated and biologically active.</p>\",\n \"<p>Gel filtration analysis of purified IFNα2b suggests that it may exist as a dimer in PBS at neutral pH. A zinc-dependent dimeric form of hIFNα2b as already been observed [##REF##8994971##38##] and was also reported for the structurally homologous human IFNβ [##REF##9342320##41##]. It is believed that interferon is biologically active as a monomer and the biological significance of zinc-mediated dimerization is currently unknown. The fact that our IFN is biologically active suggests that at the low concentration used in the bioactivity assays, it may exist in solution as a monomer.</p>\",\n \"<p>To date, the production of recombinant IFNα2b and other cytokines in mammalian systems, particularly the development of clones stably expressing a cytokine of interest, has not been well exploited due to limitations in the volumetric productivity. One of the possible causes maybe that many cytokines exhibit strong anti-proliferative and cytotoxic activities on diverse cell lines [##REF##16375608##42##,##REF##16979568##43##], therefore strongly selecting against clones that show high cytokine expression levels. The D9 clone nonetheless grew almost as well as parental cells indicating that HEK293 cells can adapt to proliferate in the presence of high levels of IFNα2b. This adaptability of HEK293 cells to a growth inhibitory cytokine suggests that they may be suitable for the large-scale production of other interferons and cytokines.</p>\",\n \"<p>To our knowledge, no comparable expression system exists in order to contrast the volumetric productivity of our HEK293 clone. However, this clone performs very well compared to other reported eukaryotic expression systems (see table ##TAB##1##2## for an overview of IFNα2b expression systems). Nevertheless, a much greater volumetric production can be obtained from <italic>E. coli </italic>expression systems. Although we believe that the production capacity of HEK293 cells for IFNα2b can be improved, we doubt that such productivity can ever be achieved in mammalian cells, at least for a cytokine. It is obvious however that the difficulty in obtaining high recovery of refolded IFNα2b is still an important challenge with <italic>E. coli</italic>. In general, purifications of recombinant proteins from prokaryotes usually require extraction from inclusion bodies and complex refolding procedures, which reduce recovery yields [##REF##15529165##44##]. Protein refolding is a critical step in the processing of biotherapeutics, as incompletely refolded species lower specific activity and may trigger an immune response. Antibodies to recombinant prokaryotic IFNα2b have been detected in HCV patients with acquired resistance to IFNα2b treatment [##REF##8033418##26##,##REF##16554542##27##], although it is not clear whether denatured IFNα2b played a role in this case.</p>\",\n \"<p>Because the vast majority of biotherapeutics including growth factors, cytokines and antibodies are secreted proteins, mammalian systems, unlike prokaryotes, allow for production in perfusion as well as for the development of non-denaturing purification procedures. The first and foremost advantage of producing human recombinant proteins in mammalian systems is to generate proteins with the necessary posttranslational modifications required for full biological activity. N-glycosylation in particular, is often required for proper protein folding [##REF##17510649##45##], protein-protein interactions, stability and optimal pharmacokinetics [##REF##17391433##46##]. Although O-glycosylation is less critical for structure and function of proteins, it has been shown for example to increase the serum half-life of IGFBP6 by 2,3 folds over the non-glycosylated protein [##REF##10802531##47##] and to protect against proteolysis [##REF##10951195##48##]. In a recent randomized study, O-glycosylated IFNα2b was shown to have an increased serum half life in comparison to non-glycosylated IFNα2b [##REF##17416111##32##]. We show here that human recombinant IFNα2b produced in HEK293 cells is O-glycosylated and extensively sialylated. Despite heterogeneity in the glycan structures, the nature and distribution of glycan moieties are quite similar to IFNα2b naturally produced by human leukocytes [##REF##9654101##40##]. Approximately 50% of the purified protein is disialylated, while another 10% is monosialylated, in comparison to 50% and 30% respectively for leukocyte-derived IFN. As expected from its biochemical structure, we show that HEK293-produced IFNα2b has a biological activity comparable to that of non-glycosylated <italic>E. coli</italic>-produced IFNα2b by means of an <italic>in vitro </italic>reporter-gene assay, indicating that IFNα2b is not inactivated by the purification process. This was also confirmed by the high specific activity ranging from 4.1 to 12.2 × 10<sup>8 </sup>IU/mg using two different batches of purified IFN and two antiviral assays.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>While additional studies are needed to determine whether HEK293-produced IFNα2b can offer advantages over non-glycosylated or pegylated IFN for <italic>in vivo </italic>applications, this work demonstrates that the HEK293 cell line is a suitable host for the high volumetric production of glycosylated human recombinant IFNα2b and potentially other cytokines.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>While additional studies are needed to determine whether HEK293-produced IFNα2b can offer advantages over non-glycosylated or pegylated IFN for <italic>in vivo </italic>applications, this work demonstrates that the HEK293 cell line is a suitable host for the high volumetric production of glycosylated human recombinant IFNα2b and potentially other cytokines.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>Mammalian cells are becoming the prevailing expression system for the production of recombinant proteins because of their capacity for proper protein folding, assembly, and post-translational modifications. These systems currently allow high volumetric production of monoclonal recombinant antibodies in the range of grams per litre. However their use for large-scale expression of cytokines typically results in much lower volumetric productivity.</p>","<title>Results</title>","<p>We have engineered a HEK293 cell clone for high level production of human recombinant glycosylated IFNα2b and developed a rapid and efficient method for its purification. This clone steadily produces more than 200 mg (up to 333 mg) of human recombinant IFNα2b per liter of serum-free culture, which can be purified by a single-step cation-exchange chromatography following media acidification and clarification. This rapid procedure yields 98% pure IFNα2b with a recovery greater than 70%. Purified IFNα2b migrates on SDS-PAGE as two species, a major 21 kDa band and a minor 19 kDa band. N-terminal sequences of both forms are identical and correspond to the expected mature protein. Purified IFNα2b elutes at neutral pH as a single peak with an apparent molecular weight of 44,000 Da as determined by size-exclusion chromatography. The presence of intramolecular and absence of intermolecular disulfide bridges is evidenced by the fact that non-reduced IFNα2b has a greater electrophoretic mobility than the reduced form. Treatment of purified IFNα2b with neuraminidase followed by O-glycosidase both increases electrophoretic mobility, indicating the presence of sialylated O-linked glycan. A detailed analysis of glycosylation by mass spectroscopy identifies disialylated and monosialylated forms as the major constituents of purified IFNα2b. Electron transfer dissociation (ETD) shows that the glycans are linked to the expected threonine at position 106. Other minor glycosylated forms and non-sialylated species are also detected, similar to IFNα2b produced naturally by lymphocytes. Further, the HEK293-produced IFNα2b is biologically active as shown with reporter gene and antiviral assays.</p>","<title>Conclusion</title>","<p>These results show that the HEK293 cell line is an efficient and valuable host for the production of biologically active and glycosylated human IFNα2b.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>Mammalian cells are becoming the prevailing expression system for the production of recombinant proteins because of their capacity for proper protein folding, assembly, and post-translational modifications. These systems currently allow high volumetric production of monoclonal recombinant antibodies in the range of grams per litre. However their use for large-scale expression of cytokines typically results in much lower volumetric productivity.</p>\",\n \"<title>Results</title>\",\n \"<p>We have engineered a HEK293 cell clone for high level production of human recombinant glycosylated IFNα2b and developed a rapid and efficient method for its purification. This clone steadily produces more than 200 mg (up to 333 mg) of human recombinant IFNα2b per liter of serum-free culture, which can be purified by a single-step cation-exchange chromatography following media acidification and clarification. This rapid procedure yields 98% pure IFNα2b with a recovery greater than 70%. Purified IFNα2b migrates on SDS-PAGE as two species, a major 21 kDa band and a minor 19 kDa band. N-terminal sequences of both forms are identical and correspond to the expected mature protein. Purified IFNα2b elutes at neutral pH as a single peak with an apparent molecular weight of 44,000 Da as determined by size-exclusion chromatography. The presence of intramolecular and absence of intermolecular disulfide bridges is evidenced by the fact that non-reduced IFNα2b has a greater electrophoretic mobility than the reduced form. Treatment of purified IFNα2b with neuraminidase followed by O-glycosidase both increases electrophoretic mobility, indicating the presence of sialylated O-linked glycan. A detailed analysis of glycosylation by mass spectroscopy identifies disialylated and monosialylated forms as the major constituents of purified IFNα2b. Electron transfer dissociation (ETD) shows that the glycans are linked to the expected threonine at position 106. Other minor glycosylated forms and non-sialylated species are also detected, similar to IFNα2b produced naturally by lymphocytes. Further, the HEK293-produced IFNα2b is biologically active as shown with reporter gene and antiviral assays.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>These results show that the HEK293 cell line is an efficient and valuable host for the production of biologically active and glycosylated human IFNα2b.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Abbreviations</title>","<p>EBV: Epstein Barr Virus; ESI: electrospray ionization; ETD: electron transfer dissociation; HEK: human embryonic kidney; IFNα2b: interferon alpha2b; PBS: phosphate buffered saline; SEAP: secreted alkaline phosphatase.</p>","<title>Authors' contributions</title>","<p>ML performed production of IFNα2b, determined cell viability and growth curves in fed-batch productions, co-developed the purification method and purified IFNα2b, performed enzymatic deglycosylation, interpreted the data and wrote the manuscript. SP did ELISA assays and characterized the D9 IFN-producing clone. JK contributed the analysis of glycosylation by mass spectroscopy and editing of the manuscript. LB performed batch and fed-batch developments. DB performed the transfection and isolation of the D9 clone. BC co-developed the purification method and performed some batch experiments. FA tested IFNα2b for bioactivity. YD designed experiments, interpreted the data and revised the manuscript.</p>"],"string":"[\n \"<title>Abbreviations</title>\",\n \"<p>EBV: Epstein Barr Virus; ESI: electrospray ionization; ETD: electron transfer dissociation; HEK: human embryonic kidney; IFNα2b: interferon alpha2b; PBS: phosphate buffered saline; SEAP: secreted alkaline phosphatase.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>ML performed production of IFNα2b, determined cell viability and growth curves in fed-batch productions, co-developed the purification method and purified IFNα2b, performed enzymatic deglycosylation, interpreted the data and wrote the manuscript. SP did ELISA assays and characterized the D9 IFN-producing clone. JK contributed the analysis of glycosylation by mass spectroscopy and editing of the manuscript. LB performed batch and fed-batch developments. DB performed the transfection and isolation of the D9 clone. BC co-developed the purification method and performed some batch experiments. FA tested IFNα2b for bioactivity. YD designed experiments, interpreted the data and revised the manuscript.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>We thank France Dumas for N-terminal sequencing of IFNα2b, Alain Drouin, Wen Ding and Luc Tessier for their technical assistance with the mass spectrometry analysis and Phuong Lan Pham for insightful discussion.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>We thank France Dumas for N-terminal sequencing of IFNα2b, Alain Drouin, Wen Ding and Luc Tessier for their technical assistance with the mass spectrometry analysis and Phuong Lan Pham for insightful discussion.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Expression plasmid encoding human IFNα2b cDNA</bold>. <bold>A) </bold>The pYD7-IFNα2b expression plasmid has been used to generate the D9 clone. (Amp) ampicillin, (Blast) blasticidin, (CMV) cytomegalovirus promoter, (enh MLP) adenovirus major late promoter, (IFNα2b) human codon-optimized sequence for human IFNα2b gene, (pA) polyadenylation sequence, (pMB1ori) bacterial origin of replication, (Puro) puromycin, (OriP) Epstein-Barr virus origin of replication, (SV40pA) simian virus 40 polyadenylation sequence, (TPL) adenovirus tripartite leader.<bold>B) </bold>Amino acid sequence of human IFNα2b. Signal peptide is underlined. The two intramolecular disulfide bridges are C<sub>1</sub>-C<sub>98 </sub>and C<sub>29</sub>-C<sub>138</sub>. The glycan-linked threonine (Thr<sub>106</sub>) is underscored.</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Kinetics of cell growth and IFNα2b production from D9 clone in fed-batch culture</bold>. D9 cells were seeded at a cell density of 0,25 × 10<sup>6 </sup>cells per mL, fed with 0,1% TN1 the next day and sampled every day. <bold>A) </bold>Coomassie-stained SDS-PAGE analysis of the culture medium (20 μL) collected daily. <bold>B)</bold> Cell counts and viability were measured at the indicated times.</p></caption></fig>","<fig position=\"float\" id=\"F3\"><label>Figure 3</label><caption><p><bold>Purification of IFNα2b by cation-exchange chromatography</bold>. <bold>A) </bold>A typical chromatographic profile of a purification of HEK293-produced IFNα2b from a 400 mL fed-batch culture is illustrated. Solid line shows the 280 nM absorbance profile. Dotted line shows pH variations. IFNα2b elutes in a single peak between 1000 and 1200 mL. <bold>B) </bold>Coomassie-stained SDS-PAGE analysis of 20 μL samples collected at different steps of production and purification of IFNα2b. <bold>1- </bold>crude harvest. <bold>2- </bold>precipitate (equivalent to 200 μL of harvest volume). <bold>3- </bold>clarified harvest. <bold>4- </bold>flow through SO3<sup>- </sup>column. <bold>5- </bold>wash SO3<sup>- </sup>column. <bold>6- </bold>elution peak SO3<sup>- </sup>column. <bold>7- </bold>desalted IFNα2b in PBS.</p></caption></fig>","<fig position=\"float\" id=\"F4\"><label>Figure 4</label><caption><p><bold>Purified IFNα2b is not aggregated and forms dimers at neutral pH independent of intermolecular cystine formation</bold>. Following a desalting step in neutral PBS, purified IFNα2b was analysed for dimer formation. <bold>A) </bold>Twenty mg of purified IFNα2b were analysed on a Superdex 75 HR16/60 column equilibrated with PBS at pH 7,0. The arrows and numbers above indicate the elution volumes of molecular weight standards eluted in the same conditions. Purified IFNα2b elutes in the same volume as ovalbumin, a 44 kDa globular protein. <bold>B) </bold>Coomassie-stained SDS-PAGE analysis of samples (20 μL) of each of the 10 fractions (4 mL) collected between elution volumes 40–80 mL. <bold>C) </bold>Coomassie-stained SDS-PAGE analysis of reduced and non-reduced IFNα2b from HEK293 cells.</p></caption></fig>","<fig position=\"float\" id=\"F5\"><label>Figure 5</label><caption><p><bold>HEK293-produced human IFNα2b is sialylated and O-glycosylated</bold>. IFNα2b was deglycosylated as described in material and methods. <bold>1- </bold>10 μg of purified HEK-produced IFNα2b. <bold>2- </bold>10 μg of purified HEK-produced IFNα2b digested with neuraminidase. <bold>3- </bold>10 μg of purified HEK-produced IFNα2b digested with O-glycosidase. <bold>4- </bold>10 μg of purified <italic>E. coli</italic>-produced IFNα2b.</p></caption></fig>","<fig position=\"float\" id=\"F6\"><label>Figure 6</label><caption><p><bold>ESI-MS analysis of the intact IFNα2b glycoprotein</bold>. <bold>A) </bold>ESI mass spectrum exhibiting the glycoform profiles associated with each charge state of the protein and <bold>B) </bold>the glycoprotein molecule weight profile reconstructed from the mass spectrum in panel A. The most intense peak at 20,213 Da appears to be composed of the mature peptide chain plus a single core type-1 disialylated glycan (Hex<sub>1</sub>HexNAc<sub>1</sub>SA<sub>2</sub>).</p></caption></fig>","<fig position=\"float\" id=\"F7\"><label>Figure 7</label><caption><p><bold>CID and ETD analysis of the tryptic glycopeptides from IFNα2b</bold>. <bold>A) </bold>CID-MS/MS spectrum of the triply protonated ion at m/z 1426.8 corresponding to the disialylated glycopeptide of T84-112. The spectrum is dominated by the sequential neutral loss of the glycan components from the doubly protonated glycopeptide ion. The principal b and y fragment ions arising from fragmentation of the peptide backbone are indicated in the spectrum as are the compositions the glycan oxonium ions observed m/z 494.9, 657.0 and 948.0, respectively. The sequence of the peptide is provided in the inset. <bold>B) </bold>CID-MS/MS spectrum of the triply protonated ion at m/z 1340.8 corresponding to the monosialylated glycopeptide of T84-112. Note that the neutral loss corresponding to a second sialic acid is missing from this spectrum as is the corresponding oxonium ion at m/z 948.0. <bold>C) </bold>ETD MS/MS spectrum of the triply protonated, monosialylated T84-112 glycopeptide at m/z 1340.8. The higher m/z region of the ETD spectrum contained the most informative fragment ions and is presented here. The c ion series indicated in the spectrum clearly identified the site of O-linkage as Threonine 106 of the mature protein.</p></caption></fig>","<fig position=\"float\" id=\"F8\"><label>Figure 8</label><caption><p><bold>HEK293-produced human IFNα2b is biologically active</bold>. The biological activity of HEK293-produced human IFNα2b was assayed with a gene reporter assay and compared to <italic>E. coli</italic>-produced human recombinant IFNα2b as described in material and methods. The activity of the secreted alkaline phosphatase is plotted against the concentration of IFNα2b produced in the two hosts. Each point represents the average ± SEM of 3 experiments performed in triplicate.</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p><bold>Expression plasmid encoding human IFNα2b cDNA</bold>. <bold>A) </bold>The pYD7-IFNα2b expression plasmid has been used to generate the D9 clone. (Amp) ampicillin, (Blast) blasticidin, (CMV) cytomegalovirus promoter, (enh MLP) adenovirus major late promoter, (IFNα2b) human codon-optimized sequence for human IFNα2b gene, (pA) polyadenylation sequence, (pMB1ori) bacterial origin of replication, (Puro) puromycin, (OriP) Epstein-Barr virus origin of replication, (SV40pA) simian virus 40 polyadenylation sequence, (TPL) adenovirus tripartite leader.<bold>B) </bold>Amino acid sequence of human IFNα2b. Signal peptide is underlined. The two intramolecular disulfide bridges are C<sub>1</sub>-C<sub>98 </sub>and C<sub>29</sub>-C<sub>138</sub>. The glycan-linked threonine (Thr<sub>106</sub>) is underscored.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p><bold>Kinetics of cell growth and IFNα2b production from D9 clone in fed-batch culture</bold>. D9 cells were seeded at a cell density of 0,25 × 10<sup>6 </sup>cells per mL, fed with 0,1% TN1 the next day and sampled every day. <bold>A) </bold>Coomassie-stained SDS-PAGE analysis of the culture medium (20 μL) collected daily. <bold>B)</bold> Cell counts and viability were measured at the indicated times.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F3\\\"><label>Figure 3</label><caption><p><bold>Purification of IFNα2b by cation-exchange chromatography</bold>. <bold>A) </bold>A typical chromatographic profile of a purification of HEK293-produced IFNα2b from a 400 mL fed-batch culture is illustrated. Solid line shows the 280 nM absorbance profile. Dotted line shows pH variations. IFNα2b elutes in a single peak between 1000 and 1200 mL. <bold>B) </bold>Coomassie-stained SDS-PAGE analysis of 20 μL samples collected at different steps of production and purification of IFNα2b. <bold>1- </bold>crude harvest. <bold>2- </bold>precipitate (equivalent to 200 μL of harvest volume). <bold>3- </bold>clarified harvest. <bold>4- </bold>flow through SO3<sup>- </sup>column. <bold>5- </bold>wash SO3<sup>- </sup>column. <bold>6- </bold>elution peak SO3<sup>- </sup>column. <bold>7- </bold>desalted IFNα2b in PBS.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F4\\\"><label>Figure 4</label><caption><p><bold>Purified IFNα2b is not aggregated and forms dimers at neutral pH independent of intermolecular cystine formation</bold>. Following a desalting step in neutral PBS, purified IFNα2b was analysed for dimer formation. <bold>A) </bold>Twenty mg of purified IFNα2b were analysed on a Superdex 75 HR16/60 column equilibrated with PBS at pH 7,0. The arrows and numbers above indicate the elution volumes of molecular weight standards eluted in the same conditions. Purified IFNα2b elutes in the same volume as ovalbumin, a 44 kDa globular protein. <bold>B) </bold>Coomassie-stained SDS-PAGE analysis of samples (20 μL) of each of the 10 fractions (4 mL) collected between elution volumes 40–80 mL. <bold>C) </bold>Coomassie-stained SDS-PAGE analysis of reduced and non-reduced IFNα2b from HEK293 cells.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F5\\\"><label>Figure 5</label><caption><p><bold>HEK293-produced human IFNα2b is sialylated and O-glycosylated</bold>. IFNα2b was deglycosylated as described in material and methods. <bold>1- </bold>10 μg of purified HEK-produced IFNα2b. <bold>2- </bold>10 μg of purified HEK-produced IFNα2b digested with neuraminidase. <bold>3- </bold>10 μg of purified HEK-produced IFNα2b digested with O-glycosidase. <bold>4- </bold>10 μg of purified <italic>E. coli</italic>-produced IFNα2b.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F6\\\"><label>Figure 6</label><caption><p><bold>ESI-MS analysis of the intact IFNα2b glycoprotein</bold>. <bold>A) </bold>ESI mass spectrum exhibiting the glycoform profiles associated with each charge state of the protein and <bold>B) </bold>the glycoprotein molecule weight profile reconstructed from the mass spectrum in panel A. The most intense peak at 20,213 Da appears to be composed of the mature peptide chain plus a single core type-1 disialylated glycan (Hex<sub>1</sub>HexNAc<sub>1</sub>SA<sub>2</sub>).</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F7\\\"><label>Figure 7</label><caption><p><bold>CID and ETD analysis of the tryptic glycopeptides from IFNα2b</bold>. <bold>A) </bold>CID-MS/MS spectrum of the triply protonated ion at m/z 1426.8 corresponding to the disialylated glycopeptide of T84-112. The spectrum is dominated by the sequential neutral loss of the glycan components from the doubly protonated glycopeptide ion. The principal b and y fragment ions arising from fragmentation of the peptide backbone are indicated in the spectrum as are the compositions the glycan oxonium ions observed m/z 494.9, 657.0 and 948.0, respectively. The sequence of the peptide is provided in the inset. <bold>B) </bold>CID-MS/MS spectrum of the triply protonated ion at m/z 1340.8 corresponding to the monosialylated glycopeptide of T84-112. Note that the neutral loss corresponding to a second sialic acid is missing from this spectrum as is the corresponding oxonium ion at m/z 948.0. <bold>C) </bold>ETD MS/MS spectrum of the triply protonated, monosialylated T84-112 glycopeptide at m/z 1340.8. The higher m/z region of the ETD spectrum contained the most informative fragment ions and is presented here. The c ion series indicated in the spectrum clearly identified the site of O-linkage as Threonine 106 of the mature protein.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F8\\\"><label>Figure 8</label><caption><p><bold>HEK293-produced human IFNα2b is biologically active</bold>. The biological activity of HEK293-produced human IFNα2b was assayed with a gene reporter assay and compared to <italic>E. coli</italic>-produced human recombinant IFNα2b as described in material and methods. The activity of the secreted alkaline phosphatase is plotted against the concentration of IFNα2b produced in the two hosts. Each point represents the average ± SEM of 3 experiments performed in triplicate.</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Quantification and recovery of HEK293-produced IFNα2b from two production schemes.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\"><bold>Production scheme</bold></td><td align=\"center\" colspan=\"2\"><bold>IFNα2b mg/L (ELISA)</bold></td><td align=\"center\"><bold>Percent recovery</bold></td></tr><tr><td/><td colspan=\"2\"><hr/></td><td/></tr><tr><td/><td align=\"center\"><bold>Culture medium</bold></td><td align=\"center\"><bold>SO3</bold><sup>-</sup><bold>column</bold></td><td/></tr></thead><tbody><tr><td align=\"center\"><bold>1 feed</bold></td><td align=\"center\">237 ± 11</td><td align=\"center\">185 ± 3</td><td align=\"center\">79.5</td></tr><tr><td align=\"center\"><bold>2 feeds</bold></td><td align=\"center\">301 ± 25</td><td align=\"center\">216 ± 11</td><td align=\"center\">71.8</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T2\"><label>Table 2</label><caption><p>Overview of human recombinant IFNα2b production in prokaryotic and eukaryotic systems.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\"><bold>Host</bold></td><td align=\"center\"><bold>mg/L</bold></td><td align=\"center\" colspan=\"2\"><bold>Recovery</bold></td><td align=\"center\"><bold>Purity %</bold></td><td align=\"center\"><bold>Glycosylation</bold></td><td align=\"center\"><bold>Activity IU/mg*</bold></td><td align=\"center\"><bold>Ref.</bold></td></tr><tr><td/><td/><td colspan=\"2\"><hr/></td><td/><td/><td/><td/></tr><tr><td/><td/><td align=\"center\"><bold>mg/L</bold></td><td align=\"center\"><bold>%</bold></td><td/><td/><td/><td/></tr></thead><tbody><tr><td align=\"center\"><bold>Prokaryotic</bold></td><td/><td/><td/><td/><td/><td/><td/></tr><tr><td colspan=\"8\"><hr/></td></tr><tr><td align=\"center\"><bold><italic>E. coli</italic></bold></td><td align=\"center\">5200</td><td align=\"center\">3000</td><td align=\"center\">58</td><td align=\"center\">ND</td><td align=\"center\">No</td><td align=\"center\">3 × 10<sup>9</sup></td><td align=\"center\">[##REF##15866717##21##]</td></tr><tr><td align=\"center\"><bold><italic>E. coli</italic></bold></td><td align=\"center\">4000</td><td align=\"center\">300</td><td align=\"center\">7,5</td><td align=\"center\">ND</td><td align=\"center\">No</td><td align=\"center\">2,5 × 10<sup>8</sup></td><td align=\"center\">[##REF##10919322##19##]</td></tr><tr><td align=\"center\"><bold><italic>E. coli</italic></bold></td><td align=\"center\">3500</td><td align=\"center\">600</td><td align=\"center\">12</td><td align=\"center\">100</td><td align=\"center\">No</td><td align=\"center\">ND</td><td align=\"center\">[##REF##11389671##20##]</td></tr><tr><td align=\"center\"><bold><italic>S. lividans</italic></bold></td><td align=\"center\">0,01</td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">No</td><td align=\"center\">0,4 × 10<sup>4</sup></td><td align=\"center\">[##REF##11876412##55##]</td></tr><tr><td colspan=\"8\"><hr/></td></tr><tr><td align=\"center\"><bold>Eukaryotic</bold></td><td/><td/><td/><td/><td/><td/><td/></tr><tr><td colspan=\"8\"><hr/></td></tr><tr><td align=\"center\"><bold><italic>Pichia pastoris</italic></bold></td><td align=\"center\">450</td><td align=\"center\">298</td><td align=\"center\">66,2</td><td align=\"center\">> 95</td><td align=\"center\">ND</td><td align=\"center\">1,9 × 10<sup>9</sup></td><td align=\"center\">[##REF##17468009##56##]</td></tr><tr><td align=\"center\"><bold><italic>Pichia pastoris</italic></bold></td><td align=\"center\">200</td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">No</td><td align=\"center\">3.0 × 10<sup>8</sup></td><td align=\"center\">[##REF##18482845##57##]</td></tr><tr><td align=\"center\"><bold>Tobacco BY2 cells</bold></td><td align=\"center\">0.02</td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">No</td><td align=\"center\">ND</td><td align=\"center\">[##REF##17328066##58##]</td></tr><tr><td align=\"center\"><bold>Insect Sf9 cells</bold></td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">Partial (no sialylation)</td><td align=\"center\">2,3 × 10<sup>8</sup></td><td align=\"center\">[##REF##8223649##34##]</td></tr><tr><td align=\"center\"><bold>Mouse NS0 cells</bold></td><td align=\"center\">120</td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">ND</td><td align=\"center\">Yes</td><td align=\"center\">2 × 10<sup>8</sup></td><td align=\"center\">[##REF##8776749##36##]</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T3\"><label>Table 3</label><caption><p>Assessment of biological activity of HEK293-produced IFNα2b using two antiviral assays</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\"><bold>Antiviral assay</bold></td><td align=\"center\" colspan=\"4\"><bold>IFNα2b activity (U/mg)</bold></td></tr><tr><td/><td colspan=\"4\"><hr/></td></tr><tr><td/><td align=\"center\"><bold>HEK293 (1 feed)</bold></td><td align=\"center\"><bold><italic>E. coli</italic></bold></td><td align=\"center\"><bold>HEK293 (2 feeds)</bold></td><td align=\"center\"><bold><italic>E. coli</italic></bold></td></tr></thead><tbody><tr><td align=\"center\"><bold>MDBK/VSV</bold></td><td align=\"center\">4.1 × 10<sup>8</sup></td><td align=\"center\">3.1 × 10<sup>8</sup></td><td align=\"center\">12.2 × 10<sup>8</sup></td><td align=\"center\">4.0 × 10<sup>8</sup></td></tr><tr><td align=\"center\"><bold>A549/EMCV</bold></td><td align=\"center\">6.0 × 10<sup>8</sup></td><td align=\"center\">3.9 × 10<sup>8</sup></td><td align=\"center\">7.2 × 10<sup>8</sup></td><td align=\"center\">8.1 × 10<sup>8</sup></td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Quantification and recovery of HEK293-produced IFNα2b from two production schemes.</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"center\\\"><bold>Production scheme</bold></td><td align=\\\"center\\\" colspan=\\\"2\\\"><bold>IFNα2b mg/L (ELISA)</bold></td><td align=\\\"center\\\"><bold>Percent recovery</bold></td></tr><tr><td/><td colspan=\\\"2\\\"><hr/></td><td/></tr><tr><td/><td align=\\\"center\\\"><bold>Culture medium</bold></td><td align=\\\"center\\\"><bold>SO3</bold><sup>-</sup><bold>column</bold></td><td/></tr></thead><tbody><tr><td align=\\\"center\\\"><bold>1 feed</bold></td><td align=\\\"center\\\">237 ± 11</td><td align=\\\"center\\\">185 ± 3</td><td align=\\\"center\\\">79.5</td></tr><tr><td align=\\\"center\\\"><bold>2 feeds</bold></td><td align=\\\"center\\\">301 ± 25</td><td align=\\\"center\\\">216 ± 11</td><td align=\\\"center\\\">71.8</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T2\\\"><label>Table 2</label><caption><p>Overview of human recombinant IFNα2b production in prokaryotic and eukaryotic systems.</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"center\\\"><bold>Host</bold></td><td align=\\\"center\\\"><bold>mg/L</bold></td><td align=\\\"center\\\" colspan=\\\"2\\\"><bold>Recovery</bold></td><td align=\\\"center\\\"><bold>Purity %</bold></td><td align=\\\"center\\\"><bold>Glycosylation</bold></td><td align=\\\"center\\\"><bold>Activity IU/mg*</bold></td><td align=\\\"center\\\"><bold>Ref.</bold></td></tr><tr><td/><td/><td colspan=\\\"2\\\"><hr/></td><td/><td/><td/><td/></tr><tr><td/><td/><td align=\\\"center\\\"><bold>mg/L</bold></td><td align=\\\"center\\\"><bold>%</bold></td><td/><td/><td/><td/></tr></thead><tbody><tr><td align=\\\"center\\\"><bold>Prokaryotic</bold></td><td/><td/><td/><td/><td/><td/><td/></tr><tr><td colspan=\\\"8\\\"><hr/></td></tr><tr><td align=\\\"center\\\"><bold><italic>E. coli</italic></bold></td><td align=\\\"center\\\">5200</td><td align=\\\"center\\\">3000</td><td align=\\\"center\\\">58</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">No</td><td align=\\\"center\\\">3 × 10<sup>9</sup></td><td align=\\\"center\\\">[##REF##15866717##21##]</td></tr><tr><td align=\\\"center\\\"><bold><italic>E. coli</italic></bold></td><td align=\\\"center\\\">4000</td><td align=\\\"center\\\">300</td><td align=\\\"center\\\">7,5</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">No</td><td align=\\\"center\\\">2,5 × 10<sup>8</sup></td><td align=\\\"center\\\">[##REF##10919322##19##]</td></tr><tr><td align=\\\"center\\\"><bold><italic>E. coli</italic></bold></td><td align=\\\"center\\\">3500</td><td align=\\\"center\\\">600</td><td align=\\\"center\\\">12</td><td align=\\\"center\\\">100</td><td align=\\\"center\\\">No</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">[##REF##11389671##20##]</td></tr><tr><td align=\\\"center\\\"><bold><italic>S. lividans</italic></bold></td><td align=\\\"center\\\">0,01</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">No</td><td align=\\\"center\\\">0,4 × 10<sup>4</sup></td><td align=\\\"center\\\">[##REF##11876412##55##]</td></tr><tr><td colspan=\\\"8\\\"><hr/></td></tr><tr><td align=\\\"center\\\"><bold>Eukaryotic</bold></td><td/><td/><td/><td/><td/><td/><td/></tr><tr><td colspan=\\\"8\\\"><hr/></td></tr><tr><td align=\\\"center\\\"><bold><italic>Pichia pastoris</italic></bold></td><td align=\\\"center\\\">450</td><td align=\\\"center\\\">298</td><td align=\\\"center\\\">66,2</td><td align=\\\"center\\\">> 95</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">1,9 × 10<sup>9</sup></td><td align=\\\"center\\\">[##REF##17468009##56##]</td></tr><tr><td align=\\\"center\\\"><bold><italic>Pichia pastoris</italic></bold></td><td align=\\\"center\\\">200</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">No</td><td align=\\\"center\\\">3.0 × 10<sup>8</sup></td><td align=\\\"center\\\">[##REF##18482845##57##]</td></tr><tr><td align=\\\"center\\\"><bold>Tobacco BY2 cells</bold></td><td align=\\\"center\\\">0.02</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">No</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">[##REF##17328066##58##]</td></tr><tr><td align=\\\"center\\\"><bold>Insect Sf9 cells</bold></td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">Partial (no sialylation)</td><td align=\\\"center\\\">2,3 × 10<sup>8</sup></td><td align=\\\"center\\\">[##REF##8223649##34##]</td></tr><tr><td align=\\\"center\\\"><bold>Mouse NS0 cells</bold></td><td align=\\\"center\\\">120</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">ND</td><td align=\\\"center\\\">Yes</td><td align=\\\"center\\\">2 × 10<sup>8</sup></td><td align=\\\"center\\\">[##REF##8776749##36##]</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T3\\\"><label>Table 3</label><caption><p>Assessment of biological activity of HEK293-produced IFNα2b using two antiviral assays</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"center\\\"><bold>Antiviral assay</bold></td><td align=\\\"center\\\" colspan=\\\"4\\\"><bold>IFNα2b activity (U/mg)</bold></td></tr><tr><td/><td colspan=\\\"4\\\"><hr/></td></tr><tr><td/><td align=\\\"center\\\"><bold>HEK293 (1 feed)</bold></td><td align=\\\"center\\\"><bold><italic>E. coli</italic></bold></td><td align=\\\"center\\\"><bold>HEK293 (2 feeds)</bold></td><td align=\\\"center\\\"><bold><italic>E. coli</italic></bold></td></tr></thead><tbody><tr><td align=\\\"center\\\"><bold>MDBK/VSV</bold></td><td align=\\\"center\\\">4.1 × 10<sup>8</sup></td><td align=\\\"center\\\">3.1 × 10<sup>8</sup></td><td align=\\\"center\\\">12.2 × 10<sup>8</sup></td><td align=\\\"center\\\">4.0 × 10<sup>8</sup></td></tr><tr><td align=\\\"center\\\"><bold>A549/EMCV</bold></td><td align=\\\"center\\\">6.0 × 10<sup>8</sup></td><td align=\\\"center\\\">3.9 × 10<sup>8</sup></td><td align=\\\"center\\\">7.2 × 10<sup>8</sup></td><td align=\\\"center\\\">8.1 × 10<sup>8</sup></td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":["<table-wrap-foot><p>* IFNα2b activity has been determined by inhibition of viral replication. Different viruses and hosts were used.</p></table-wrap-foot>","<table-wrap-foot><p>IFNα2b activity has been determined by inhibition of viral replication of vesicular stomatitis virus (VSV) in Madin Darby bovine kidney cells (MDBK) and of encephalomyocarditis virus (ECMV) in the lung carcinoma cell line A-549. Both antiviral assays were carried out by PBL InterferonSource. In each assay performed independently, <italic>E. coli </italic>IFNα2b was used as a positive control.</p></table-wrap-foot>"],"string":"[\n \"<table-wrap-foot><p>* IFNα2b activity has been determined by inhibition of viral replication. Different viruses and hosts were used.</p></table-wrap-foot>\",\n \"<table-wrap-foot><p>IFNα2b activity has been determined by inhibition of viral replication of vesicular stomatitis virus (VSV) in Madin Darby bovine kidney cells (MDBK) and of encephalomyocarditis virus (ECMV) in the lung carcinoma cell line A-549. Both antiviral assays were carried out by PBL InterferonSource. In each assay performed independently, <italic>E. coli </italic>IFNα2b was used as a positive control.</p></table-wrap-foot>\"\n]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1472-6750-8-65-1\"/>","<graphic xlink:href=\"1472-6750-8-65-2\"/>","<graphic xlink:href=\"1472-6750-8-65-3\"/>","<graphic xlink:href=\"1472-6750-8-65-4\"/>","<graphic xlink:href=\"1472-6750-8-65-5\"/>","<graphic xlink:href=\"1472-6750-8-65-6\"/>","<graphic xlink:href=\"1472-6750-8-65-7\"/>","<graphic xlink:href=\"1472-6750-8-65-8\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1472-6750-8-65-1\\\"/>\",\n \"<graphic xlink:href=\\\"1472-6750-8-65-2\\\"/>\",\n \"<graphic xlink:href=\\\"1472-6750-8-65-3\\\"/>\",\n \"<graphic xlink:href=\\\"1472-6750-8-65-4\\\"/>\",\n \"<graphic xlink:href=\\\"1472-6750-8-65-5\\\"/>\",\n \"<graphic xlink:href=\\\"1472-6750-8-65-6\\\"/>\",\n \"<graphic xlink:href=\\\"1472-6750-8-65-7\\\"/>\",\n \"<graphic xlink:href=\\\"1472-6750-8-65-8\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":58,"string":"58"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:38"},"citation":{"kind":"string","value":"BMC Biotechnol. 2008 Aug 27; 8:65"},"package_file":{"kind":"string","value":"oa_package/a8/a0/PMC2538527.tar.gz"}}},{"rowIdx":119692,"cells":{"accession_id":{"kind":"string","value":"PMC2538528"},"pmid":{"kind":"string","value":"18691430"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>Integration of foreign DNA plays a pivotal role in genetic engineering, animal transgenesis, and therapeutic gene transfer. Lentiviral vectors (LV) efficiently insert genetic cargo in both dividing and non-dividing cells and have attracted, therefore, major attention as a gene transfer tool. During lentiviral transduction, linear vector DNA is associated with viral and cellular proteins in the preintegration complex (PIC) which is transported across the nuclear membrane and facilitates tethering of viral genomic DNA to chromatin. As part of the PIC, cellular LEDGF/p75 is thought to anchor viral DNA on chromatin, allowing the viral integrase to insert viral DNA in a fashion that supposedly favors integration in actively transcribed genes [##REF##16959972##1##, ####REF##12202041##2##, ##REF##18092005##3####18092005##3##]. Great interest is attracted to ways of altering the lentiviral integration profile, allowing gene insertion in predetermined and safe vector landing sites. It remains unknown, however, whether lentiviral integration can be directed by alternative integration machineries, despite the integrity of the PIC and the exquisite involvement of cellular factors in nuclear entry and chromatin association.</p>","<p>During lentivirus infection circular forms of the viral genomic DNA are generated by either non-homologous end joining (NHEJ) of the full-length linear viral DNA (creating 2-LTR circles) [##REF##11406603##4##], or by homologous recombination between the two LTRs of the episomal viral DNA (creating 1-LTR circles) [##REF##1834863##5##]. Such episomal DNA circles have traditionally been considered dead-end products of reverse transcription [##REF##1834863##5##] and are eventually lost together with episomal linear vector forms as a result of host cell division. However, integration-defective lentiviral (IDLV) vectors carrying an inactive integrase protein that abolish the normal viral integration pathway have recently emerged as novel efficient gene carriers, facilitating high levels of transient expression from linear and circular DNA forms [##REF##17700544##6##, ####REF##16556511##7##, ##REF##16491086##8##, ##REF##15053861##9####15053861##9##]. Increased persistence of transgene expression in dividing cells has been demonstrated by allowing circles harboring the simian virus 40 (SV40) origin of replication to replicate episomally in cells containing the SV40 large T antigen [##REF##15053861##9##]. Moreover, non-integrating lentiviral vectors have been shown to facilitate stable <italic>in vivo </italic>therapeutic levels of transgene expression in non-dividing neuronal cells [##REF##16491086##8##] and muscle [##REF##17700544##6##]. Recently, the episomal nature of the integration-defective vectors was further exploited as a template source for high-efficient gene correction by homologous recombination in human cell lines and in human embryonic stem cells [##REF##17998901##10##,##REF##17965707##11##].</p>","<p>High stability and accessibility of DNA circles by cellular proteins have led us to suggest that stable circular DNA intermediates can be engineered to act as putative substrates for gene insertion by nonviral gene-inserting proteins. We test this hypothesis here by using a model system based on the actions of the site-directed Flp recombinase and demonstrate for the first time that LV-derived DNA circles can serve as a substrate for gene insertion facilitated by exogenous nonviral recombinases. Our findings provide evidence that <italic>trans</italic>-acting integrases are able to gain access to and insert transduced lentiviral DNA with possible application in (i) viral vector manipulation for improved viral gene transfer and (ii) Flp-based cell engineering methods focusing on hard-to-transfect cells and/or creation of site-directed gene insertions that do not contain bacterial remnants of plasmid DNA.</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>Integration of foreign DNA plays a pivotal role in genetic engineering, animal transgenesis, and therapeutic gene transfer. Lentiviral vectors (LV) efficiently insert genetic cargo in both dividing and non-dividing cells and have attracted, therefore, major attention as a gene transfer tool. During lentiviral transduction, linear vector DNA is associated with viral and cellular proteins in the preintegration complex (PIC) which is transported across the nuclear membrane and facilitates tethering of viral genomic DNA to chromatin. As part of the PIC, cellular LEDGF/p75 is thought to anchor viral DNA on chromatin, allowing the viral integrase to insert viral DNA in a fashion that supposedly favors integration in actively transcribed genes [##REF##16959972##1##, ####REF##12202041##2##, ##REF##18092005##3####18092005##3##]. Great interest is attracted to ways of altering the lentiviral integration profile, allowing gene insertion in predetermined and safe vector landing sites. It remains unknown, however, whether lentiviral integration can be directed by alternative integration machineries, despite the integrity of the PIC and the exquisite involvement of cellular factors in nuclear entry and chromatin association.</p>\",\n \"<p>During lentivirus infection circular forms of the viral genomic DNA are generated by either non-homologous end joining (NHEJ) of the full-length linear viral DNA (creating 2-LTR circles) [##REF##11406603##4##], or by homologous recombination between the two LTRs of the episomal viral DNA (creating 1-LTR circles) [##REF##1834863##5##]. Such episomal DNA circles have traditionally been considered dead-end products of reverse transcription [##REF##1834863##5##] and are eventually lost together with episomal linear vector forms as a result of host cell division. However, integration-defective lentiviral (IDLV) vectors carrying an inactive integrase protein that abolish the normal viral integration pathway have recently emerged as novel efficient gene carriers, facilitating high levels of transient expression from linear and circular DNA forms [##REF##17700544##6##, ####REF##16556511##7##, ##REF##16491086##8##, ##REF##15053861##9####15053861##9##]. Increased persistence of transgene expression in dividing cells has been demonstrated by allowing circles harboring the simian virus 40 (SV40) origin of replication to replicate episomally in cells containing the SV40 large T antigen [##REF##15053861##9##]. Moreover, non-integrating lentiviral vectors have been shown to facilitate stable <italic>in vivo </italic>therapeutic levels of transgene expression in non-dividing neuronal cells [##REF##16491086##8##] and muscle [##REF##17700544##6##]. Recently, the episomal nature of the integration-defective vectors was further exploited as a template source for high-efficient gene correction by homologous recombination in human cell lines and in human embryonic stem cells [##REF##17998901##10##,##REF##17965707##11##].</p>\",\n \"<p>High stability and accessibility of DNA circles by cellular proteins have led us to suggest that stable circular DNA intermediates can be engineered to act as putative substrates for gene insertion by nonviral gene-inserting proteins. We test this hypothesis here by using a model system based on the actions of the site-directed Flp recombinase and demonstrate for the first time that LV-derived DNA circles can serve as a substrate for gene insertion facilitated by exogenous nonviral recombinases. Our findings provide evidence that <italic>trans</italic>-acting integrases are able to gain access to and insert transduced lentiviral DNA with possible application in (i) viral vector manipulation for improved viral gene transfer and (ii) Flp-based cell engineering methods focusing on hard-to-transfect cells and/or creation of site-directed gene insertions that do not contain bacterial remnants of plasmid DNA.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<title>Vector construction</title>","<p>The HIV-1-derived Flp substrate vector, pLV/FRT-hygro, was generated by replacing the eGFP gene (BamHI/XhoI digestion) of the third generation SIN-vector pCCL.WPS.PGK-eGFP.WHV (a kind gift from Dr. Patrick Aebischer, Swiss Federal Institute of Technology, EPFL, Lausanne, Switzerland) with the puromycin resistance gene, PCR-amplified from pT/PGK-Puro [##REF##10802653##12##] (creating pCCL.WPS.PGK-Puro.WHV), followed by insertion of the ATG-deficient FRT-hygro fusion gene (PCR-amplified from pcDNA5/FRT, Invitrogen) into the HpaI site located upstream of the cPPT The SB-based docking vector, pSBT/RSV-FGIP, was generated by amplifying the eGFP sequence (from peGFP.N1, Clontech) using a forward primer containing the 48-bp FRT sequence and inserting the resulting FRT.GFP fusion gene into MluI/XmaI-digested pSBT/RSV-hAAT [##REF##10802653##12##] (generating pSBT/RSV-FRT.GFP) prior to insertion of an IRES-puro cassette (PCR-amplified from pecoenv-IRES-puro, kindly provided by Dr. Finn Skou Pedersen, University of Aarhus, Denmark), into the XmaI site. pLV/PGK-Flp was generated by replacing the eGFP gene of pCCL.WPS.PGK-eGFP.WHV with the Flpx9 gene [##REF##9661200##13##] PCR-amplified from pCMV-Flp (obtained from A. Francis Stewart, University of California San Francisco, USA), the latter which contains the enhanced x9 Flp variant driven by a cytomegalovirus (CMV) promoter. pCMV-SB contains the SB10 transposase gene driven by a CMV promoter and has been described previously [##REF##9390559##14##].</p>","<title>Lentiviral vector production</title>","<p>HEK-293 and 293T cells were cultured at 37°C in 5% (v/v) CO<sub>2 </sub>and maintained in Dulbecco's modified Eagle's medium (Cambrex, Verviers, Belgium) with D-glucose (4.500 mg/liter) supplemented with 10% fetal calf serum, penicillin (100 U/ml), streptomycin (0.1 mg/ml), and L-glutamine (265 mg/liter). When selection was applied, puromycin (Sigma, St. Louis, MO) or hygromycin B (Invitrogen, Carlsbad, CA) was added to the growth medium to a final concentration of 1 μg/ml or 200 μg/ml, respectively.</p>","<p>VSV-G-pseudotyped lentiviral vectors were produced by CaPO<sub>4</sub>-transfection of 293T cells (seeded at 3 × 10<sup>6 </sup>cells/dish in 10-cm dishes) with 3 μg pRSV-Rev, 3.75 μg pMD.2G (VSV-G), 13 μg pMDLg/pRRE (or 13 μg pMDLg/pRREintD64V [##REF##16491086##8##] for production of integration-defective vectors) and 13 μg lentiviral vector plasmid. The supernatant was harvested two days post-transfection and polybrene was added to a final concentration of 8 μg/ml prior to transfer to target cells.</p>","<title>Generation and transfection of FRT-tagged cell lines</title>","<p>FRT-tagged HEK-293-derived cell lines were generated by transfecting HEK-293 cells (seeded at 2 × 10<sup>5 </sup>cells/well in 6 well plates) with 1.5 μg pSBT/RSV-FGIP and 0.5 μg pCMV-SB [##REF##9390559##14##] (using 4 μl Fugene-6; Roche, Basel, Switzerland) and selecting for puromycin resistance. Resistant clones were isolated and expanded. For evaluating the efficacy of Flp-mediated insertion of transgenes into the engineered FRT docking site, FRT-tagged cell lines (seeded at 7 × 10<sup>5 </sup>cells/dish in 10-cm dishes, n = 3) were CaPO<sub>4</sub>-transfected with 2 μg pLV/FRT-hygro and 10 μg pCMV-Flp or 10 μg pUC19 (negative control). Two days after transfection the cell lines were split, diluted, and selected for 10 days with hygromycin B prior to counting of hygromycin B-resistant colonies.</p>","<title>Quantification of viral DNA forms in transduced cells</title>","<p>HEK/FGIP1 cells (seeded at 3 × 10<sup>6 </sup>cells/dish in 10-cm dishes, n = 3) were transduced with LV/FRT-hygro or IDLV/FRT-hygro (~4.33 × 10<sup>6 </sup>and ~3.79 × 10<sup>6 </sup>pg p24, respectively). Hirt DNA was harvested 24 hours post-transduction. The amount of total HIV DNA and 2-LTR circles was quantified by real time PCR performed on an iCycler Thermal Cycler (Bio-Rad) using the DyNAmo HS SYBR Green qPCR Kit (Finnzymes, Espoo, Finland). Total HIV DNA was quantified by amplifying a part of the Woodchuck Hepatitis Virus (WHV) posttranscriptional regulatory element present in the vector backbone, and 2-LTR circles were amplified by using primers spanning the LTR-LTR junction. Copy numbers of total HIV DNA and 2-LTR circles were determined from standard curves created by PCR amplification on matching control DNA templates. Concentrations of p24 Gag were measured using a HIV-1 p24 ELISA kit (ZeptoMetrix, Buffalo, NY). To rule out possible overestimation of the total vector DNA due to putative contamination with plasmid DNA, we carried out a quantitative PCR analysis using a primer set amplifying an amplicon within the Amp resistance gene in the plasmid backbone. A pLV/FRT-hygro plasmid dilution series was used as qPCR standard to verify sufficient sensitivity of the assay to detect plasmid contamination. Contaminating plasmid DNA was detected within the range of the assay but was neglectable relative to levels of total vector DNA in transduced cells.</p>","<title>Flp-directed insertion of lentiviral DNA circles</title>","<p>HEK/FGIP1 (n = 3) and HEK/FGIP2-6 (n = 1) cell lines were seeded at a total of 7 × 10<sup>5 </sup>cells/dish in 10-cm dishes. For combined transfection-transduction assays the transfections were performed by CaPO<sub>4 </sub>using a total of 10 μg pCMV-Flp or 2 μg pLV/FRT-hygro, respectively. Transductions were performed using IDLV/FRT-hygro (~4.8 × 10<sup>5 </sup>pg p24) or IDLV/PGK-Flp (~17 × 10<sup>5 </sup>pg p24) vectors. The cells were grown in non-selective medium for two days before being subjected to hygromycin B selection. In co-transduction assays the cells were infected with IDLV/FRT-hygro (~4.8 × 10<sup>5 </sup>pg p24) and IDLV/PGK-Flp (~17 × 10<sup>5 </sup>pg p24) before being subjected to hygromycin B selection. All experiments were performed using an empty Flp-deficient vector as a negative control.</p>","<title>Analyses of clones carrying inserted DNA circles</title>","<p>Southern blot analysis was performed using 10 μg XbaI-digested genomic DNA isolated from hygromycin B-resistant clones. The digested DNA was separated on a 0.8% agarose gel, transferred to a nitrocellulose membrane, hybridized to a 700-bp <sup>32</sup>P-labeled probe, derived from the hygromycin B resistance gene, and subjected to autoradiography. HEK-293 genomic DNA spiked with pLV/FRT-hygro and digested with XbaI (which cuts at a single site in pLV/FRT-hygro) was utilized as a positive control. PCR-based analyses of Flp-directed circle insertions were performed using genomic DNA from isolated hygromycin B-resistant clones. Primer sequences are available upon request.</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<title>Vector construction</title>\",\n \"<p>The HIV-1-derived Flp substrate vector, pLV/FRT-hygro, was generated by replacing the eGFP gene (BamHI/XhoI digestion) of the third generation SIN-vector pCCL.WPS.PGK-eGFP.WHV (a kind gift from Dr. Patrick Aebischer, Swiss Federal Institute of Technology, EPFL, Lausanne, Switzerland) with the puromycin resistance gene, PCR-amplified from pT/PGK-Puro [##REF##10802653##12##] (creating pCCL.WPS.PGK-Puro.WHV), followed by insertion of the ATG-deficient FRT-hygro fusion gene (PCR-amplified from pcDNA5/FRT, Invitrogen) into the HpaI site located upstream of the cPPT The SB-based docking vector, pSBT/RSV-FGIP, was generated by amplifying the eGFP sequence (from peGFP.N1, Clontech) using a forward primer containing the 48-bp FRT sequence and inserting the resulting FRT.GFP fusion gene into MluI/XmaI-digested pSBT/RSV-hAAT [##REF##10802653##12##] (generating pSBT/RSV-FRT.GFP) prior to insertion of an IRES-puro cassette (PCR-amplified from pecoenv-IRES-puro, kindly provided by Dr. Finn Skou Pedersen, University of Aarhus, Denmark), into the XmaI site. pLV/PGK-Flp was generated by replacing the eGFP gene of pCCL.WPS.PGK-eGFP.WHV with the Flpx9 gene [##REF##9661200##13##] PCR-amplified from pCMV-Flp (obtained from A. Francis Stewart, University of California San Francisco, USA), the latter which contains the enhanced x9 Flp variant driven by a cytomegalovirus (CMV) promoter. pCMV-SB contains the SB10 transposase gene driven by a CMV promoter and has been described previously [##REF##9390559##14##].</p>\",\n \"<title>Lentiviral vector production</title>\",\n \"<p>HEK-293 and 293T cells were cultured at 37°C in 5% (v/v) CO<sub>2 </sub>and maintained in Dulbecco's modified Eagle's medium (Cambrex, Verviers, Belgium) with D-glucose (4.500 mg/liter) supplemented with 10% fetal calf serum, penicillin (100 U/ml), streptomycin (0.1 mg/ml), and L-glutamine (265 mg/liter). When selection was applied, puromycin (Sigma, St. Louis, MO) or hygromycin B (Invitrogen, Carlsbad, CA) was added to the growth medium to a final concentration of 1 μg/ml or 200 μg/ml, respectively.</p>\",\n \"<p>VSV-G-pseudotyped lentiviral vectors were produced by CaPO<sub>4</sub>-transfection of 293T cells (seeded at 3 × 10<sup>6 </sup>cells/dish in 10-cm dishes) with 3 μg pRSV-Rev, 3.75 μg pMD.2G (VSV-G), 13 μg pMDLg/pRRE (or 13 μg pMDLg/pRREintD64V [##REF##16491086##8##] for production of integration-defective vectors) and 13 μg lentiviral vector plasmid. The supernatant was harvested two days post-transfection and polybrene was added to a final concentration of 8 μg/ml prior to transfer to target cells.</p>\",\n \"<title>Generation and transfection of FRT-tagged cell lines</title>\",\n \"<p>FRT-tagged HEK-293-derived cell lines were generated by transfecting HEK-293 cells (seeded at 2 × 10<sup>5 </sup>cells/well in 6 well plates) with 1.5 μg pSBT/RSV-FGIP and 0.5 μg pCMV-SB [##REF##9390559##14##] (using 4 μl Fugene-6; Roche, Basel, Switzerland) and selecting for puromycin resistance. Resistant clones were isolated and expanded. For evaluating the efficacy of Flp-mediated insertion of transgenes into the engineered FRT docking site, FRT-tagged cell lines (seeded at 7 × 10<sup>5 </sup>cells/dish in 10-cm dishes, n = 3) were CaPO<sub>4</sub>-transfected with 2 μg pLV/FRT-hygro and 10 μg pCMV-Flp or 10 μg pUC19 (negative control). Two days after transfection the cell lines were split, diluted, and selected for 10 days with hygromycin B prior to counting of hygromycin B-resistant colonies.</p>\",\n \"<title>Quantification of viral DNA forms in transduced cells</title>\",\n \"<p>HEK/FGIP1 cells (seeded at 3 × 10<sup>6 </sup>cells/dish in 10-cm dishes, n = 3) were transduced with LV/FRT-hygro or IDLV/FRT-hygro (~4.33 × 10<sup>6 </sup>and ~3.79 × 10<sup>6 </sup>pg p24, respectively). Hirt DNA was harvested 24 hours post-transduction. The amount of total HIV DNA and 2-LTR circles was quantified by real time PCR performed on an iCycler Thermal Cycler (Bio-Rad) using the DyNAmo HS SYBR Green qPCR Kit (Finnzymes, Espoo, Finland). Total HIV DNA was quantified by amplifying a part of the Woodchuck Hepatitis Virus (WHV) posttranscriptional regulatory element present in the vector backbone, and 2-LTR circles were amplified by using primers spanning the LTR-LTR junction. Copy numbers of total HIV DNA and 2-LTR circles were determined from standard curves created by PCR amplification on matching control DNA templates. Concentrations of p24 Gag were measured using a HIV-1 p24 ELISA kit (ZeptoMetrix, Buffalo, NY). To rule out possible overestimation of the total vector DNA due to putative contamination with plasmid DNA, we carried out a quantitative PCR analysis using a primer set amplifying an amplicon within the Amp resistance gene in the plasmid backbone. A pLV/FRT-hygro plasmid dilution series was used as qPCR standard to verify sufficient sensitivity of the assay to detect plasmid contamination. Contaminating plasmid DNA was detected within the range of the assay but was neglectable relative to levels of total vector DNA in transduced cells.</p>\",\n \"<title>Flp-directed insertion of lentiviral DNA circles</title>\",\n \"<p>HEK/FGIP1 (n = 3) and HEK/FGIP2-6 (n = 1) cell lines were seeded at a total of 7 × 10<sup>5 </sup>cells/dish in 10-cm dishes. For combined transfection-transduction assays the transfections were performed by CaPO<sub>4 </sub>using a total of 10 μg pCMV-Flp or 2 μg pLV/FRT-hygro, respectively. Transductions were performed using IDLV/FRT-hygro (~4.8 × 10<sup>5 </sup>pg p24) or IDLV/PGK-Flp (~17 × 10<sup>5 </sup>pg p24) vectors. The cells were grown in non-selective medium for two days before being subjected to hygromycin B selection. In co-transduction assays the cells were infected with IDLV/FRT-hygro (~4.8 × 10<sup>5 </sup>pg p24) and IDLV/PGK-Flp (~17 × 10<sup>5 </sup>pg p24) before being subjected to hygromycin B selection. All experiments were performed using an empty Flp-deficient vector as a negative control.</p>\",\n \"<title>Analyses of clones carrying inserted DNA circles</title>\",\n \"<p>Southern blot analysis was performed using 10 μg XbaI-digested genomic DNA isolated from hygromycin B-resistant clones. The digested DNA was separated on a 0.8% agarose gel, transferred to a nitrocellulose membrane, hybridized to a 700-bp <sup>32</sup>P-labeled probe, derived from the hygromycin B resistance gene, and subjected to autoradiography. HEK-293 genomic DNA spiked with pLV/FRT-hygro and digested with XbaI (which cuts at a single site in pLV/FRT-hygro) was utilized as a positive control. PCR-based analyses of Flp-directed circle insertions were performed using genomic DNA from isolated hygromycin B-resistant clones. Primer sequences are available upon request.</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results and Discussion</title>","<p>To provide proof-of-principle that <italic>trans</italic>-acting nonviral recombinases are able to gain access to lentivirally delivered substrates and facilitate their insertion, we designed an LV-derived hybrid integration system based upon the integrating properties of the yeast Flp recombinase. First, we constructed an LV substrate vector, pLV/FRT-hygro, containing an ATG-deficient FRT-hygro fusion cassette in the context of a self-inactivating (SIN) LV vector (Figure ##FIG##0##1A##). The Flp recombination target (FRT) sequence is recognized by the Flp recombinase which mediates recombination between two identical FRT sites. By including the FRT sequence in this vector, we reasoned that LV DNA circles generated during vector transduction would serve as substrates for Flp-dependent site-directed insertion of viral DNA into FRT sites engineered into the genome of transduced cells. Integration of the ATG-deficient FRT-hygro fusion gene into an engineered FRT site flanked upstream by a promoter and an ATG sequence would regenerate a functional hygromycin B expression cassette, allowing selection of cells containing site-directed vector insertion (Figure ##FIG##0##1B##). Hence, by using a site-directed Flp-based approach, we were able to score circle insertions selectively but also suspected a low circle insertion rate due to strong limitations on available target sites in the transduced cells.</p>","<p>The conditions for the Flp-based integration machinery were optimized by packaging vector RNA in virus particles carrying an inactive viral integrase protein harboring the class I D64V mutation [##REF##8551608##15##]. By blocking the normal viral integration machinery, we were able to increase the copy number of 2-LTR circles from 3.8 to 22 circles per cell (Figure ##FIG##1##2##) corresponding to a 3.9-fold increase of circular DNA (correlated to the total amount of HIV-1 DNA) available for Flp-based recombination in transduced cells (Figure ##FIG##1##2##). To rule out possible overestimation of the total vector DNA due to plasmid contamination, we carried out a quantitative PCR analysis using a plasmid-specific primer set amplifying an amplicon within the Amp resistance gene in the plasmid backbone. Although within the detection limit of the assay, the level of contaminating plasmids was neglectable relative to measured copy numbers of total vector DNA (data not shown) and considered, therefore, to be without notable influence on measurements of total vector DNA. Importantly, the integrase mutation did not influence production or transduction capacity of the viral particles, since p24 values of the virus preparations and the total amount of episomal vector DNA present in the transduced cells were comparable between vector preparations carrying active and inactive viral integrase (Figure ##FIG##1##2##). In accordance with previous reports [##REF##17700544##6##,##REF##17593926##16##] the titer of integrase-deficient vectors was reduced approximately 1000-fold (from ~10<sup>8 </sup>to ~10<sup>5 </sup>CFU/ml) compared to vectors carrying the active integrase (data not shown).</p>","<p>To tag chromosomal DNA with recognition sequences for the Flp recombinase, we generated a Sleeping Beauty [##REF##9390559##14##] (SB) transposon-derived docking vector, pSBT/RSV-FGIP, containing the Flp recombination target (FRT) sequence as part of a new active fusion variant of the eGFP reporter gene (Figure ##FIG##0##1A##). The eGFP fusion gene, containing an FRT sequence between the start codon and the remaining part of the eGFP coding sequence, was flanked downstream by an IRES element and the puromycin resistance gene. The docking SB transposon was inserted into the genomic DNA of HEK-293 cells by co-transfection of pSBT/RSV-FGIP with pCMV-SB, a plasmid encoding the SB transposase. To provide optimal conditions for subsequent Flp-based gene insertion, we utilized conditions which in our hands consistently allow insertion of >1 vector in transfected HEK-293 cells. The rationale was to create a cell line tagged with at least two docking sites. Among several eGFP-positive HEK-293 cell lines that were generated by puromycin selection, one cell line, HEK/FGIP1, was utilized for further studies. This particular cell line was found to contain at least 3 vector insertions, as determined by Southern blot analysis (data not shown). To confirm functionality of the FRT sequence in the context of the eGFP fusion gene, HEK/FGIP1 cells were co-transfected with 2 μg plasmid carrying an ATG-deficient FRT-hygro cassette (pLV/FRT-hygro) and 10 μg plasmid encoding Flp recombinase. Subsequent hygromycin B selection demonstrated efficient insertion into the engineered FRT site (Figure ##FIG##2##3A##). Analysis of the transfected HEK-SB/FGIP1 cells by quantitative PCR (data not shown) showed that each cell on average contained 1.3 × 10<sup>4 </sup>± 2.3 × 10<sup>3 </sup>FRT-tagged donor plasmids 24 hours after transfection, leading to an estimated insertion rate of 2.8 × 10<sup>-7 </sup>Flp-based insertions per single copy of transfected FRT-hygro-containing plasmid in the culture. Notably, co-transfection of FRT-hygro substrate plasmid with a negative control plasmid did not result in colony formation, demonstrating the absolute lack of false positives in the system. As expected by the presence of >1 docking insertion in this cell line, eGFP expression was not turned off in hygromycin B resistant cells due to the fact that not all docking sites had been targeted by Flp recombination. However, subsequent PCR and sequence analysis of multiple hygromycin B-resistant clones confirmed correct Flp-based plasmid insertion in the eGFP gene of the integrated docking vector (data not shown). In summary, these data provide evidence that the Flp docking construction containing the novel FRT-eGFP fusion gene is functional in context of an integrated SB vector.</p>","<p>During lentiviral transduction double-stranded viral DNA is transported through the nuclear membrane as part of the PIC consisting of both viral and cellular proteins. Attempts to access the viral DNA by nonviral recombinases may therefore be hampered by the reduced DNA accessibility within the context of the PIC. To demonstrate that Flp indeed can gain access to the circular viral DNA and facilitate genomic insertion of LV circular substrates, we transfected the HEK/FGIP1 cell line with a Flp expression plasmid one day prior to transduction with the integration-defective (ID) LV/FRT-hygro vector (see Figure ##FIG##0##1A##). After hygromycin B selection 97 ± 15 resistant colonies were obtained (Figure ##FIG##2##3B##), whereas resistant colonies could not be detected in cells transfected with an empty control plasmid prior to IDLV/FRT-hygro transduction.</p>","<p>To examine whether IDLVs, co-transduced with DNA circle donor IDLVs, could serve as a source of Flp recombinase we created an LV SIN vector, pLV/PGK-Flpx9, containing a PGK-driven Flp gene (Figure ##FIG##0##1A##). First, HEK/FGIP1 cells were transduced with IDLV/PGK-Flp and on the following day transfected with an FRT-tagged plasmid substrate (pLV/FRT-hygro). After two weeks of hygromycin B selection, we detected 35 ± 9 drug-resistant colonies as a result of Flp-mediated plasmid insertion (Figure ##FIG##2##3C##), whereas transduction with a viral vector, IDLV/PGK-eGFP, lacking the Flp expression cassette did not result in any colony formation. These findings demonstrated that Flp recombinase, transiently expressed from integration-defective LV vectors, was able to confer substrate recombination and site-specific gene insertion. We finally co-transduced the HEK/FGIP1 cell line with IDLV/FRT-hygro and IDLV/PGK-Flp and subsequently selected transduced cells for hygromycin B resistance. In this setup, we obtained 58 ± 6 colonies per co-transduction (Figure ##FIG##2##3D##). To examine whether the efficiency of Flp-directed gene insertion varied among clones tagged with the docking vector, we generated five additional FRT-tagged HEK clones (HEK/FGIP2-6). All these cell lines demonstrated levels of eGFP expression that were comparable with the expression of eGFP in HEK/FGIP1 as measured by FACS analysis (data not shown). By co-transduction of these cell lines with IDLV/FRT-hygro and IDLV/PGK-Flp we obtained from 15 to 35 hygromycin B-resistant colonies (Figure ##FIG##2##3E##), indicating that efficiency of LV circle insertion varied only to a small degree between the tested FRT-tagged clones.</p>","<p>To demonstrate that the DNA circles were precisely inserted by Flp into the FRT docking site, we first analyzed five representative clones by southern blot analysis of genomic DNA digested with Xba<italic>I</italic>, which cuts within the duplicated FRT sequences (Figure ##FIG##3##4A##). This analysis verified that full-length circles had been site-specifically inserted. To further characterize the inserted DNA circles 22 clones (10 and 12 clones from figure ##FIG##2##3B## and ##FIG##2##3D##, respectively) were isolated and analyzed. PCR amplification of genomic DNA using primer sets flanking the upstream and downstream FRT junction sites, respectively, resulted in PCR fragments indicative of site-specific circle insertion into the SB-tagged locus (Figure ##FIG##3##4B##, <bold>panel I–II and V–VI</bold>). Sequencing of these PCR products confirmed precise recombination between the genomic FRT site and the circle-associated FRT site, except for one clone (clone 14) in which part of the downstream region of the vector had been deleted. Although this clone carried marks of an inaccurate circle insertion, it could alternatively be the result of Flp-based recombination between a linear substrate and the genomic FRT site. In theory, linear substrates may be as efficient substrates as their circular counterparts but the outcome of vector incorporation into the genomic FRT site may differ. Whereas circular forms are resolved by the Flp recombinase into the genomic site without generating DNA breaks, linear forms containing free LTR ends would be expected to generate potentially harmful double-strand DNA breaks. Such complications would suggest that LV hybrid systems based upon cut-and-paste transposases acting on circular and linear substrates may be advantageous and perhaps safer than recombinase-based systems.</p>","<p>Next, we carried out PCR amplification and sequencing of fragments containing the LTRs of the site-directed insertions. Eight 1-LTR and fourteen 2-LTR circle integrations, created by Flp-based insertion of circles generated by homologous recombination and NHEJ, respectively, were detected (Figure ##FIG##3##4B##, <bold>panel III and VII</bold>) confirming that the integrated DNA in each clone was indeed derived from circular substrates. We analyzed 33 additional clones and from a total of 55 clones, 30 1-LTR and 25 2-LTR insertions were identified (data not shown). According to previous findings claiming a 9:1 ratio of 1-LTR to 2-LTR circles present in transduced cells [##REF##11329067##17##], there appears to be a preference for insertion of 2-LTR circles in our system. Although this finding could reflect differences in the cellular location of circle species and/or their accessibility for proteins <italic>in trans</italic>, possible explanations remain speculative. Altogether, our data demonstrate that DNA circles generated during lentiviral transduction are indeed accessible for nonviral integrases <italic>in trans </italic>and may serve as substrates for genomic recombination by Flp protein transiently delivered by an integration-defective vector.</p>","<p>Based upon 2-LTR copy numbers, measured by q-PCR, we calculated an estimated insertion rate of 1.7 × 10<sup>-5 </sup>Flp-based insertions per single copy of transduced 2-LTR circle (number of drug-resistant colonies containing a 2-LTR insertion/(number of 2-LTR circles per cell × total number of transduced cells)), leading us to suggest that 2-LTR circles, in comparison to transfected plasmid DNA, might be more efficient substrates for Flp-based recombination.</p>","<p>The D64V mutation in the HIV-1 integrase protein removes all enzymatic activity of the protein and has been reported to reduce integration of vector DNA 1.000–10.000-fold [##REF##17700544##6##,##REF##8551608##15##,##REF##17593926##16##]. We reproducibly measured a 1000-fold reduction by colony-forming assays and, hence, could not formally rule out that integrase-independent insertion of linear IDLV/FRT-hygro or IDLV/PGK-Flp could have occurred in hygromycin B-selected clones. We therefore verified by PCR analysis that unspecific integration of linear vector DNA had not occurred in any of the hygromycin B-resistant clones (Figure ##FIG##3##4B##, <bold>IV </bold>and <bold>VII–IX</bold>), providing proof that the cell clones carrying a site-directed insertion did not carry additional background vector insertions.</p>","<p>Our findings provide, to our knowledge, the first proof-of-principle that integration of lentiviral DNA can be facilitated by a nonviral recombinase, thereby altering the integration profile of LV vectors – in this case towards a site-directed profile using DNA circles as a substrate for gene insertion. The normal catalytic activities of the lentiviral integrase were replaced in a drug-selective approach with the site-directed properties of the yeast Flp recombinase. As Flp recognition sites are not present in the human genome, an eGFP fusion gene containing the FRT sequences was inserted by a novel transposon-based FRT docking vector prior to IDLV transduction. The site-directed approach allowing insertion only in the genomic engineered sites resulted, as expected, in a fairly low insertion rate. As more potent alternatives, LV-hybrids with integration machineries derived from the phage ΦC31 integrase [##REF##11359900##18##], hyperactive Sleeping Beauty transposases [##REF##15456893##19##] or the AAV Rep protein [##REF##9311886##20##] will have direct relevance in human cells, although cut-and-paste transposon systems would be preferred to mimimize the risk of generating double-strand DNA breaks as a possible outcome of recombinase-based insertion of linear substrates. Site-directed integration technologies based on the recombination capabilities of tyrosine recombinases as Cre or Flp have been widely used to direct targeted insertion of nonviral DNA plasmid substrates into genomic recognition sites. Flp-mediated plasmid insertion routinely allows genetic engineering of easy-to-transfect cell lines and has become pivotal in comparative gene expression studies in which integrated transgenes of interest may otherwise be variably influenced by the surrounding DNA. Our data describe a lentivirus-based technology with possible implication for Flp-mediated gene insertion in hard-to-transfect cell lines or potentially in FRT-tagged tissues or primary cells that are not easily transfected. Recent evidence has supported the fact that episomal lentiviral circles are highly stable in non-dividing cells and may provide persistent transgene expression in vivo [##REF##16491086##8##]. For many applications, the stability of lentiviral circles in non-dividing cells does not call for genomic integration of the transgene. Nevertheless, stable viral episomes may represent permanent targets for recombinase-directed insertion of lentiviral circles in non-dividing cells.</p>","<p>The obvious difference in efficiency (as measured by the number of hygromycin B-resistant colonies) between plasmid- and the LV circle-based Flp integration systems (Figure ##FIG##2##3A## versus Figure ##FIG##2##3B## and ##FIG##2##3D##) may reflect differences in the availability of circular substrates in the two systems (plasmid DNA versus LV circles) or, alternatively, that plasmid DNA is somehow better suited for Flp-based insertion. Quantitative PCR analyses comparing the number of plasmids in transfected cells with the number of episomal 2-LTR DNA circles in LV-transduced cells indicated that about 600 times more episomal DNA circles are available in the plasmid-based system compared to the LV-based system (1.3 × 10<sup>4 </sup>plasmids per cell compared to 22 2-LTR DNA circles per cell). However, as we found that 50% of the hygromycin B-resistant clones were the result of 2-LTR circle insertions, we estimate that the high number of plasmids available in transfected cells produced only 52 times more hygromycin B-resistant colonies than transduced 2-LTR episomes (2546 versus 48.5 colonies), leading to the assumption that LV-derived 2-LTR circular DNA is more efficiently integrated than plasmid-based substrates. Possible explanations for this finding, including varying substrate concentrations in different cellular compartments and differences in accessibility caused by structural substrate constraints (relaxed versus supercoiled substrates), are currently subjects for further scrutiny. Comparable levels of colony formation in experiments using IDLVs as a source of Flp recombinase and/or circular DNA substrates (Figure ##FIG##2##3B, C##, and ##FIG##2##3D##) indicate that both virus-derived Flp and DNA substrates are limiting factors for efficient Flp-based gene insertion.</p>","<p>By integrating viral circles rather than plasmid DNA, we obtained Flp-based insertions that are not potentially harnessed by bacterial sequences derived from the plasmid backbone. A recent <italic>in vivo </italic>study has shown an increase in heterochromatin-like histone modifications correlating with lower levels of transgene expression from transfected plasmids containing bacterial sequences compared to plasmids devoid of bacteria-derived DNA [##REF##17457320##21##]. Together, our findings provide a novel tool for Flp-based genetic engineering and pave the way for future applications of lentiviral DNA circles as potential substrates for more therapeutic relevant nonviral integration machineries in somatic gene transfer.</p>"],"string":"[\n \"<title>Results and Discussion</title>\",\n \"<p>To provide proof-of-principle that <italic>trans</italic>-acting nonviral recombinases are able to gain access to lentivirally delivered substrates and facilitate their insertion, we designed an LV-derived hybrid integration system based upon the integrating properties of the yeast Flp recombinase. First, we constructed an LV substrate vector, pLV/FRT-hygro, containing an ATG-deficient FRT-hygro fusion cassette in the context of a self-inactivating (SIN) LV vector (Figure ##FIG##0##1A##). The Flp recombination target (FRT) sequence is recognized by the Flp recombinase which mediates recombination between two identical FRT sites. By including the FRT sequence in this vector, we reasoned that LV DNA circles generated during vector transduction would serve as substrates for Flp-dependent site-directed insertion of viral DNA into FRT sites engineered into the genome of transduced cells. Integration of the ATG-deficient FRT-hygro fusion gene into an engineered FRT site flanked upstream by a promoter and an ATG sequence would regenerate a functional hygromycin B expression cassette, allowing selection of cells containing site-directed vector insertion (Figure ##FIG##0##1B##). Hence, by using a site-directed Flp-based approach, we were able to score circle insertions selectively but also suspected a low circle insertion rate due to strong limitations on available target sites in the transduced cells.</p>\",\n \"<p>The conditions for the Flp-based integration machinery were optimized by packaging vector RNA in virus particles carrying an inactive viral integrase protein harboring the class I D64V mutation [##REF##8551608##15##]. By blocking the normal viral integration machinery, we were able to increase the copy number of 2-LTR circles from 3.8 to 22 circles per cell (Figure ##FIG##1##2##) corresponding to a 3.9-fold increase of circular DNA (correlated to the total amount of HIV-1 DNA) available for Flp-based recombination in transduced cells (Figure ##FIG##1##2##). To rule out possible overestimation of the total vector DNA due to plasmid contamination, we carried out a quantitative PCR analysis using a plasmid-specific primer set amplifying an amplicon within the Amp resistance gene in the plasmid backbone. Although within the detection limit of the assay, the level of contaminating plasmids was neglectable relative to measured copy numbers of total vector DNA (data not shown) and considered, therefore, to be without notable influence on measurements of total vector DNA. Importantly, the integrase mutation did not influence production or transduction capacity of the viral particles, since p24 values of the virus preparations and the total amount of episomal vector DNA present in the transduced cells were comparable between vector preparations carrying active and inactive viral integrase (Figure ##FIG##1##2##). In accordance with previous reports [##REF##17700544##6##,##REF##17593926##16##] the titer of integrase-deficient vectors was reduced approximately 1000-fold (from ~10<sup>8 </sup>to ~10<sup>5 </sup>CFU/ml) compared to vectors carrying the active integrase (data not shown).</p>\",\n \"<p>To tag chromosomal DNA with recognition sequences for the Flp recombinase, we generated a Sleeping Beauty [##REF##9390559##14##] (SB) transposon-derived docking vector, pSBT/RSV-FGIP, containing the Flp recombination target (FRT) sequence as part of a new active fusion variant of the eGFP reporter gene (Figure ##FIG##0##1A##). The eGFP fusion gene, containing an FRT sequence between the start codon and the remaining part of the eGFP coding sequence, was flanked downstream by an IRES element and the puromycin resistance gene. The docking SB transposon was inserted into the genomic DNA of HEK-293 cells by co-transfection of pSBT/RSV-FGIP with pCMV-SB, a plasmid encoding the SB transposase. To provide optimal conditions for subsequent Flp-based gene insertion, we utilized conditions which in our hands consistently allow insertion of >1 vector in transfected HEK-293 cells. The rationale was to create a cell line tagged with at least two docking sites. Among several eGFP-positive HEK-293 cell lines that were generated by puromycin selection, one cell line, HEK/FGIP1, was utilized for further studies. This particular cell line was found to contain at least 3 vector insertions, as determined by Southern blot analysis (data not shown). To confirm functionality of the FRT sequence in the context of the eGFP fusion gene, HEK/FGIP1 cells were co-transfected with 2 μg plasmid carrying an ATG-deficient FRT-hygro cassette (pLV/FRT-hygro) and 10 μg plasmid encoding Flp recombinase. Subsequent hygromycin B selection demonstrated efficient insertion into the engineered FRT site (Figure ##FIG##2##3A##). Analysis of the transfected HEK-SB/FGIP1 cells by quantitative PCR (data not shown) showed that each cell on average contained 1.3 × 10<sup>4 </sup>± 2.3 × 10<sup>3 </sup>FRT-tagged donor plasmids 24 hours after transfection, leading to an estimated insertion rate of 2.8 × 10<sup>-7 </sup>Flp-based insertions per single copy of transfected FRT-hygro-containing plasmid in the culture. Notably, co-transfection of FRT-hygro substrate plasmid with a negative control plasmid did not result in colony formation, demonstrating the absolute lack of false positives in the system. As expected by the presence of >1 docking insertion in this cell line, eGFP expression was not turned off in hygromycin B resistant cells due to the fact that not all docking sites had been targeted by Flp recombination. However, subsequent PCR and sequence analysis of multiple hygromycin B-resistant clones confirmed correct Flp-based plasmid insertion in the eGFP gene of the integrated docking vector (data not shown). In summary, these data provide evidence that the Flp docking construction containing the novel FRT-eGFP fusion gene is functional in context of an integrated SB vector.</p>\",\n \"<p>During lentiviral transduction double-stranded viral DNA is transported through the nuclear membrane as part of the PIC consisting of both viral and cellular proteins. Attempts to access the viral DNA by nonviral recombinases may therefore be hampered by the reduced DNA accessibility within the context of the PIC. To demonstrate that Flp indeed can gain access to the circular viral DNA and facilitate genomic insertion of LV circular substrates, we transfected the HEK/FGIP1 cell line with a Flp expression plasmid one day prior to transduction with the integration-defective (ID) LV/FRT-hygro vector (see Figure ##FIG##0##1A##). After hygromycin B selection 97 ± 15 resistant colonies were obtained (Figure ##FIG##2##3B##), whereas resistant colonies could not be detected in cells transfected with an empty control plasmid prior to IDLV/FRT-hygro transduction.</p>\",\n \"<p>To examine whether IDLVs, co-transduced with DNA circle donor IDLVs, could serve as a source of Flp recombinase we created an LV SIN vector, pLV/PGK-Flpx9, containing a PGK-driven Flp gene (Figure ##FIG##0##1A##). First, HEK/FGIP1 cells were transduced with IDLV/PGK-Flp and on the following day transfected with an FRT-tagged plasmid substrate (pLV/FRT-hygro). After two weeks of hygromycin B selection, we detected 35 ± 9 drug-resistant colonies as a result of Flp-mediated plasmid insertion (Figure ##FIG##2##3C##), whereas transduction with a viral vector, IDLV/PGK-eGFP, lacking the Flp expression cassette did not result in any colony formation. These findings demonstrated that Flp recombinase, transiently expressed from integration-defective LV vectors, was able to confer substrate recombination and site-specific gene insertion. We finally co-transduced the HEK/FGIP1 cell line with IDLV/FRT-hygro and IDLV/PGK-Flp and subsequently selected transduced cells for hygromycin B resistance. In this setup, we obtained 58 ± 6 colonies per co-transduction (Figure ##FIG##2##3D##). To examine whether the efficiency of Flp-directed gene insertion varied among clones tagged with the docking vector, we generated five additional FRT-tagged HEK clones (HEK/FGIP2-6). All these cell lines demonstrated levels of eGFP expression that were comparable with the expression of eGFP in HEK/FGIP1 as measured by FACS analysis (data not shown). By co-transduction of these cell lines with IDLV/FRT-hygro and IDLV/PGK-Flp we obtained from 15 to 35 hygromycin B-resistant colonies (Figure ##FIG##2##3E##), indicating that efficiency of LV circle insertion varied only to a small degree between the tested FRT-tagged clones.</p>\",\n \"<p>To demonstrate that the DNA circles were precisely inserted by Flp into the FRT docking site, we first analyzed five representative clones by southern blot analysis of genomic DNA digested with Xba<italic>I</italic>, which cuts within the duplicated FRT sequences (Figure ##FIG##3##4A##). This analysis verified that full-length circles had been site-specifically inserted. To further characterize the inserted DNA circles 22 clones (10 and 12 clones from figure ##FIG##2##3B## and ##FIG##2##3D##, respectively) were isolated and analyzed. PCR amplification of genomic DNA using primer sets flanking the upstream and downstream FRT junction sites, respectively, resulted in PCR fragments indicative of site-specific circle insertion into the SB-tagged locus (Figure ##FIG##3##4B##, <bold>panel I–II and V–VI</bold>). Sequencing of these PCR products confirmed precise recombination between the genomic FRT site and the circle-associated FRT site, except for one clone (clone 14) in which part of the downstream region of the vector had been deleted. Although this clone carried marks of an inaccurate circle insertion, it could alternatively be the result of Flp-based recombination between a linear substrate and the genomic FRT site. In theory, linear substrates may be as efficient substrates as their circular counterparts but the outcome of vector incorporation into the genomic FRT site may differ. Whereas circular forms are resolved by the Flp recombinase into the genomic site without generating DNA breaks, linear forms containing free LTR ends would be expected to generate potentially harmful double-strand DNA breaks. Such complications would suggest that LV hybrid systems based upon cut-and-paste transposases acting on circular and linear substrates may be advantageous and perhaps safer than recombinase-based systems.</p>\",\n \"<p>Next, we carried out PCR amplification and sequencing of fragments containing the LTRs of the site-directed insertions. Eight 1-LTR and fourteen 2-LTR circle integrations, created by Flp-based insertion of circles generated by homologous recombination and NHEJ, respectively, were detected (Figure ##FIG##3##4B##, <bold>panel III and VII</bold>) confirming that the integrated DNA in each clone was indeed derived from circular substrates. We analyzed 33 additional clones and from a total of 55 clones, 30 1-LTR and 25 2-LTR insertions were identified (data not shown). According to previous findings claiming a 9:1 ratio of 1-LTR to 2-LTR circles present in transduced cells [##REF##11329067##17##], there appears to be a preference for insertion of 2-LTR circles in our system. Although this finding could reflect differences in the cellular location of circle species and/or their accessibility for proteins <italic>in trans</italic>, possible explanations remain speculative. Altogether, our data demonstrate that DNA circles generated during lentiviral transduction are indeed accessible for nonviral integrases <italic>in trans </italic>and may serve as substrates for genomic recombination by Flp protein transiently delivered by an integration-defective vector.</p>\",\n \"<p>Based upon 2-LTR copy numbers, measured by q-PCR, we calculated an estimated insertion rate of 1.7 × 10<sup>-5 </sup>Flp-based insertions per single copy of transduced 2-LTR circle (number of drug-resistant colonies containing a 2-LTR insertion/(number of 2-LTR circles per cell × total number of transduced cells)), leading us to suggest that 2-LTR circles, in comparison to transfected plasmid DNA, might be more efficient substrates for Flp-based recombination.</p>\",\n \"<p>The D64V mutation in the HIV-1 integrase protein removes all enzymatic activity of the protein and has been reported to reduce integration of vector DNA 1.000–10.000-fold [##REF##17700544##6##,##REF##8551608##15##,##REF##17593926##16##]. We reproducibly measured a 1000-fold reduction by colony-forming assays and, hence, could not formally rule out that integrase-independent insertion of linear IDLV/FRT-hygro or IDLV/PGK-Flp could have occurred in hygromycin B-selected clones. We therefore verified by PCR analysis that unspecific integration of linear vector DNA had not occurred in any of the hygromycin B-resistant clones (Figure ##FIG##3##4B##, <bold>IV </bold>and <bold>VII–IX</bold>), providing proof that the cell clones carrying a site-directed insertion did not carry additional background vector insertions.</p>\",\n \"<p>Our findings provide, to our knowledge, the first proof-of-principle that integration of lentiviral DNA can be facilitated by a nonviral recombinase, thereby altering the integration profile of LV vectors – in this case towards a site-directed profile using DNA circles as a substrate for gene insertion. The normal catalytic activities of the lentiviral integrase were replaced in a drug-selective approach with the site-directed properties of the yeast Flp recombinase. As Flp recognition sites are not present in the human genome, an eGFP fusion gene containing the FRT sequences was inserted by a novel transposon-based FRT docking vector prior to IDLV transduction. The site-directed approach allowing insertion only in the genomic engineered sites resulted, as expected, in a fairly low insertion rate. As more potent alternatives, LV-hybrids with integration machineries derived from the phage ΦC31 integrase [##REF##11359900##18##], hyperactive Sleeping Beauty transposases [##REF##15456893##19##] or the AAV Rep protein [##REF##9311886##20##] will have direct relevance in human cells, although cut-and-paste transposon systems would be preferred to mimimize the risk of generating double-strand DNA breaks as a possible outcome of recombinase-based insertion of linear substrates. Site-directed integration technologies based on the recombination capabilities of tyrosine recombinases as Cre or Flp have been widely used to direct targeted insertion of nonviral DNA plasmid substrates into genomic recognition sites. Flp-mediated plasmid insertion routinely allows genetic engineering of easy-to-transfect cell lines and has become pivotal in comparative gene expression studies in which integrated transgenes of interest may otherwise be variably influenced by the surrounding DNA. Our data describe a lentivirus-based technology with possible implication for Flp-mediated gene insertion in hard-to-transfect cell lines or potentially in FRT-tagged tissues or primary cells that are not easily transfected. Recent evidence has supported the fact that episomal lentiviral circles are highly stable in non-dividing cells and may provide persistent transgene expression in vivo [##REF##16491086##8##]. For many applications, the stability of lentiviral circles in non-dividing cells does not call for genomic integration of the transgene. Nevertheless, stable viral episomes may represent permanent targets for recombinase-directed insertion of lentiviral circles in non-dividing cells.</p>\",\n \"<p>The obvious difference in efficiency (as measured by the number of hygromycin B-resistant colonies) between plasmid- and the LV circle-based Flp integration systems (Figure ##FIG##2##3A## versus Figure ##FIG##2##3B## and ##FIG##2##3D##) may reflect differences in the availability of circular substrates in the two systems (plasmid DNA versus LV circles) or, alternatively, that plasmid DNA is somehow better suited for Flp-based insertion. Quantitative PCR analyses comparing the number of plasmids in transfected cells with the number of episomal 2-LTR DNA circles in LV-transduced cells indicated that about 600 times more episomal DNA circles are available in the plasmid-based system compared to the LV-based system (1.3 × 10<sup>4 </sup>plasmids per cell compared to 22 2-LTR DNA circles per cell). However, as we found that 50% of the hygromycin B-resistant clones were the result of 2-LTR circle insertions, we estimate that the high number of plasmids available in transfected cells produced only 52 times more hygromycin B-resistant colonies than transduced 2-LTR episomes (2546 versus 48.5 colonies), leading to the assumption that LV-derived 2-LTR circular DNA is more efficiently integrated than plasmid-based substrates. Possible explanations for this finding, including varying substrate concentrations in different cellular compartments and differences in accessibility caused by structural substrate constraints (relaxed versus supercoiled substrates), are currently subjects for further scrutiny. Comparable levels of colony formation in experiments using IDLVs as a source of Flp recombinase and/or circular DNA substrates (Figure ##FIG##2##3B, C##, and ##FIG##2##3D##) indicate that both virus-derived Flp and DNA substrates are limiting factors for efficient Flp-based gene insertion.</p>\",\n \"<p>By integrating viral circles rather than plasmid DNA, we obtained Flp-based insertions that are not potentially harnessed by bacterial sequences derived from the plasmid backbone. A recent <italic>in vivo </italic>study has shown an increase in heterochromatin-like histone modifications correlating with lower levels of transgene expression from transfected plasmids containing bacterial sequences compared to plasmids devoid of bacteria-derived DNA [##REF##17457320##21##]. Together, our findings provide a novel tool for Flp-based genetic engineering and pave the way for future applications of lentiviral DNA circles as potential substrates for more therapeutic relevant nonviral integration machineries in somatic gene transfer.</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Results and Discussion</title>","<p>To provide proof-of-principle that <italic>trans</italic>-acting nonviral recombinases are able to gain access to lentivirally delivered substrates and facilitate their insertion, we designed an LV-derived hybrid integration system based upon the integrating properties of the yeast Flp recombinase. First, we constructed an LV substrate vector, pLV/FRT-hygro, containing an ATG-deficient FRT-hygro fusion cassette in the context of a self-inactivating (SIN) LV vector (Figure ##FIG##0##1A##). The Flp recombination target (FRT) sequence is recognized by the Flp recombinase which mediates recombination between two identical FRT sites. By including the FRT sequence in this vector, we reasoned that LV DNA circles generated during vector transduction would serve as substrates for Flp-dependent site-directed insertion of viral DNA into FRT sites engineered into the genome of transduced cells. Integration of the ATG-deficient FRT-hygro fusion gene into an engineered FRT site flanked upstream by a promoter and an ATG sequence would regenerate a functional hygromycin B expression cassette, allowing selection of cells containing site-directed vector insertion (Figure ##FIG##0##1B##). Hence, by using a site-directed Flp-based approach, we were able to score circle insertions selectively but also suspected a low circle insertion rate due to strong limitations on available target sites in the transduced cells.</p>","<p>The conditions for the Flp-based integration machinery were optimized by packaging vector RNA in virus particles carrying an inactive viral integrase protein harboring the class I D64V mutation [##REF##8551608##15##]. By blocking the normal viral integration machinery, we were able to increase the copy number of 2-LTR circles from 3.8 to 22 circles per cell (Figure ##FIG##1##2##) corresponding to a 3.9-fold increase of circular DNA (correlated to the total amount of HIV-1 DNA) available for Flp-based recombination in transduced cells (Figure ##FIG##1##2##). To rule out possible overestimation of the total vector DNA due to plasmid contamination, we carried out a quantitative PCR analysis using a plasmid-specific primer set amplifying an amplicon within the Amp resistance gene in the plasmid backbone. Although within the detection limit of the assay, the level of contaminating plasmids was neglectable relative to measured copy numbers of total vector DNA (data not shown) and considered, therefore, to be without notable influence on measurements of total vector DNA. Importantly, the integrase mutation did not influence production or transduction capacity of the viral particles, since p24 values of the virus preparations and the total amount of episomal vector DNA present in the transduced cells were comparable between vector preparations carrying active and inactive viral integrase (Figure ##FIG##1##2##). In accordance with previous reports [##REF##17700544##6##,##REF##17593926##16##] the titer of integrase-deficient vectors was reduced approximately 1000-fold (from ~10<sup>8 </sup>to ~10<sup>5 </sup>CFU/ml) compared to vectors carrying the active integrase (data not shown).</p>","<p>To tag chromosomal DNA with recognition sequences for the Flp recombinase, we generated a Sleeping Beauty [##REF##9390559##14##] (SB) transposon-derived docking vector, pSBT/RSV-FGIP, containing the Flp recombination target (FRT) sequence as part of a new active fusion variant of the eGFP reporter gene (Figure ##FIG##0##1A##). The eGFP fusion gene, containing an FRT sequence between the start codon and the remaining part of the eGFP coding sequence, was flanked downstream by an IRES element and the puromycin resistance gene. The docking SB transposon was inserted into the genomic DNA of HEK-293 cells by co-transfection of pSBT/RSV-FGIP with pCMV-SB, a plasmid encoding the SB transposase. To provide optimal conditions for subsequent Flp-based gene insertion, we utilized conditions which in our hands consistently allow insertion of >1 vector in transfected HEK-293 cells. The rationale was to create a cell line tagged with at least two docking sites. Among several eGFP-positive HEK-293 cell lines that were generated by puromycin selection, one cell line, HEK/FGIP1, was utilized for further studies. This particular cell line was found to contain at least 3 vector insertions, as determined by Southern blot analysis (data not shown). To confirm functionality of the FRT sequence in the context of the eGFP fusion gene, HEK/FGIP1 cells were co-transfected with 2 μg plasmid carrying an ATG-deficient FRT-hygro cassette (pLV/FRT-hygro) and 10 μg plasmid encoding Flp recombinase. Subsequent hygromycin B selection demonstrated efficient insertion into the engineered FRT site (Figure ##FIG##2##3A##). Analysis of the transfected HEK-SB/FGIP1 cells by quantitative PCR (data not shown) showed that each cell on average contained 1.3 × 10<sup>4 </sup>± 2.3 × 10<sup>3 </sup>FRT-tagged donor plasmids 24 hours after transfection, leading to an estimated insertion rate of 2.8 × 10<sup>-7 </sup>Flp-based insertions per single copy of transfected FRT-hygro-containing plasmid in the culture. Notably, co-transfection of FRT-hygro substrate plasmid with a negative control plasmid did not result in colony formation, demonstrating the absolute lack of false positives in the system. As expected by the presence of >1 docking insertion in this cell line, eGFP expression was not turned off in hygromycin B resistant cells due to the fact that not all docking sites had been targeted by Flp recombination. However, subsequent PCR and sequence analysis of multiple hygromycin B-resistant clones confirmed correct Flp-based plasmid insertion in the eGFP gene of the integrated docking vector (data not shown). In summary, these data provide evidence that the Flp docking construction containing the novel FRT-eGFP fusion gene is functional in context of an integrated SB vector.</p>","<p>During lentiviral transduction double-stranded viral DNA is transported through the nuclear membrane as part of the PIC consisting of both viral and cellular proteins. Attempts to access the viral DNA by nonviral recombinases may therefore be hampered by the reduced DNA accessibility within the context of the PIC. To demonstrate that Flp indeed can gain access to the circular viral DNA and facilitate genomic insertion of LV circular substrates, we transfected the HEK/FGIP1 cell line with a Flp expression plasmid one day prior to transduction with the integration-defective (ID) LV/FRT-hygro vector (see Figure ##FIG##0##1A##). After hygromycin B selection 97 ± 15 resistant colonies were obtained (Figure ##FIG##2##3B##), whereas resistant colonies could not be detected in cells transfected with an empty control plasmid prior to IDLV/FRT-hygro transduction.</p>","<p>To examine whether IDLVs, co-transduced with DNA circle donor IDLVs, could serve as a source of Flp recombinase we created an LV SIN vector, pLV/PGK-Flpx9, containing a PGK-driven Flp gene (Figure ##FIG##0##1A##). First, HEK/FGIP1 cells were transduced with IDLV/PGK-Flp and on the following day transfected with an FRT-tagged plasmid substrate (pLV/FRT-hygro). After two weeks of hygromycin B selection, we detected 35 ± 9 drug-resistant colonies as a result of Flp-mediated plasmid insertion (Figure ##FIG##2##3C##), whereas transduction with a viral vector, IDLV/PGK-eGFP, lacking the Flp expression cassette did not result in any colony formation. These findings demonstrated that Flp recombinase, transiently expressed from integration-defective LV vectors, was able to confer substrate recombination and site-specific gene insertion. We finally co-transduced the HEK/FGIP1 cell line with IDLV/FRT-hygro and IDLV/PGK-Flp and subsequently selected transduced cells for hygromycin B resistance. In this setup, we obtained 58 ± 6 colonies per co-transduction (Figure ##FIG##2##3D##). To examine whether the efficiency of Flp-directed gene insertion varied among clones tagged with the docking vector, we generated five additional FRT-tagged HEK clones (HEK/FGIP2-6). All these cell lines demonstrated levels of eGFP expression that were comparable with the expression of eGFP in HEK/FGIP1 as measured by FACS analysis (data not shown). By co-transduction of these cell lines with IDLV/FRT-hygro and IDLV/PGK-Flp we obtained from 15 to 35 hygromycin B-resistant colonies (Figure ##FIG##2##3E##), indicating that efficiency of LV circle insertion varied only to a small degree between the tested FRT-tagged clones.</p>","<p>To demonstrate that the DNA circles were precisely inserted by Flp into the FRT docking site, we first analyzed five representative clones by southern blot analysis of genomic DNA digested with Xba<italic>I</italic>, which cuts within the duplicated FRT sequences (Figure ##FIG##3##4A##). This analysis verified that full-length circles had been site-specifically inserted. To further characterize the inserted DNA circles 22 clones (10 and 12 clones from figure ##FIG##2##3B## and ##FIG##2##3D##, respectively) were isolated and analyzed. PCR amplification of genomic DNA using primer sets flanking the upstream and downstream FRT junction sites, respectively, resulted in PCR fragments indicative of site-specific circle insertion into the SB-tagged locus (Figure ##FIG##3##4B##, <bold>panel I–II and V–VI</bold>). Sequencing of these PCR products confirmed precise recombination between the genomic FRT site and the circle-associated FRT site, except for one clone (clone 14) in which part of the downstream region of the vector had been deleted. Although this clone carried marks of an inaccurate circle insertion, it could alternatively be the result of Flp-based recombination between a linear substrate and the genomic FRT site. In theory, linear substrates may be as efficient substrates as their circular counterparts but the outcome of vector incorporation into the genomic FRT site may differ. Whereas circular forms are resolved by the Flp recombinase into the genomic site without generating DNA breaks, linear forms containing free LTR ends would be expected to generate potentially harmful double-strand DNA breaks. Such complications would suggest that LV hybrid systems based upon cut-and-paste transposases acting on circular and linear substrates may be advantageous and perhaps safer than recombinase-based systems.</p>","<p>Next, we carried out PCR amplification and sequencing of fragments containing the LTRs of the site-directed insertions. Eight 1-LTR and fourteen 2-LTR circle integrations, created by Flp-based insertion of circles generated by homologous recombination and NHEJ, respectively, were detected (Figure ##FIG##3##4B##, <bold>panel III and VII</bold>) confirming that the integrated DNA in each clone was indeed derived from circular substrates. We analyzed 33 additional clones and from a total of 55 clones, 30 1-LTR and 25 2-LTR insertions were identified (data not shown). According to previous findings claiming a 9:1 ratio of 1-LTR to 2-LTR circles present in transduced cells [##REF##11329067##17##], there appears to be a preference for insertion of 2-LTR circles in our system. Although this finding could reflect differences in the cellular location of circle species and/or their accessibility for proteins <italic>in trans</italic>, possible explanations remain speculative. Altogether, our data demonstrate that DNA circles generated during lentiviral transduction are indeed accessible for nonviral integrases <italic>in trans </italic>and may serve as substrates for genomic recombination by Flp protein transiently delivered by an integration-defective vector.</p>","<p>Based upon 2-LTR copy numbers, measured by q-PCR, we calculated an estimated insertion rate of 1.7 × 10<sup>-5 </sup>Flp-based insertions per single copy of transduced 2-LTR circle (number of drug-resistant colonies containing a 2-LTR insertion/(number of 2-LTR circles per cell × total number of transduced cells)), leading us to suggest that 2-LTR circles, in comparison to transfected plasmid DNA, might be more efficient substrates for Flp-based recombination.</p>","<p>The D64V mutation in the HIV-1 integrase protein removes all enzymatic activity of the protein and has been reported to reduce integration of vector DNA 1.000–10.000-fold [##REF##17700544##6##,##REF##8551608##15##,##REF##17593926##16##]. We reproducibly measured a 1000-fold reduction by colony-forming assays and, hence, could not formally rule out that integrase-independent insertion of linear IDLV/FRT-hygro or IDLV/PGK-Flp could have occurred in hygromycin B-selected clones. We therefore verified by PCR analysis that unspecific integration of linear vector DNA had not occurred in any of the hygromycin B-resistant clones (Figure ##FIG##3##4B##, <bold>IV </bold>and <bold>VII–IX</bold>), providing proof that the cell clones carrying a site-directed insertion did not carry additional background vector insertions.</p>","<p>Our findings provide, to our knowledge, the first proof-of-principle that integration of lentiviral DNA can be facilitated by a nonviral recombinase, thereby altering the integration profile of LV vectors – in this case towards a site-directed profile using DNA circles as a substrate for gene insertion. The normal catalytic activities of the lentiviral integrase were replaced in a drug-selective approach with the site-directed properties of the yeast Flp recombinase. As Flp recognition sites are not present in the human genome, an eGFP fusion gene containing the FRT sequences was inserted by a novel transposon-based FRT docking vector prior to IDLV transduction. The site-directed approach allowing insertion only in the genomic engineered sites resulted, as expected, in a fairly low insertion rate. As more potent alternatives, LV-hybrids with integration machineries derived from the phage ΦC31 integrase [##REF##11359900##18##], hyperactive Sleeping Beauty transposases [##REF##15456893##19##] or the AAV Rep protein [##REF##9311886##20##] will have direct relevance in human cells, although cut-and-paste transposon systems would be preferred to mimimize the risk of generating double-strand DNA breaks as a possible outcome of recombinase-based insertion of linear substrates. Site-directed integration technologies based on the recombination capabilities of tyrosine recombinases as Cre or Flp have been widely used to direct targeted insertion of nonviral DNA plasmid substrates into genomic recognition sites. Flp-mediated plasmid insertion routinely allows genetic engineering of easy-to-transfect cell lines and has become pivotal in comparative gene expression studies in which integrated transgenes of interest may otherwise be variably influenced by the surrounding DNA. Our data describe a lentivirus-based technology with possible implication for Flp-mediated gene insertion in hard-to-transfect cell lines or potentially in FRT-tagged tissues or primary cells that are not easily transfected. Recent evidence has supported the fact that episomal lentiviral circles are highly stable in non-dividing cells and may provide persistent transgene expression in vivo [##REF##16491086##8##]. For many applications, the stability of lentiviral circles in non-dividing cells does not call for genomic integration of the transgene. Nevertheless, stable viral episomes may represent permanent targets for recombinase-directed insertion of lentiviral circles in non-dividing cells.</p>","<p>The obvious difference in efficiency (as measured by the number of hygromycin B-resistant colonies) between plasmid- and the LV circle-based Flp integration systems (Figure ##FIG##2##3A## versus Figure ##FIG##2##3B## and ##FIG##2##3D##) may reflect differences in the availability of circular substrates in the two systems (plasmid DNA versus LV circles) or, alternatively, that plasmid DNA is somehow better suited for Flp-based insertion. Quantitative PCR analyses comparing the number of plasmids in transfected cells with the number of episomal 2-LTR DNA circles in LV-transduced cells indicated that about 600 times more episomal DNA circles are available in the plasmid-based system compared to the LV-based system (1.3 × 10<sup>4 </sup>plasmids per cell compared to 22 2-LTR DNA circles per cell). However, as we found that 50% of the hygromycin B-resistant clones were the result of 2-LTR circle insertions, we estimate that the high number of plasmids available in transfected cells produced only 52 times more hygromycin B-resistant colonies than transduced 2-LTR episomes (2546 versus 48.5 colonies), leading to the assumption that LV-derived 2-LTR circular DNA is more efficiently integrated than plasmid-based substrates. Possible explanations for this finding, including varying substrate concentrations in different cellular compartments and differences in accessibility caused by structural substrate constraints (relaxed versus supercoiled substrates), are currently subjects for further scrutiny. Comparable levels of colony formation in experiments using IDLVs as a source of Flp recombinase and/or circular DNA substrates (Figure ##FIG##2##3B, C##, and ##FIG##2##3D##) indicate that both virus-derived Flp and DNA substrates are limiting factors for efficient Flp-based gene insertion.</p>","<p>By integrating viral circles rather than plasmid DNA, we obtained Flp-based insertions that are not potentially harnessed by bacterial sequences derived from the plasmid backbone. A recent <italic>in vivo </italic>study has shown an increase in heterochromatin-like histone modifications correlating with lower levels of transgene expression from transfected plasmids containing bacterial sequences compared to plasmids devoid of bacteria-derived DNA [##REF##17457320##21##]. Together, our findings provide a novel tool for Flp-based genetic engineering and pave the way for future applications of lentiviral DNA circles as potential substrates for more therapeutic relevant nonviral integration machineries in somatic gene transfer.</p>"],"string":"[\n \"<title>Results and Discussion</title>\",\n \"<p>To provide proof-of-principle that <italic>trans</italic>-acting nonviral recombinases are able to gain access to lentivirally delivered substrates and facilitate their insertion, we designed an LV-derived hybrid integration system based upon the integrating properties of the yeast Flp recombinase. First, we constructed an LV substrate vector, pLV/FRT-hygro, containing an ATG-deficient FRT-hygro fusion cassette in the context of a self-inactivating (SIN) LV vector (Figure ##FIG##0##1A##). The Flp recombination target (FRT) sequence is recognized by the Flp recombinase which mediates recombination between two identical FRT sites. By including the FRT sequence in this vector, we reasoned that LV DNA circles generated during vector transduction would serve as substrates for Flp-dependent site-directed insertion of viral DNA into FRT sites engineered into the genome of transduced cells. Integration of the ATG-deficient FRT-hygro fusion gene into an engineered FRT site flanked upstream by a promoter and an ATG sequence would regenerate a functional hygromycin B expression cassette, allowing selection of cells containing site-directed vector insertion (Figure ##FIG##0##1B##). Hence, by using a site-directed Flp-based approach, we were able to score circle insertions selectively but also suspected a low circle insertion rate due to strong limitations on available target sites in the transduced cells.</p>\",\n \"<p>The conditions for the Flp-based integration machinery were optimized by packaging vector RNA in virus particles carrying an inactive viral integrase protein harboring the class I D64V mutation [##REF##8551608##15##]. By blocking the normal viral integration machinery, we were able to increase the copy number of 2-LTR circles from 3.8 to 22 circles per cell (Figure ##FIG##1##2##) corresponding to a 3.9-fold increase of circular DNA (correlated to the total amount of HIV-1 DNA) available for Flp-based recombination in transduced cells (Figure ##FIG##1##2##). To rule out possible overestimation of the total vector DNA due to plasmid contamination, we carried out a quantitative PCR analysis using a plasmid-specific primer set amplifying an amplicon within the Amp resistance gene in the plasmid backbone. Although within the detection limit of the assay, the level of contaminating plasmids was neglectable relative to measured copy numbers of total vector DNA (data not shown) and considered, therefore, to be without notable influence on measurements of total vector DNA. Importantly, the integrase mutation did not influence production or transduction capacity of the viral particles, since p24 values of the virus preparations and the total amount of episomal vector DNA present in the transduced cells were comparable between vector preparations carrying active and inactive viral integrase (Figure ##FIG##1##2##). In accordance with previous reports [##REF##17700544##6##,##REF##17593926##16##] the titer of integrase-deficient vectors was reduced approximately 1000-fold (from ~10<sup>8 </sup>to ~10<sup>5 </sup>CFU/ml) compared to vectors carrying the active integrase (data not shown).</p>\",\n \"<p>To tag chromosomal DNA with recognition sequences for the Flp recombinase, we generated a Sleeping Beauty [##REF##9390559##14##] (SB) transposon-derived docking vector, pSBT/RSV-FGIP, containing the Flp recombination target (FRT) sequence as part of a new active fusion variant of the eGFP reporter gene (Figure ##FIG##0##1A##). The eGFP fusion gene, containing an FRT sequence between the start codon and the remaining part of the eGFP coding sequence, was flanked downstream by an IRES element and the puromycin resistance gene. The docking SB transposon was inserted into the genomic DNA of HEK-293 cells by co-transfection of pSBT/RSV-FGIP with pCMV-SB, a plasmid encoding the SB transposase. To provide optimal conditions for subsequent Flp-based gene insertion, we utilized conditions which in our hands consistently allow insertion of >1 vector in transfected HEK-293 cells. The rationale was to create a cell line tagged with at least two docking sites. Among several eGFP-positive HEK-293 cell lines that were generated by puromycin selection, one cell line, HEK/FGIP1, was utilized for further studies. This particular cell line was found to contain at least 3 vector insertions, as determined by Southern blot analysis (data not shown). To confirm functionality of the FRT sequence in the context of the eGFP fusion gene, HEK/FGIP1 cells were co-transfected with 2 μg plasmid carrying an ATG-deficient FRT-hygro cassette (pLV/FRT-hygro) and 10 μg plasmid encoding Flp recombinase. Subsequent hygromycin B selection demonstrated efficient insertion into the engineered FRT site (Figure ##FIG##2##3A##). Analysis of the transfected HEK-SB/FGIP1 cells by quantitative PCR (data not shown) showed that each cell on average contained 1.3 × 10<sup>4 </sup>± 2.3 × 10<sup>3 </sup>FRT-tagged donor plasmids 24 hours after transfection, leading to an estimated insertion rate of 2.8 × 10<sup>-7 </sup>Flp-based insertions per single copy of transfected FRT-hygro-containing plasmid in the culture. Notably, co-transfection of FRT-hygro substrate plasmid with a negative control plasmid did not result in colony formation, demonstrating the absolute lack of false positives in the system. As expected by the presence of >1 docking insertion in this cell line, eGFP expression was not turned off in hygromycin B resistant cells due to the fact that not all docking sites had been targeted by Flp recombination. However, subsequent PCR and sequence analysis of multiple hygromycin B-resistant clones confirmed correct Flp-based plasmid insertion in the eGFP gene of the integrated docking vector (data not shown). In summary, these data provide evidence that the Flp docking construction containing the novel FRT-eGFP fusion gene is functional in context of an integrated SB vector.</p>\",\n \"<p>During lentiviral transduction double-stranded viral DNA is transported through the nuclear membrane as part of the PIC consisting of both viral and cellular proteins. Attempts to access the viral DNA by nonviral recombinases may therefore be hampered by the reduced DNA accessibility within the context of the PIC. To demonstrate that Flp indeed can gain access to the circular viral DNA and facilitate genomic insertion of LV circular substrates, we transfected the HEK/FGIP1 cell line with a Flp expression plasmid one day prior to transduction with the integration-defective (ID) LV/FRT-hygro vector (see Figure ##FIG##0##1A##). After hygromycin B selection 97 ± 15 resistant colonies were obtained (Figure ##FIG##2##3B##), whereas resistant colonies could not be detected in cells transfected with an empty control plasmid prior to IDLV/FRT-hygro transduction.</p>\",\n \"<p>To examine whether IDLVs, co-transduced with DNA circle donor IDLVs, could serve as a source of Flp recombinase we created an LV SIN vector, pLV/PGK-Flpx9, containing a PGK-driven Flp gene (Figure ##FIG##0##1A##). First, HEK/FGIP1 cells were transduced with IDLV/PGK-Flp and on the following day transfected with an FRT-tagged plasmid substrate (pLV/FRT-hygro). After two weeks of hygromycin B selection, we detected 35 ± 9 drug-resistant colonies as a result of Flp-mediated plasmid insertion (Figure ##FIG##2##3C##), whereas transduction with a viral vector, IDLV/PGK-eGFP, lacking the Flp expression cassette did not result in any colony formation. These findings demonstrated that Flp recombinase, transiently expressed from integration-defective LV vectors, was able to confer substrate recombination and site-specific gene insertion. We finally co-transduced the HEK/FGIP1 cell line with IDLV/FRT-hygro and IDLV/PGK-Flp and subsequently selected transduced cells for hygromycin B resistance. In this setup, we obtained 58 ± 6 colonies per co-transduction (Figure ##FIG##2##3D##). To examine whether the efficiency of Flp-directed gene insertion varied among clones tagged with the docking vector, we generated five additional FRT-tagged HEK clones (HEK/FGIP2-6). All these cell lines demonstrated levels of eGFP expression that were comparable with the expression of eGFP in HEK/FGIP1 as measured by FACS analysis (data not shown). By co-transduction of these cell lines with IDLV/FRT-hygro and IDLV/PGK-Flp we obtained from 15 to 35 hygromycin B-resistant colonies (Figure ##FIG##2##3E##), indicating that efficiency of LV circle insertion varied only to a small degree between the tested FRT-tagged clones.</p>\",\n \"<p>To demonstrate that the DNA circles were precisely inserted by Flp into the FRT docking site, we first analyzed five representative clones by southern blot analysis of genomic DNA digested with Xba<italic>I</italic>, which cuts within the duplicated FRT sequences (Figure ##FIG##3##4A##). This analysis verified that full-length circles had been site-specifically inserted. To further characterize the inserted DNA circles 22 clones (10 and 12 clones from figure ##FIG##2##3B## and ##FIG##2##3D##, respectively) were isolated and analyzed. PCR amplification of genomic DNA using primer sets flanking the upstream and downstream FRT junction sites, respectively, resulted in PCR fragments indicative of site-specific circle insertion into the SB-tagged locus (Figure ##FIG##3##4B##, <bold>panel I–II and V–VI</bold>). Sequencing of these PCR products confirmed precise recombination between the genomic FRT site and the circle-associated FRT site, except for one clone (clone 14) in which part of the downstream region of the vector had been deleted. Although this clone carried marks of an inaccurate circle insertion, it could alternatively be the result of Flp-based recombination between a linear substrate and the genomic FRT site. In theory, linear substrates may be as efficient substrates as their circular counterparts but the outcome of vector incorporation into the genomic FRT site may differ. Whereas circular forms are resolved by the Flp recombinase into the genomic site without generating DNA breaks, linear forms containing free LTR ends would be expected to generate potentially harmful double-strand DNA breaks. Such complications would suggest that LV hybrid systems based upon cut-and-paste transposases acting on circular and linear substrates may be advantageous and perhaps safer than recombinase-based systems.</p>\",\n \"<p>Next, we carried out PCR amplification and sequencing of fragments containing the LTRs of the site-directed insertions. Eight 1-LTR and fourteen 2-LTR circle integrations, created by Flp-based insertion of circles generated by homologous recombination and NHEJ, respectively, were detected (Figure ##FIG##3##4B##, <bold>panel III and VII</bold>) confirming that the integrated DNA in each clone was indeed derived from circular substrates. We analyzed 33 additional clones and from a total of 55 clones, 30 1-LTR and 25 2-LTR insertions were identified (data not shown). According to previous findings claiming a 9:1 ratio of 1-LTR to 2-LTR circles present in transduced cells [##REF##11329067##17##], there appears to be a preference for insertion of 2-LTR circles in our system. Although this finding could reflect differences in the cellular location of circle species and/or their accessibility for proteins <italic>in trans</italic>, possible explanations remain speculative. Altogether, our data demonstrate that DNA circles generated during lentiviral transduction are indeed accessible for nonviral integrases <italic>in trans </italic>and may serve as substrates for genomic recombination by Flp protein transiently delivered by an integration-defective vector.</p>\",\n \"<p>Based upon 2-LTR copy numbers, measured by q-PCR, we calculated an estimated insertion rate of 1.7 × 10<sup>-5 </sup>Flp-based insertions per single copy of transduced 2-LTR circle (number of drug-resistant colonies containing a 2-LTR insertion/(number of 2-LTR circles per cell × total number of transduced cells)), leading us to suggest that 2-LTR circles, in comparison to transfected plasmid DNA, might be more efficient substrates for Flp-based recombination.</p>\",\n \"<p>The D64V mutation in the HIV-1 integrase protein removes all enzymatic activity of the protein and has been reported to reduce integration of vector DNA 1.000–10.000-fold [##REF##17700544##6##,##REF##8551608##15##,##REF##17593926##16##]. We reproducibly measured a 1000-fold reduction by colony-forming assays and, hence, could not formally rule out that integrase-independent insertion of linear IDLV/FRT-hygro or IDLV/PGK-Flp could have occurred in hygromycin B-selected clones. We therefore verified by PCR analysis that unspecific integration of linear vector DNA had not occurred in any of the hygromycin B-resistant clones (Figure ##FIG##3##4B##, <bold>IV </bold>and <bold>VII–IX</bold>), providing proof that the cell clones carrying a site-directed insertion did not carry additional background vector insertions.</p>\",\n \"<p>Our findings provide, to our knowledge, the first proof-of-principle that integration of lentiviral DNA can be facilitated by a nonviral recombinase, thereby altering the integration profile of LV vectors – in this case towards a site-directed profile using DNA circles as a substrate for gene insertion. The normal catalytic activities of the lentiviral integrase were replaced in a drug-selective approach with the site-directed properties of the yeast Flp recombinase. As Flp recognition sites are not present in the human genome, an eGFP fusion gene containing the FRT sequences was inserted by a novel transposon-based FRT docking vector prior to IDLV transduction. The site-directed approach allowing insertion only in the genomic engineered sites resulted, as expected, in a fairly low insertion rate. As more potent alternatives, LV-hybrids with integration machineries derived from the phage ΦC31 integrase [##REF##11359900##18##], hyperactive Sleeping Beauty transposases [##REF##15456893##19##] or the AAV Rep protein [##REF##9311886##20##] will have direct relevance in human cells, although cut-and-paste transposon systems would be preferred to mimimize the risk of generating double-strand DNA breaks as a possible outcome of recombinase-based insertion of linear substrates. Site-directed integration technologies based on the recombination capabilities of tyrosine recombinases as Cre or Flp have been widely used to direct targeted insertion of nonviral DNA plasmid substrates into genomic recognition sites. Flp-mediated plasmid insertion routinely allows genetic engineering of easy-to-transfect cell lines and has become pivotal in comparative gene expression studies in which integrated transgenes of interest may otherwise be variably influenced by the surrounding DNA. Our data describe a lentivirus-based technology with possible implication for Flp-mediated gene insertion in hard-to-transfect cell lines or potentially in FRT-tagged tissues or primary cells that are not easily transfected. Recent evidence has supported the fact that episomal lentiviral circles are highly stable in non-dividing cells and may provide persistent transgene expression in vivo [##REF##16491086##8##]. For many applications, the stability of lentiviral circles in non-dividing cells does not call for genomic integration of the transgene. Nevertheless, stable viral episomes may represent permanent targets for recombinase-directed insertion of lentiviral circles in non-dividing cells.</p>\",\n \"<p>The obvious difference in efficiency (as measured by the number of hygromycin B-resistant colonies) between plasmid- and the LV circle-based Flp integration systems (Figure ##FIG##2##3A## versus Figure ##FIG##2##3B## and ##FIG##2##3D##) may reflect differences in the availability of circular substrates in the two systems (plasmid DNA versus LV circles) or, alternatively, that plasmid DNA is somehow better suited for Flp-based insertion. Quantitative PCR analyses comparing the number of plasmids in transfected cells with the number of episomal 2-LTR DNA circles in LV-transduced cells indicated that about 600 times more episomal DNA circles are available in the plasmid-based system compared to the LV-based system (1.3 × 10<sup>4 </sup>plasmids per cell compared to 22 2-LTR DNA circles per cell). However, as we found that 50% of the hygromycin B-resistant clones were the result of 2-LTR circle insertions, we estimate that the high number of plasmids available in transfected cells produced only 52 times more hygromycin B-resistant colonies than transduced 2-LTR episomes (2546 versus 48.5 colonies), leading to the assumption that LV-derived 2-LTR circular DNA is more efficiently integrated than plasmid-based substrates. Possible explanations for this finding, including varying substrate concentrations in different cellular compartments and differences in accessibility caused by structural substrate constraints (relaxed versus supercoiled substrates), are currently subjects for further scrutiny. Comparable levels of colony formation in experiments using IDLVs as a source of Flp recombinase and/or circular DNA substrates (Figure ##FIG##2##3B, C##, and ##FIG##2##3D##) indicate that both virus-derived Flp and DNA substrates are limiting factors for efficient Flp-based gene insertion.</p>\",\n \"<p>By integrating viral circles rather than plasmid DNA, we obtained Flp-based insertions that are not potentially harnessed by bacterial sequences derived from the plasmid backbone. A recent <italic>in vivo </italic>study has shown an increase in heterochromatin-like histone modifications correlating with lower levels of transgene expression from transfected plasmids containing bacterial sequences compared to plasmids devoid of bacteria-derived DNA [##REF##17457320##21##]. Together, our findings provide a novel tool for Flp-based genetic engineering and pave the way for future applications of lentiviral DNA circles as potential substrates for more therapeutic relevant nonviral integration machineries in somatic gene transfer.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>Site-specific integration systems as Cre and Flp are important tools in genetic engineering and animal transgenesis but can in some instances be hampered by the requirement for transfection of plasmid DNA. Lentiviral vectors efficiently transduce both proliferating and quiescent cells but have a preference for integration into transcriptional units thereby representing a potential risk of insertional mutagenesis. A portion of the lentiviral DNA in transduced cells is converted into episomal circlular forms. We have herein demonstrated for the first time that an exogenous recombinase has access to lentiviral DNA as substrate for DNA insertion with the potential of altering the integration profile of HIV-1-derived vectors. In the present setup we combined lentiviral delivery with the site-specific integration properties of the Flp recombinase in a drug-selective approach. By packaging the viral vector with the inactive D64V integrase mutant we were able to increase the amount of circular substrates 4-fold and at the same time abolish the viral integration machinery. We demonstrate that both 1- and 2-LTR circles were inserted into engineered FRT acceptor sites in the genome of human cells by <italic>trans</italic>-acting Flp recombinase delivered either by Flp-encoding transfected plasmid DNA or by co-transduced integrase-defective lentiviral vectors carrying a Flp expression cassette. Among several advantages of this approach, genetic cargo inserted as viral DNA circles is not potentially harnessed by bacterial sequences derived from the plasmid backbone, the latter which is believed to negatively affect the long-term stability of transgene expression. Moreover, this hybrid lenti-Flp technology may be usefull in studies that require Flp-mediated gene insertion in hard-to-transfect cell lines. Our findings provide evidence that <italic>trans</italic>-acting integrases are able to gain access to and insert transduced lentiviral DNA and open up for the development of new hybrid systems which do not rely on an engineered genomic target sequence and which are based on more therapeutically relevant recombinases or transposases for potential use in gene transfer.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>Site-specific integration systems as Cre and Flp are important tools in genetic engineering and animal transgenesis but can in some instances be hampered by the requirement for transfection of plasmid DNA. Lentiviral vectors efficiently transduce both proliferating and quiescent cells but have a preference for integration into transcriptional units thereby representing a potential risk of insertional mutagenesis. A portion of the lentiviral DNA in transduced cells is converted into episomal circlular forms. We have herein demonstrated for the first time that an exogenous recombinase has access to lentiviral DNA as substrate for DNA insertion with the potential of altering the integration profile of HIV-1-derived vectors. In the present setup we combined lentiviral delivery with the site-specific integration properties of the Flp recombinase in a drug-selective approach. By packaging the viral vector with the inactive D64V integrase mutant we were able to increase the amount of circular substrates 4-fold and at the same time abolish the viral integration machinery. We demonstrate that both 1- and 2-LTR circles were inserted into engineered FRT acceptor sites in the genome of human cells by <italic>trans</italic>-acting Flp recombinase delivered either by Flp-encoding transfected plasmid DNA or by co-transduced integrase-defective lentiviral vectors carrying a Flp expression cassette. Among several advantages of this approach, genetic cargo inserted as viral DNA circles is not potentially harnessed by bacterial sequences derived from the plasmid backbone, the latter which is believed to negatively affect the long-term stability of transgene expression. Moreover, this hybrid lenti-Flp technology may be usefull in studies that require Flp-mediated gene insertion in hard-to-transfect cell lines. Our findings provide evidence that <italic>trans</italic>-acting integrases are able to gain access to and insert transduced lentiviral DNA and open up for the development of new hybrid systems which do not rely on an engineered genomic target sequence and which are based on more therapeutically relevant recombinases or transposases for potential use in gene transfer.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>Circular forms of viral genomic DNA are generated during infection of cells with retroviruses like HIV-1. Such circles are unable to replicate and are eventually lost as a result of cell division, lending support to the prevalent notion that episomal retroviral DNA forms are dead-end products of reverse transcription.</p>","<title>Results</title>","<p>We demonstrate that circular DNA generated during transduction with HIV-1-based lentiviral vectors can be utilized as substrate for gene insertion directed by nonviral recombinases co-expressed in the target cells. By packaging of lentiviral genomic RNA in integrase-defective lentiviral vectors, harboring an inactive form of the viral integrase, the normal pathway for viral integration is blocked and circular vector DNA accumulates in transduced cells as a result. We find that the amount of DNA circles is increased 4-fold in cells transduced with integration-defective vectors relative to cells treated with integrase-proficient vectors. By transduction of target cells harboring engineered recognition sites for the yeast Flp recombinase with integration-defective lentiviral vectors containing an ATG-deficient hygromycin B selection gene we demonstrate precise integration of lentiviral vector-derived DNA circles in a drug-selective approach. Moreover, it is demonstrated that <italic>trans</italic>-acting Flp recombinase can be delivered by Flp-encoding transfected plasmid DNA or, alternatively, by co-transduced integrase-defective lentiviral vectors carrying a Flp expression cassette.</p>","<title>Conclusion</title>","<p>Our data provide proof-of-principle that nonviral recombinases, like Flp, produced by plasmid DNA or non-integrating lentiviral vectors can gain access to circular viral recombination substrates and facilitate site-directed genomic insertion of such episomal DNA forms. Replacement of the normal viral integration machinery with nonviral mediators of integration represents a new platform for creation of lentiviral vectors with an altered integration profile.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>Circular forms of viral genomic DNA are generated during infection of cells with retroviruses like HIV-1. Such circles are unable to replicate and are eventually lost as a result of cell division, lending support to the prevalent notion that episomal retroviral DNA forms are dead-end products of reverse transcription.</p>\",\n \"<title>Results</title>\",\n \"<p>We demonstrate that circular DNA generated during transduction with HIV-1-based lentiviral vectors can be utilized as substrate for gene insertion directed by nonviral recombinases co-expressed in the target cells. By packaging of lentiviral genomic RNA in integrase-defective lentiviral vectors, harboring an inactive form of the viral integrase, the normal pathway for viral integration is blocked and circular vector DNA accumulates in transduced cells as a result. We find that the amount of DNA circles is increased 4-fold in cells transduced with integration-defective vectors relative to cells treated with integrase-proficient vectors. By transduction of target cells harboring engineered recognition sites for the yeast Flp recombinase with integration-defective lentiviral vectors containing an ATG-deficient hygromycin B selection gene we demonstrate precise integration of lentiviral vector-derived DNA circles in a drug-selective approach. Moreover, it is demonstrated that <italic>trans</italic>-acting Flp recombinase can be delivered by Flp-encoding transfected plasmid DNA or, alternatively, by co-transduced integrase-defective lentiviral vectors carrying a Flp expression cassette.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>Our data provide proof-of-principle that nonviral recombinases, like Flp, produced by plasmid DNA or non-integrating lentiviral vectors can gain access to circular viral recombination substrates and facilitate site-directed genomic insertion of such episomal DNA forms. Replacement of the normal viral integration machinery with nonviral mediators of integration represents a new platform for creation of lentiviral vectors with an altered integration profile.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Authors' contributions</title>","<p>BM, NHS, and JGM conceived and designed the experiments and the hybrid vector constructs. RJYM assisted during development of the experimental design. All vectors were constructed by BM. Cell culture analyses were performed by BM, and molecular analyses were carried out by BM, NHS and MJ. JGM mentored BM, NHS and MJ in construction work and data analysis. BM drafted the manuscript along with NHS and JGM, and JGM completed the manuscript preparation. All authors read and approved the final manuscript.</p>"],"string":"[\n \"<title>Authors' contributions</title>\",\n \"<p>BM, NHS, and JGM conceived and designed the experiments and the hybrid vector constructs. RJYM assisted during development of the experimental design. All vectors were constructed by BM. Cell culture analyses were performed by BM, and molecular analyses were carried out by BM, NHS and MJ. JGM mentored BM, NHS and MJ in construction work and data analysis. BM drafted the manuscript along with NHS and JGM, and JGM completed the manuscript preparation. All authors read and approved the final manuscript.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>We thank Finn Skou Pedersen (Department of Molecular Biology, University of Aarhus, Aarhus, Denmark) for providing pecoenv-IRES-puro, Adrian Thrasher (Institute of Child Health, University College London, London, UK) for providing pMDLg/pRREintD64V, and Patrick Aebischer (Swiss Federal Institute of Technology, EPFL, Lausanne, Switzerland) for providing lentiviral SIN vectors. This work was made possible through the generous support by the Danish Medical Research Council, the Novo Nordisk Foundation, the Carlsberg Foundation, the Danish Cancer Society, Aage Bangs Foundation, and the EU (EU-FP6-STREP, contract number 018961). B.M. was funded by a grant from the Danish Cancer Society.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>We thank Finn Skou Pedersen (Department of Molecular Biology, University of Aarhus, Aarhus, Denmark) for providing pecoenv-IRES-puro, Adrian Thrasher (Institute of Child Health, University College London, London, UK) for providing pMDLg/pRREintD64V, and Patrick Aebischer (Swiss Federal Institute of Technology, EPFL, Lausanne, Switzerland) for providing lentiviral SIN vectors. This work was made possible through the generous support by the Danish Medical Research Council, the Novo Nordisk Foundation, the Carlsberg Foundation, the Danish Cancer Society, Aage Bangs Foundation, and the EU (EU-FP6-STREP, contract number 018961). B.M. was funded by a grant from the Danish Cancer Society.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Strategy for Flp-directed integration of lentiviral DNA circles. (<bold>A) </bold>Schematic representation of vectors utilized for lentiviral transduction and generation of Sleeping Beauty vector-tagged cell lines. The lentiviral vector, pLV/FRT-hygro, is a third generation SIN vector containing an ATG-deficient FRT-hygro fusion gene located between the packaging signal (ψ) and the central polypurine tract (cPPT, not shown) flanked downstream by a selectable marker expression cassette. In the lentiviral SIN vector pLV/PGK-puro the PGK-driven Flpx9 expression cassette is located downstream from ψ and cPPT sequence (the latter not shown). The SB transposon docking vector, pSBT/RSV-FGIP, contains the left and inverted repeats of SB (LIR and RIR, represented by white arrows) and an expression cassette containing the RSV promoter driving a fusion gene consisting of an ATG-FRT-tagged eGFP gene, an IRES element, the puromycin-resistance gene, and a polyadenylation signal. (<bold>B</bold>) Schematic representation of site-directed integration of LV DNA circles. After reverse transcription of the viral RNA, circular forms of the viral genomic DNA are generated by either non-homologous end joining (2-LTR) or homologous recombination (1-LTR). These circles are normally considered dead-end products of reverse transcription but the FRT site will enable DNA circles to become substrates for Flp recombination. In cells harboring an engineered FRT site flanked by a promoter and a start codon, Flp-mediated insertion of the virus-derived (i) 1-LTR circles and (ii) 2-LTR circles will generate a functional hygromycin B resistance expression cassette. To block the normal viral integration machinery, integration-defective lentiviral vectors (IDLVs), carrying an inactive viral integrase protein (harboring the D64A mutation), were utilized as carriers of viral RNA. Puro, puromycin resistance gene; LTR, long terminal repeat; FRT, Flp recombination target site.</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Blockage of the normal viral integration machinery increases the formation of LV DNA circles in transduced cells. HEK-SB/FGIP cells were infected with integration-proficient or integration-deficient lentiviral vectors. Hirt DNA was harvested 24 hours post-transduction and subsequently used for Q-PCR analysis to determine the amount of linear and circular lentiviral DNA. Transductions were performed in triplicates and presented as mean value + SD.</p></caption></fig>","<fig position=\"float\" id=\"F3\"><label>Figure 3</label><caption><p>Episomal lentiviral DNA can act both as a substrate for Flp recombination and as a source of Flp recombinase for site-directed genomic integration. (<bold>A</bold>) Flp-mediated integration of plasmids into FRT-tagged HEK-derived cell line. The HEK/FGIP1 cell line was transfected with pLV/FRT-hygro and pCMV-Flp or a negative control and selected for hygromycin B resistance. (<bold>B</bold>) Flp-mediated integration of lentiviral DNA circles. HEK/FGIP1 cells were transfected with pCMV-Flp or a negative control one day prior to transduction with the IDLV/FRT-hygro vector. (<bold>C</bold>) Transient expression of Flp recombinase from integration-defective LV vectors is sufficient for site-directed insertion of donor plasmid. HEK/FGIP1 cells were transduced with IDLV/PGK-Flp or a negative control and on the following day transfected with pLV/FRT-hygro. (<bold>D-E</bold>) IDLV-encoded Flp catalyzes site-directed genomic integration of lentiviral DNA circles. HEK/FGIP1-6 cells were co-transduced with IDLV/FRT-hygro and IDLV/PGK-Flp or a negative control. Transfections/transductions were performed in triplicates (except for in panel E in which n = 1) and presented as mean value + SD.</p></caption></fig>","<fig position=\"float\" id=\"F4\"><label>Figure 4</label><caption><p><bold>Southern blot and PCR analysis confirm precise insertion of lentiviral derived DNA circles </bold>(<bold>A</bold>) Southern blot analysis of representative hygromycin B-resistant clones containing inserted lentiviral circles. Genomic DNA was digested with Xba<italic>I</italic>, which cuts within the duplicated FRT sites, generating a ~5400/5630-bp fragment (1-LTR and 2-LTR insertions, respectively) recognized by the indicated hygro probe. Length differences between 1- and 2-LTR insertions could be resolved on a shorter exposure of the membrane (not shown). (<bold>B</bold>) PCR-based characterization of vector insertions in transduced cells. Genomic DNA from ten (taken from (<bold>3B</bold>)) and twelve (taken from (<bold>3D</bold>)) hygromycin B-resistant clones was used for PCR analysis to confirm site-specific insertion into an engineered FRT site (panel I–II and V–VI), integration of circular DNA substrates containing one or two LTRs (panel III and VII), and finally to verify that unspecific insertions of IDLV/FRT-hygro or IDLV/PGK-Flp had not occurred (panel IV and VIII–IX). N and P indicate negative (HEK/FGIP1) and positive (pLV/FRT-hygro or pLV/PGK-Flp) control clones, respectively.</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p>Strategy for Flp-directed integration of lentiviral DNA circles. (<bold>A) </bold>Schematic representation of vectors utilized for lentiviral transduction and generation of Sleeping Beauty vector-tagged cell lines. The lentiviral vector, pLV/FRT-hygro, is a third generation SIN vector containing an ATG-deficient FRT-hygro fusion gene located between the packaging signal (ψ) and the central polypurine tract (cPPT, not shown) flanked downstream by a selectable marker expression cassette. In the lentiviral SIN vector pLV/PGK-puro the PGK-driven Flpx9 expression cassette is located downstream from ψ and cPPT sequence (the latter not shown). The SB transposon docking vector, pSBT/RSV-FGIP, contains the left and inverted repeats of SB (LIR and RIR, represented by white arrows) and an expression cassette containing the RSV promoter driving a fusion gene consisting of an ATG-FRT-tagged eGFP gene, an IRES element, the puromycin-resistance gene, and a polyadenylation signal. (<bold>B</bold>) Schematic representation of site-directed integration of LV DNA circles. After reverse transcription of the viral RNA, circular forms of the viral genomic DNA are generated by either non-homologous end joining (2-LTR) or homologous recombination (1-LTR). These circles are normally considered dead-end products of reverse transcription but the FRT site will enable DNA circles to become substrates for Flp recombination. In cells harboring an engineered FRT site flanked by a promoter and a start codon, Flp-mediated insertion of the virus-derived (i) 1-LTR circles and (ii) 2-LTR circles will generate a functional hygromycin B resistance expression cassette. To block the normal viral integration machinery, integration-defective lentiviral vectors (IDLVs), carrying an inactive viral integrase protein (harboring the D64A mutation), were utilized as carriers of viral RNA. Puro, puromycin resistance gene; LTR, long terminal repeat; FRT, Flp recombination target site.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p>Blockage of the normal viral integration machinery increases the formation of LV DNA circles in transduced cells. HEK-SB/FGIP cells were infected with integration-proficient or integration-deficient lentiviral vectors. Hirt DNA was harvested 24 hours post-transduction and subsequently used for Q-PCR analysis to determine the amount of linear and circular lentiviral DNA. Transductions were performed in triplicates and presented as mean value + SD.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F3\\\"><label>Figure 3</label><caption><p>Episomal lentiviral DNA can act both as a substrate for Flp recombination and as a source of Flp recombinase for site-directed genomic integration. (<bold>A</bold>) Flp-mediated integration of plasmids into FRT-tagged HEK-derived cell line. The HEK/FGIP1 cell line was transfected with pLV/FRT-hygro and pCMV-Flp or a negative control and selected for hygromycin B resistance. (<bold>B</bold>) Flp-mediated integration of lentiviral DNA circles. HEK/FGIP1 cells were transfected with pCMV-Flp or a negative control one day prior to transduction with the IDLV/FRT-hygro vector. (<bold>C</bold>) Transient expression of Flp recombinase from integration-defective LV vectors is sufficient for site-directed insertion of donor plasmid. HEK/FGIP1 cells were transduced with IDLV/PGK-Flp or a negative control and on the following day transfected with pLV/FRT-hygro. (<bold>D-E</bold>) IDLV-encoded Flp catalyzes site-directed genomic integration of lentiviral DNA circles. HEK/FGIP1-6 cells were co-transduced with IDLV/FRT-hygro and IDLV/PGK-Flp or a negative control. Transfections/transductions were performed in triplicates (except for in panel E in which n = 1) and presented as mean value + SD.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F4\\\"><label>Figure 4</label><caption><p><bold>Southern blot and PCR analysis confirm precise insertion of lentiviral derived DNA circles </bold>(<bold>A</bold>) Southern blot analysis of representative hygromycin B-resistant clones containing inserted lentiviral circles. Genomic DNA was digested with Xba<italic>I</italic>, which cuts within the duplicated FRT sites, generating a ~5400/5630-bp fragment (1-LTR and 2-LTR insertions, respectively) recognized by the indicated hygro probe. Length differences between 1- and 2-LTR insertions could be resolved on a shorter exposure of the membrane (not shown). (<bold>B</bold>) PCR-based characterization of vector insertions in transduced cells. Genomic DNA from ten (taken from (<bold>3B</bold>)) and twelve (taken from (<bold>3D</bold>)) hygromycin B-resistant clones was used for PCR analysis to confirm site-specific insertion into an engineered FRT site (panel I–II and V–VI), integration of circular DNA substrates containing one or two LTRs (panel III and VII), and finally to verify that unspecific insertions of IDLV/FRT-hygro or IDLV/PGK-Flp had not occurred (panel IV and VIII–IX). N and P indicate negative (HEK/FGIP1) and positive (pLV/FRT-hygro or pLV/PGK-Flp) control clones, respectively.</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":[],"string":"[]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1472-6750-8-60-1\"/>","<graphic xlink:href=\"1472-6750-8-60-2\"/>","<graphic xlink:href=\"1472-6750-8-60-3\"/>","<graphic xlink:href=\"1472-6750-8-60-4\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1472-6750-8-60-1\\\"/>\",\n \"<graphic xlink:href=\\\"1472-6750-8-60-2\\\"/>\",\n \"<graphic xlink:href=\\\"1472-6750-8-60-3\\\"/>\",\n \"<graphic xlink:href=\\\"1472-6750-8-60-4\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":21,"string":"21"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:38"},"citation":{"kind":"string","value":"BMC Biotechnol. 2008 Aug 9; 8:60"},"package_file":{"kind":"string","value":"oa_package/2f/f2/PMC2538528.tar.gz"}}},{"rowIdx":119693,"cells":{"accession_id":{"kind":"string","value":"PMC2538529"},"pmid":{"kind":"string","value":"18700989"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>Small supernumerary marker chromosomes occur in 0.075% of unselected prenatal cases and in 0.044% of consecutively studied postnatal cases, and majority of them are <italic>de novo </italic>in origin [##REF##17901697##1##, ####REF##3857214##2##, ##REF##9482642##3##, ##REF##15508017##4####15508017##4##]. Phenotype of individuals with <italic>de novo </italic>sSMC vary from normal to extremely mild or severe, depending on the chromosomal region involved and the euchromatic content present [##REF##16276087##5##, ####UREF##0##6##, ##REF##13680362##7####13680362##7##]. Although a number of reports describe the occurrence of a variety of sSMC for nearly all the chromosomes, the number for each type is not large enough to suggest a good genotype-phenotype correlation for a given sSMC, except for inv dup(15) and inv dup(22) where the phenotypic consequences are well described [##UREF##0##6##,##REF##7532149##8##, ####REF##9375728##9##, ##REF##1928105##10####1928105##10##]. We describe here the phenotype and corresponding molecular cytogenetic results of a child with dysmorphic features. This is yet another case of analphoid 3q supernumerary marker chromosome involving a new break point at 3q25.33. The marker is characterized as inversion-duplication 3q25.33-qter by oligo aCGH and FISH studies and it also reveals tissue specific mosaicism.</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>Small supernumerary marker chromosomes occur in 0.075% of unselected prenatal cases and in 0.044% of consecutively studied postnatal cases, and majority of them are <italic>de novo </italic>in origin [##REF##17901697##1##, ####REF##3857214##2##, ##REF##9482642##3##, ##REF##15508017##4####15508017##4##]. Phenotype of individuals with <italic>de novo </italic>sSMC vary from normal to extremely mild or severe, depending on the chromosomal region involved and the euchromatic content present [##REF##16276087##5##, ####UREF##0##6##, ##REF##13680362##7####13680362##7##]. Although a number of reports describe the occurrence of a variety of sSMC for nearly all the chromosomes, the number for each type is not large enough to suggest a good genotype-phenotype correlation for a given sSMC, except for inv dup(15) and inv dup(22) where the phenotypic consequences are well described [##UREF##0##6##,##REF##7532149##8##, ####REF##9375728##9##, ##REF##1928105##10####1928105##10##]. We describe here the phenotype and corresponding molecular cytogenetic results of a child with dysmorphic features. This is yet another case of analphoid 3q supernumerary marker chromosome involving a new break point at 3q25.33. The marker is characterized as inversion-duplication 3q25.33-qter by oligo aCGH and FISH studies and it also reveals tissue specific mosaicism.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<title>Cytogenetic and fish studies</title>","<p>Cytogenetic study was carried out on peripheral blood lymphocytes by G-banding according to the standard procedures [##UREF##4##20##], and 50 G-banded metaphases were analyzed. FISH study was undertaken using all chromosome specific sub-telomere FISH probes (Vysis). Hybridization and washing was done as per manufacturer's protocol and 100 metaphases were analyzed. Due to the strong abnormal clinical presentation and presence of prominent streaky pigmentation, further studies were undertaken on cultured skin fibroblast cells by routine G-banding and 70 metaphase spreads were analyzed, followed by C-band and NOR staining [##UREF##4##20##]. To further characterize the marker chromosome, alpha-satellite Pan-centromeric (Cambio) and chromosome 3 specific sub-telomeric (Vysis) FISH studies were performed as per manufacturer's instructions.</p>","<title>Oligo array CGH studies and validation</title>","<p>Oligo aCGH analysis was carried out using Human 44A microarray (Agilent) to determine the origin of the marker chromosome and to precisely identify the breakpoint region involved in the formation of the marker. The array contained <italic>in situ </italic>synthesized 60-mer oligonucleotides representing a total of 44,290 features. The oligonucleotide probes span the human genome with an average spatial resolution of approximately ~75 Kb, including coding and non-coding sequences, providing sufficient coverage for a genome-wide survey of DNA aberrations. Genomic DNA was extracted from cultured skin fibroblast cells of the patient by routine Proteinase K method and co-hybridized with normal male control DNA (Promega). DNA labelling, hybridization to oligonucleotide-array and post washing was carried out according to the protocol from Agilent Technologies and as described in Murthy et al [##REF##17268193##21##]. Array CGH result was further validated by FISH study using chromosome 3 specific subtelomere FISH probe (Vysis).</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<title>Cytogenetic and fish studies</title>\",\n \"<p>Cytogenetic study was carried out on peripheral blood lymphocytes by G-banding according to the standard procedures [##UREF##4##20##], and 50 G-banded metaphases were analyzed. FISH study was undertaken using all chromosome specific sub-telomere FISH probes (Vysis). Hybridization and washing was done as per manufacturer's protocol and 100 metaphases were analyzed. Due to the strong abnormal clinical presentation and presence of prominent streaky pigmentation, further studies were undertaken on cultured skin fibroblast cells by routine G-banding and 70 metaphase spreads were analyzed, followed by C-band and NOR staining [##UREF##4##20##]. To further characterize the marker chromosome, alpha-satellite Pan-centromeric (Cambio) and chromosome 3 specific sub-telomeric (Vysis) FISH studies were performed as per manufacturer's instructions.</p>\",\n \"<title>Oligo array CGH studies and validation</title>\",\n \"<p>Oligo aCGH analysis was carried out using Human 44A microarray (Agilent) to determine the origin of the marker chromosome and to precisely identify the breakpoint region involved in the formation of the marker. The array contained <italic>in situ </italic>synthesized 60-mer oligonucleotides representing a total of 44,290 features. The oligonucleotide probes span the human genome with an average spatial resolution of approximately ~75 Kb, including coding and non-coding sequences, providing sufficient coverage for a genome-wide survey of DNA aberrations. Genomic DNA was extracted from cultured skin fibroblast cells of the patient by routine Proteinase K method and co-hybridized with normal male control DNA (Promega). DNA labelling, hybridization to oligonucleotide-array and post washing was carried out according to the protocol from Agilent Technologies and as described in Murthy et al [##REF##17268193##21##]. Array CGH result was further validated by FISH study using chromosome 3 specific subtelomere FISH probe (Vysis).</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<p>Cytogenetic study by Giemsa banding (G-banding) showed normal 46,XX chromosomes in all the 50 lymphocyte cells and 47,XX,+mar in all the 70 skin fibroblast cells studied (Fig. ##FIG##0##1a##). The marker chromosome was constitutive heterochromatin band (C-band) and nucleolar organizer region (NOR) staining negative. Fluorescence in situ hybridization studies using Pan-centromeric alpha-satellite FISH probe (Cambio) showed no hybridization onto the marker chromosome (Fig. ##FIG##0##1b##), confirming it to be analphoid. Immuno-FISH studies for centromere specific proteins could not be undertaken to confirm the formation of a neocentromere. However, the fact that the marker was confirmed as analphoid by FISH and was also found to be highly stable in skin fibroblast culture, strongly suggest of a possible neocentromere formation. Peripheral blood chromosomes of the parents were normal by G-banding and by all chromosome specific sub-telomeric FISH analysis. Array-CGH studies on cultured skin fibroblast cells of the patient showed amplification of oligo-probes from probe FLJ14153 at 3q25.33 (160.03 Mb) to 3qter (199.29 Mb) (Fig. ##FIG##1##2##) confirming the origin and breakpoint of the marker chromosome. The observation was further validated by FISH studies using chromosome 3 specific subtelomere FISH probe (Vysis), which revealed the marker to be inversion-duplication 3q25.33-qter (Fig. ##FIG##0##1c##).</p>"],"string":"[\n \"<title>Results</title>\",\n \"<p>Cytogenetic study by Giemsa banding (G-banding) showed normal 46,XX chromosomes in all the 50 lymphocyte cells and 47,XX,+mar in all the 70 skin fibroblast cells studied (Fig. ##FIG##0##1a##). The marker chromosome was constitutive heterochromatin band (C-band) and nucleolar organizer region (NOR) staining negative. Fluorescence in situ hybridization studies using Pan-centromeric alpha-satellite FISH probe (Cambio) showed no hybridization onto the marker chromosome (Fig. ##FIG##0##1b##), confirming it to be analphoid. Immuno-FISH studies for centromere specific proteins could not be undertaken to confirm the formation of a neocentromere. However, the fact that the marker was confirmed as analphoid by FISH and was also found to be highly stable in skin fibroblast culture, strongly suggest of a possible neocentromere formation. Peripheral blood chromosomes of the parents were normal by G-banding and by all chromosome specific sub-telomeric FISH analysis. Array-CGH studies on cultured skin fibroblast cells of the patient showed amplification of oligo-probes from probe FLJ14153 at 3q25.33 (160.03 Mb) to 3qter (199.29 Mb) (Fig. ##FIG##1##2##) confirming the origin and breakpoint of the marker chromosome. The observation was further validated by FISH studies using chromosome 3 specific subtelomere FISH probe (Vysis), which revealed the marker to be inversion-duplication 3q25.33-qter (Fig. ##FIG##0##1c##).</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>Supernumerary marker chromosomes are a cause of great concern and pose huge challenge in routine medical practice, particularly in genetic diagnosis and counseling. Precise identification and complete characterization of the marker chromosome is very important to understand the underlying cause of the disease and to establish a good genotype-phenotype correlation.</p>","<p>Analphoid markers are rare observations, in which the marker chromosome lacks centromeric alphoid DNA sequences, that are otherwise typically present in normal functional centromeres. Survival and stability of such an analhpoid marker chromosome depends on the formation of a neocentromere [##REF##9399915##11##]. At present 73 cases of neocentromeric sSMC originating from different chromosomes are reported in the literature, of which 13q, 15q and 3q are the most frequent observations [##REF##17901697##1##]. To our knowledge only 9 cases of analphoid 3q inversion-duplication marker (including the present case) are reported so far, involving chromosomal break points 3q22.3, 3q25.33, 3q26.2, 3q27.1, 3q27.2 and 3q28 [##REF##17567547##12##, ####REF##11183190##13##, ##REF##10982967##14##, ##UREF##1##15##, ##UREF##2##16##, ##REF##10204855##17##, ##REF##12624156##18##, ##UREF##3##19####3##19##]. A brief summary of the clinical features, chromosomal breakpoints and degree of mosaicism of the reported cases with 3q inversion-duplication supernumerary marker chromosome is presented in Table ##TAB##0##1##. As can be seen, the most frequent break point is at 3q26.2 (4 out of 9 cases) suggesting that this is possibly the most common site of neocentromere formation in a 3q marker. However, findings of other break points between 3q22 to 3q28 strongly suggest that this region probably has several potential hotspots of necentromere formation.</p>","<p>Although all of the above cases with an analphoid 3q marker chromosome share some common clinical features, they still show widely varying phenotypes, probably due to the presence of varying euchromatic content as well as varying degree of mosiaicism (Table ##TAB##0##1##). Except for the case described by Portnoi et al [##REF##10204855##17##] where the patient presented only with lines of Blaschko but otherwise healthy and not dysmorphic, all the other reported cases presented with developmental delay, severe dysmorphic features and multiple congenital anomalies involving several organs and systems. Our present case with break point at 3q25.33 presented with strikingly distinct phenotype as described in the case report. The typical facial appearance and the prominent hairy forehead are distinctive features, in addition to the cardiac and skeletal abnormalities that are similar to the cases described by Gimelli et al and Cockwell et al[##REF##17567547##12##,##REF##11183190##13##].</p>","<p>Mosaicism is reported in 59% of cases where the sSMC are found in association with a normal cell line [##REF##15508017##4##]. Five of the nine cases discussed here showed tissue specific mosaicism where the 3q marker was present only in fibroblasts and not in lymphocytes (case number 1–3 and 5–6 of Table ##TAB##0##1##), other two cases showed varying degree of mosaicism in lymphocytes as well as in fibroblasts (case number 4 and 7 of Table ##TAB##0##1##), and the remaining two cases had the marker chromosome in 71% and 100% lymphocytes respectively (case number 8 and 9 of Table ##TAB##0##1##). Keeping in mind the specific clinical features of the patient and with the application of modern molecular cytogenetic detection methods such as aCGH and FISH, more and more similar cases are likely to be identified that would further help in obtaining a better genotype-phenotype correlation, and in providing with an accurate genetic diagnosis and better informed counseling, which is highly valuable to the patients.</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>Supernumerary marker chromosomes are a cause of great concern and pose huge challenge in routine medical practice, particularly in genetic diagnosis and counseling. Precise identification and complete characterization of the marker chromosome is very important to understand the underlying cause of the disease and to establish a good genotype-phenotype correlation.</p>\",\n \"<p>Analphoid markers are rare observations, in which the marker chromosome lacks centromeric alphoid DNA sequences, that are otherwise typically present in normal functional centromeres. Survival and stability of such an analhpoid marker chromosome depends on the formation of a neocentromere [##REF##9399915##11##]. At present 73 cases of neocentromeric sSMC originating from different chromosomes are reported in the literature, of which 13q, 15q and 3q are the most frequent observations [##REF##17901697##1##]. To our knowledge only 9 cases of analphoid 3q inversion-duplication marker (including the present case) are reported so far, involving chromosomal break points 3q22.3, 3q25.33, 3q26.2, 3q27.1, 3q27.2 and 3q28 [##REF##17567547##12##, ####REF##11183190##13##, ##REF##10982967##14##, ##UREF##1##15##, ##UREF##2##16##, ##REF##10204855##17##, ##REF##12624156##18##, ##UREF##3##19####3##19##]. A brief summary of the clinical features, chromosomal breakpoints and degree of mosaicism of the reported cases with 3q inversion-duplication supernumerary marker chromosome is presented in Table ##TAB##0##1##. As can be seen, the most frequent break point is at 3q26.2 (4 out of 9 cases) suggesting that this is possibly the most common site of neocentromere formation in a 3q marker. However, findings of other break points between 3q22 to 3q28 strongly suggest that this region probably has several potential hotspots of necentromere formation.</p>\",\n \"<p>Although all of the above cases with an analphoid 3q marker chromosome share some common clinical features, they still show widely varying phenotypes, probably due to the presence of varying euchromatic content as well as varying degree of mosiaicism (Table ##TAB##0##1##). Except for the case described by Portnoi et al [##REF##10204855##17##] where the patient presented only with lines of Blaschko but otherwise healthy and not dysmorphic, all the other reported cases presented with developmental delay, severe dysmorphic features and multiple congenital anomalies involving several organs and systems. Our present case with break point at 3q25.33 presented with strikingly distinct phenotype as described in the case report. The typical facial appearance and the prominent hairy forehead are distinctive features, in addition to the cardiac and skeletal abnormalities that are similar to the cases described by Gimelli et al and Cockwell et al[##REF##17567547##12##,##REF##11183190##13##].</p>\",\n \"<p>Mosaicism is reported in 59% of cases where the sSMC are found in association with a normal cell line [##REF##15508017##4##]. Five of the nine cases discussed here showed tissue specific mosaicism where the 3q marker was present only in fibroblasts and not in lymphocytes (case number 1–3 and 5–6 of Table ##TAB##0##1##), other two cases showed varying degree of mosaicism in lymphocytes as well as in fibroblasts (case number 4 and 7 of Table ##TAB##0##1##), and the remaining two cases had the marker chromosome in 71% and 100% lymphocytes respectively (case number 8 and 9 of Table ##TAB##0##1##). Keeping in mind the specific clinical features of the patient and with the application of modern molecular cytogenetic detection methods such as aCGH and FISH, more and more similar cases are likely to be identified that would further help in obtaining a better genotype-phenotype correlation, and in providing with an accurate genetic diagnosis and better informed counseling, which is highly valuable to the patients.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":[],"string":"[]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>Small supernumerary marker chromosomes (sSMC) occur in 0.075% of unselected prenatal and in 0.044% of consecutively studied postnatal cases. Individuals with sSMC present with varying phenotype, ranging from normal to extremely mild or severe depending on the chromosomal region involved, the euchromatic content present and degree of mosaicism. Except for chromosomes 15 and 22, the number of reported cases of sSMC is extremely small to provide us with a good genotype-phenotype correlation. Analphoid sSMC are even rarer. To our knowledge only eight cases of analphoid inversion-duplication 3q sSMC are reported so far.</p>","<title>Results</title>","<p>We describe here a one month old female child with several dysmorphic features and with a <italic>de novo </italic>analphoid supernumerary marker chromosome only in cultured skin fibroblast cells and not in lymphocytes. The marker was characterized as analphoid inversion-duplication 3q25.33-qter by oligo array comparative genomic hybridization (aCGH) and fluorescence in situ hybridization (FISH) studies. The final skin fibroblast karyotype was interpreted as 47,XX,+der(3).ish inv dup(3)(qter-q25.33::q25.33-qter)(subtel 3q+,subtel 3q+) <italic>de novo</italic>.</p>","<title>Conclusion</title>","<p>In addition to the eight reported cases of analphoid inversion-duplication 3q supernumerary marker in the literature, this is yet another case of 3q sSMC with a new breakpoint at 3q25.33 and with varying phenotype as described in the case report. Identification of more and more similar cases of analphoid inversion-duplication 3q marker will help in establishing a better genotype-phenotype correlation. The study further demonstrates that aCGH in conjunction with routine cytogenetics and FISH is very useful in precisely identifying and characterizing a marker chromosome, and more importantly help in providing with an accurate genetic diagnosis and better counseling to the family.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>Small supernumerary marker chromosomes (sSMC) occur in 0.075% of unselected prenatal and in 0.044% of consecutively studied postnatal cases. Individuals with sSMC present with varying phenotype, ranging from normal to extremely mild or severe depending on the chromosomal region involved, the euchromatic content present and degree of mosaicism. Except for chromosomes 15 and 22, the number of reported cases of sSMC is extremely small to provide us with a good genotype-phenotype correlation. Analphoid sSMC are even rarer. To our knowledge only eight cases of analphoid inversion-duplication 3q sSMC are reported so far.</p>\",\n \"<title>Results</title>\",\n \"<p>We describe here a one month old female child with several dysmorphic features and with a <italic>de novo </italic>analphoid supernumerary marker chromosome only in cultured skin fibroblast cells and not in lymphocytes. The marker was characterized as analphoid inversion-duplication 3q25.33-qter by oligo array comparative genomic hybridization (aCGH) and fluorescence in situ hybridization (FISH) studies. The final skin fibroblast karyotype was interpreted as 47,XX,+der(3).ish inv dup(3)(qter-q25.33::q25.33-qter)(subtel 3q+,subtel 3q+) <italic>de novo</italic>.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>In addition to the eight reported cases of analphoid inversion-duplication 3q supernumerary marker in the literature, this is yet another case of 3q sSMC with a new breakpoint at 3q25.33 and with varying phenotype as described in the case report. Identification of more and more similar cases of analphoid inversion-duplication 3q marker will help in establishing a better genotype-phenotype correlation. The study further demonstrates that aCGH in conjunction with routine cytogenetics and FISH is very useful in precisely identifying and characterizing a marker chromosome, and more importantly help in providing with an accurate genetic diagnosis and better counseling to the family.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Case presentation</title>","<p>A one month old female child presenting with several dysmorphic features was referred to us for cytogenetic studies. She was the second child of unrelated parents. The first child was normal. The pregnancy and delivery at term were normal. Birth weight was 2.2 Kg, length 45 cm and head circumference was 32 cm. At birth she was noted to have several dysmorphic features including: prominent hairy forehead with hair extending up to the cheeks, upslanting palpebral fissures, depressed nasal bridge with short nose and very smooth philtrum, thin upper lip which was turning downward, low set ears, micrognathia, chubby cheeks, contracture of the fingers with postaxial polydactyly of left hand, widely separated toes which were overlapping, streaky pigmentation on the inner aspect of both fore arms distributed along the lines of Blaschko. Opthalmological exam was normal. Echocardiography showed sub-aortic ventricular septal defect (VSD), pulmonary hypertention and moderate valvular pulmonary stenosis. Skeletal survey showed a tiny projection of the tip of coccyx, a tail-like sacrococcygeal appendage. Computed tomography scan of the lumbosacral spine showed prominence of coccyx and outward projection. Magnetic resonance imaging of the brain showed partial hypoplasia of the corpus callosum and slight hypoplasia of the cerebellum.</p>","<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>SKM conceived the study and drafted the manuscript. LG referred the patient, and RN and LG contributed clinical information. AKM, EEMR, SM, RP performed banding and cytogenetic analysis; SN and SP did FISH and PSJ did aCGH studies. MTA provided valuable support. All authors read and approved the final manuscript.</p>","<title>Consent</title>","<p>This case report is presented with the consent of the patient's family.</p>"],"string":"[\n \"<title>Case presentation</title>\",\n \"<p>A one month old female child presenting with several dysmorphic features was referred to us for cytogenetic studies. She was the second child of unrelated parents. The first child was normal. The pregnancy and delivery at term were normal. Birth weight was 2.2 Kg, length 45 cm and head circumference was 32 cm. At birth she was noted to have several dysmorphic features including: prominent hairy forehead with hair extending up to the cheeks, upslanting palpebral fissures, depressed nasal bridge with short nose and very smooth philtrum, thin upper lip which was turning downward, low set ears, micrognathia, chubby cheeks, contracture of the fingers with postaxial polydactyly of left hand, widely separated toes which were overlapping, streaky pigmentation on the inner aspect of both fore arms distributed along the lines of Blaschko. Opthalmological exam was normal. Echocardiography showed sub-aortic ventricular septal defect (VSD), pulmonary hypertention and moderate valvular pulmonary stenosis. Skeletal survey showed a tiny projection of the tip of coccyx, a tail-like sacrococcygeal appendage. Computed tomography scan of the lumbosacral spine showed prominence of coccyx and outward projection. Magnetic resonance imaging of the brain showed partial hypoplasia of the corpus callosum and slight hypoplasia of the cerebellum.</p>\",\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>SKM conceived the study and drafted the manuscript. LG referred the patient, and RN and LG contributed clinical information. AKM, EEMR, SM, RP performed banding and cytogenetic analysis; SN and SP did FISH and PSJ did aCGH studies. MTA provided valuable support. All authors read and approved the final manuscript.</p>\",\n \"<title>Consent</title>\",\n \"<p>This case report is presented with the consent of the patient's family.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>We acknowledge the Department of Health and Medical Services (DOHMS), Dubai and Center for Arab Genomic studies (CAGS), Dubai for supporting the work.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>We acknowledge the Department of Health and Medical Services (DOHMS), Dubai and Center for Arab Genomic studies (CAGS), Dubai for supporting the work.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>a) Partial G-banded metaphase from skin fibroblast cell showing the marker chromosome (arrow). b) Supernumerary marker chromosome showing no hybridization with human alpha-satellite Pan-centromeric probe (Cambio). (c) Chromosome 3 specific subtelomeric FISH (Mix 3 – Vysis) showing one normal chromosome 3 (3ptel green/3qtel red) and the marker chromosome with two red signals for 3q subtelomere, confirming the marker to be inversion-duplication 3q25.33-qter.</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Oligo aCGH study using Agilent 44 K oligo array. Labeling and hybridization are as described in methods. Figure shows a partial cytogenetic profile of chromosome 3q and amplification of chromosomal region 3q25.33-qter.</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p>a) Partial G-banded metaphase from skin fibroblast cell showing the marker chromosome (arrow). b) Supernumerary marker chromosome showing no hybridization with human alpha-satellite Pan-centromeric probe (Cambio). (c) Chromosome 3 specific subtelomeric FISH (Mix 3 – Vysis) showing one normal chromosome 3 (3ptel green/3qtel red) and the marker chromosome with two red signals for 3q subtelomere, confirming the marker to be inversion-duplication 3q25.33-qter.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p>Oligo aCGH study using Agilent 44 K oligo array. Labeling and hybridization are as described in methods. Figure shows a partial cytogenetic profile of chromosome 3q and amplification of chromosomal region 3q25.33-qter.</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Karyotype and clinical presentation of individuals reported with a supernumerary analphoid inversion-duplication 3q marker chromosome</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Case no.</td><td align=\"left\">Karyotype</td><td align=\"left\">Clinical features</td><td align=\"left\">References</td></tr></thead><tbody><tr><td align=\"left\">1</td><td align=\"left\">47,XY,+der(3) <bold>inv dup(3)(qter-q22.3::q22.3-qter) </bold>in dark skin fibroblast only (87%) 46,XY (in PBL & light skin)</td><td align=\"left\">Lumbosacral maningeocele, mental retardation, sparse hair, short limbs, hypoplasia of digital phalanges, agensis of nails and clinodactyly of fifth finger, ambiguous genitalia, depressed nasal bridge, anteverted nostrils lines of Blaschko, severe developmental delay.</td><td align=\"left\">[##REF##17567547##12##,##UREF##3##19##]</td></tr><tr><td align=\"left\">2</td><td align=\"left\">47,XX,+der(3) <bold>inv dup(3)(qter-q25.33::q25.33-qter) </bold>in skin fibroblast only (100%) 46,XX (PBL)</td><td align=\"left\">Multiple congenital anomalies, prominent hairy forehead, low set ears, micrognathia, postaxial polydactyly of left hand, depressed nasal bridge, short nose, lines of Blaschko, sub arortic VSD, pulmonary hypertension, tail-like sacrococcygeal appendage, hypoplasia of corpus callosum.</td><td align=\"left\">present case</td></tr><tr><td align=\"left\">3</td><td align=\"left\">47,XY,+der(3) <bold>inv dup(3)(qter-q26.2::q26.2-qter) </bold>in skin fibroblast (57%)</td><td align=\"left\">Abortus with high arched palate, postnuchal edema, single transverse palmer crease on rt. hand lumbosacral myelomengiocele, Arnold-Chiari malformation, asymmetry of the kidneys, renal dysplasia.</td><td align=\"left\">[##REF##11183190##13##,##UREF##3##19##]</td></tr><tr><td align=\"left\">4</td><td align=\"left\">47,XY,+der(3) <bold>inv dup(3)(qter-q26.2::q26.2-qter) </bold>in skin fibroblast (88%) in PBL (2.5%)</td><td align=\"left\">Enlargerd kidney, streaky hypopigmentation of skin, wide open anterior and posterior fontanel, rt preauricular pit, accessory nipples, postaxial polydactyly, clinodactyly of 5<sup>th </sup>finger, rocker bottom feet, seizures, duplication of rt kidney, right pulmonary srtery stenosis, developmental delay.</td><td align=\"left\">[##REF##10982967##14##,##UREF##3##19##]</td></tr><tr><td align=\"left\">5</td><td align=\"left\">47,XY,+der(3) <bold>inv dup(3)(qter-q26.2::q26.2-qter) </bold>in skin fibroblast 46,XY (PBL)</td><td align=\"left\">Mild developmental delay, attention-deficit hyperactivity, asymmetry of hands and legs, lines of irregular skin pigmentation consistent with the lines of Blaschko, macrocephaly.</td><td align=\"left\">[##UREF##1##15##,##UREF##3##19##]</td></tr><tr><td align=\"left\">6</td><td align=\"left\">47,XX,+der(3) <bold>inv dup(3)(qter-q26.2::q26.2-qter) </bold>in skin fibroblast (24%) 46,XX (PBL)</td><td align=\"left\">Skeletal abnormalities, limb stiffness, abnormal skin pigmentation, developmental delay.</td><td align=\"left\">[##UREF##2##16##,##UREF##3##19##]</td></tr><tr><td align=\"left\">7</td><td align=\"left\">47,XY,+der(3) <bold>inv dup(3)(qter-q27.1::q27.1-qter) </bold>in dark skin fibroblast (6%) in PBL (30%) 46,XY (100% in light skin)</td><td align=\"left\">22 year old man, normal intelligence, onset of pigmentary anomalies at age 10–12 years, lines of Blaschko, otherwise healthy and not dysmorphic.</td><td align=\"left\">[##REF##10204855##17##,##UREF##3##19##]</td></tr><tr><td align=\"left\">8</td><td align=\"left\">47,XX,+der(3) <bold>inv dup(3)(qter-q27.2::q27.2-qter) </bold>in PBL (71%)</td><td align=\"left\">Swirly areas of hyperpigmentation, bilateral preauricular pits, hypotonia, developmental delay, seizures.</td><td align=\"left\">[##REF##10982967##14##,##UREF##3##19##]</td></tr><tr><td align=\"left\">9</td><td align=\"left\">47,XX,+der(3) <bold>inv dup(3)(qter-q28::q28-qter) </bold>(100% in PBL)</td><td align=\"left\">Marked developmental delay, Hypognathia, atypical epicanthus, slight hirsutism, bilateral icthyosiform hyperkerotosis of palms and sole, hypotonia, hyporeflexia, cannot speak properly.</td><td align=\"left\">[##REF##12624156##18##,##UREF##3##19##]</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Karyotype and clinical presentation of individuals reported with a supernumerary analphoid inversion-duplication 3q marker chromosome</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\">Case no.</td><td align=\\\"left\\\">Karyotype</td><td align=\\\"left\\\">Clinical features</td><td align=\\\"left\\\">References</td></tr></thead><tbody><tr><td align=\\\"left\\\">1</td><td align=\\\"left\\\">47,XY,+der(3) <bold>inv dup(3)(qter-q22.3::q22.3-qter) </bold>in dark skin fibroblast only (87%) 46,XY (in PBL & light skin)</td><td align=\\\"left\\\">Lumbosacral maningeocele, mental retardation, sparse hair, short limbs, hypoplasia of digital phalanges, agensis of nails and clinodactyly of fifth finger, ambiguous genitalia, depressed nasal bridge, anteverted nostrils lines of Blaschko, severe developmental delay.</td><td align=\\\"left\\\">[##REF##17567547##12##,##UREF##3##19##]</td></tr><tr><td align=\\\"left\\\">2</td><td align=\\\"left\\\">47,XX,+der(3) <bold>inv dup(3)(qter-q25.33::q25.33-qter) </bold>in skin fibroblast only (100%) 46,XX (PBL)</td><td align=\\\"left\\\">Multiple congenital anomalies, prominent hairy forehead, low set ears, micrognathia, postaxial polydactyly of left hand, depressed nasal bridge, short nose, lines of Blaschko, sub arortic VSD, pulmonary hypertension, tail-like sacrococcygeal appendage, hypoplasia of corpus callosum.</td><td align=\\\"left\\\">present case</td></tr><tr><td align=\\\"left\\\">3</td><td align=\\\"left\\\">47,XY,+der(3) <bold>inv dup(3)(qter-q26.2::q26.2-qter) </bold>in skin fibroblast (57%)</td><td align=\\\"left\\\">Abortus with high arched palate, postnuchal edema, single transverse palmer crease on rt. hand lumbosacral myelomengiocele, Arnold-Chiari malformation, asymmetry of the kidneys, renal dysplasia.</td><td align=\\\"left\\\">[##REF##11183190##13##,##UREF##3##19##]</td></tr><tr><td align=\\\"left\\\">4</td><td align=\\\"left\\\">47,XY,+der(3) <bold>inv dup(3)(qter-q26.2::q26.2-qter) </bold>in skin fibroblast (88%) in PBL (2.5%)</td><td align=\\\"left\\\">Enlargerd kidney, streaky hypopigmentation of skin, wide open anterior and posterior fontanel, rt preauricular pit, accessory nipples, postaxial polydactyly, clinodactyly of 5<sup>th </sup>finger, rocker bottom feet, seizures, duplication of rt kidney, right pulmonary srtery stenosis, developmental delay.</td><td align=\\\"left\\\">[##REF##10982967##14##,##UREF##3##19##]</td></tr><tr><td align=\\\"left\\\">5</td><td align=\\\"left\\\">47,XY,+der(3) <bold>inv dup(3)(qter-q26.2::q26.2-qter) </bold>in skin fibroblast 46,XY (PBL)</td><td align=\\\"left\\\">Mild developmental delay, attention-deficit hyperactivity, asymmetry of hands and legs, lines of irregular skin pigmentation consistent with the lines of Blaschko, macrocephaly.</td><td align=\\\"left\\\">[##UREF##1##15##,##UREF##3##19##]</td></tr><tr><td align=\\\"left\\\">6</td><td align=\\\"left\\\">47,XX,+der(3) <bold>inv dup(3)(qter-q26.2::q26.2-qter) </bold>in skin fibroblast (24%) 46,XX (PBL)</td><td align=\\\"left\\\">Skeletal abnormalities, limb stiffness, abnormal skin pigmentation, developmental delay.</td><td align=\\\"left\\\">[##UREF##2##16##,##UREF##3##19##]</td></tr><tr><td align=\\\"left\\\">7</td><td align=\\\"left\\\">47,XY,+der(3) <bold>inv dup(3)(qter-q27.1::q27.1-qter) </bold>in dark skin fibroblast (6%) in PBL (30%) 46,XY (100% in light skin)</td><td align=\\\"left\\\">22 year old man, normal intelligence, onset of pigmentary anomalies at age 10–12 years, lines of Blaschko, otherwise healthy and not dysmorphic.</td><td align=\\\"left\\\">[##REF##10204855##17##,##UREF##3##19##]</td></tr><tr><td align=\\\"left\\\">8</td><td align=\\\"left\\\">47,XX,+der(3) <bold>inv dup(3)(qter-q27.2::q27.2-qter) </bold>in PBL (71%)</td><td align=\\\"left\\\">Swirly areas of hyperpigmentation, bilateral preauricular pits, hypotonia, developmental delay, seizures.</td><td align=\\\"left\\\">[##REF##10982967##14##,##UREF##3##19##]</td></tr><tr><td align=\\\"left\\\">9</td><td align=\\\"left\\\">47,XX,+der(3) <bold>inv dup(3)(qter-q28::q28-qter) </bold>(100% in PBL)</td><td align=\\\"left\\\">Marked developmental delay, Hypognathia, atypical epicanthus, slight hirsutism, bilateral icthyosiform hyperkerotosis of palms and sole, hypotonia, hyporeflexia, cannot speak properly.</td><td align=\\\"left\\\">[##REF##12624156##18##,##UREF##3##19##]</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":["<table-wrap-foot><p>(PBL = peripheral blood lymphocyte culture)</p></table-wrap-foot>"],"string":"[\n \"<table-wrap-foot><p>(PBL = peripheral blood lymphocyte culture)</p></table-wrap-foot>\"\n]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1755-8166-1-19-1\"/>","<graphic xlink:href=\"1755-8166-1-19-2\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1755-8166-1-19-1\\\"/>\",\n \"<graphic xlink:href=\\\"1755-8166-1-19-2\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Dennis\", \"Veltman\", \"Thompson\", \"Craig\", \"Bolton\", \"Thomas\"], \"given-names\": [\"NR\", \"MW\", \"R\", \"E\", \"PF\", \"NS\"], \"article-title\": [\"Clinical findings in 33 subjects with large supernumerary marker(15) chromosomes and 3 subjects with triplication of 15q11-q13\"], \"source\": [\"Am J Med Genet\"], \"year\": [\"2006\"], \"volume\": [\"140\"], \"fpage\": [\"434\"], \"lpage\": [\"441\"], \"pub-id\": [\"10.1002/ajmg.a.31091\"]}, {\"surname\": [\"Yu\", \"Qi\", \"Thompson\", \"Modaff\", \"Wells\", \"Meisner\", \"Pauli\"], \"given-names\": [\"J\", \"Z\", \"K\", \"P\", \"W\", \"L\", \"R\"], \"article-title\": [\"Characterization of a rare neocentric marker chromosome using chromosome microdissection\"], \"source\": [\"54th annual meeting of the American Society of Human Genetics \"], \"year\": [\"2004\"], \"fpage\": [\"192\"]}, {\"surname\": [\"Sullivan\", \"Mountford\", \"Emmerson\", \"Ellis\", \"Turmbull\", \"Waters\"], \"given-names\": [\"CM\", \"ST\", \"JM\", \"RJ\", \"C\", \"KS\"], \"article-title\": [\"A mosaic karyotype with an additional inv dup(3)(qter-q26.2::q26.2-qter), containing a neocentromere, detected in a skin biopsy from a girl with skeletal abnormalities, abnormal skin pigmentation and developmental delay\"], \"source\": [\"J Med Genet\"], \"year\": [\"2005\"], \"volume\": [\"42\"], \"fpage\": [\"S71\"], \"comment\": [\"(Abstract # 2.23)\"]}, {\"surname\": [\"Liehr\"], \"given-names\": [\"T\"], \"article-title\": [\"Small supernumerary marker chromosome (sSMC)\"]}, {\"surname\": [\"Rooney\", \"Rooney DE\"], \"given-names\": [\"DE\"], \"article-title\": [\"Chromosome staining and banding techniques\"], \"source\": [\"Human Cytogenetics: constitutional analysis A practical approach\"], \"year\": [\"2001\"], \"publisher-name\": [\"Oxford university press\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":21,"string":"21"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:38"},"citation":{"kind":"string","value":"Mol Cytogenet. 2008 Aug 14; 1:19"},"package_file":{"kind":"string","value":"oa_package/31/9a/PMC2538529.tar.gz"}}},{"rowIdx":119694,"cells":{"accession_id":{"kind":"string","value":"PMC2538530"},"pmid":{"kind":"string","value":"18764944"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>Kaposi sarcoma (KS) is a low-grade vascular neoplasm associated with Human Herpesvirus-8 (HHV8) infection. There are four clinical-epidemiological types, including African (endemic) KS, AIDS-associated (epidemic) KS, classic KS, and transplant-associated (iatrogenic) KS. KS is a multifocal tumor that presents chiefly in mucocutaneous sites. AIDS-associated KS tends to be multicentric, often involving mucous membranes along the entire gastrointestinal tract and occurring in atypical locations. Patients with AIDS frequently manifest with skin lesions of the lower extremities, face, trunk, genitalia. In patients with AIDS, KS may also involve their lymph nodes and visceral organs. For patients with classic and transplant-associated KS, lesions are often limited to the skin, although visceral KS may occur. In African KS the legs are primarily involved, with more widespread KS involvement of the lymphoid system seen in children. Involvement of several unusual anatomical sites have been reported, such as KS of the musculoskeletal system, nervous system, heart, breast, major salivary glands, and endocrine organs [##REF##18605999##1##].</p>","<p>Involvement of the subcutaneous tissue (subcutis or hypodermis) by KS typically occurs when cutaneous KS lesions evolve from a plaque stage lesion into deep endophytic nodular tumors. Large KS tumors may even penetrate deep down to involve underlying contiguous bone [##REF##17265518##2##]. Hence, KS of the subcutis is, by and large, almost always accompanied by concomitant noticeable skin changes. We are aware of only one published case of AIDS-related KS involving the subcutaneous tissue of the thigh, that was associated with distant visible KS skin lesions of the patient's lower legs [##REF##2390823##3##]. To the best of our knowledge, primary KS of the subcutis (i.e. without KS disease elsewhere) has not been documented. We present the first case of AIDS-associated KS primary to the subcutaneous tissue, in order to bring attention to the occurrence of KS in this unusual anatomical location.</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>Kaposi sarcoma (KS) is a low-grade vascular neoplasm associated with Human Herpesvirus-8 (HHV8) infection. There are four clinical-epidemiological types, including African (endemic) KS, AIDS-associated (epidemic) KS, classic KS, and transplant-associated (iatrogenic) KS. KS is a multifocal tumor that presents chiefly in mucocutaneous sites. AIDS-associated KS tends to be multicentric, often involving mucous membranes along the entire gastrointestinal tract and occurring in atypical locations. Patients with AIDS frequently manifest with skin lesions of the lower extremities, face, trunk, genitalia. In patients with AIDS, KS may also involve their lymph nodes and visceral organs. For patients with classic and transplant-associated KS, lesions are often limited to the skin, although visceral KS may occur. In African KS the legs are primarily involved, with more widespread KS involvement of the lymphoid system seen in children. Involvement of several unusual anatomical sites have been reported, such as KS of the musculoskeletal system, nervous system, heart, breast, major salivary glands, and endocrine organs [##REF##18605999##1##].</p>\",\n \"<p>Involvement of the subcutaneous tissue (subcutis or hypodermis) by KS typically occurs when cutaneous KS lesions evolve from a plaque stage lesion into deep endophytic nodular tumors. Large KS tumors may even penetrate deep down to involve underlying contiguous bone [##REF##17265518##2##]. Hence, KS of the subcutis is, by and large, almost always accompanied by concomitant noticeable skin changes. We are aware of only one published case of AIDS-related KS involving the subcutaneous tissue of the thigh, that was associated with distant visible KS skin lesions of the patient's lower legs [##REF##2390823##3##]. To the best of our knowledge, primary KS of the subcutis (i.e. without KS disease elsewhere) has not been documented. We present the first case of AIDS-associated KS primary to the subcutaneous tissue, in order to bring attention to the occurrence of KS in this unusual anatomical location.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":[],"string":"[]","isConversational":false},"results":{"kind":"list like","value":[],"string":"[]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>This report represents the first documented case of isolated KS manifesting primarily in the soft tissue of the thigh. Lee et al reported a case describing a subcutaneous AIDS-KS tumor in a 58-year-old HIV seropositive man that presented initially with KS skin nodules over his lower legs [##REF##2390823##3##]. We are aware of another case of AIDS-KS in which the patient, a 57-year-old man, manifested with several subcutaneous noduli spread out over his entire legs [##REF##7655117##4##]. This patient, however, presented with pronounced non-pitting lower extremity edema and visible KS skin plaques and nodules. In our case, there were no cutaneous changes at all.</p>","<p>The differential diagnosis of a subcutaneous thigh mass in an HIV-positive person is broad and includes infection (e.g. abscess, cryptococcus), reactive/benign conditions (e.g. nodular fasciitis), benign neoplasms (e.g. lipoma), and malignant neoplasms (e.g. liposarcoma, metastasis). The anterior thigh compartment is an uncommon site for an enlarged lymph node to manifest. Although infection should always be excluded in the context of immunosuppression, other than tenderness to palpation there were no findings prior to biopsy in our case that were particularly indicative of infection. Soft tissue abscess due to mycobacterial infection has been noted in patients with AIDS [##REF##17823760##5##]. In our patient there was no antecedent trauma which may have caused localized nodular fat necrosis or fasciitis. Multiple subcutaneous lipomas induced by antiretroviral drugs have been reported [##REF##18087023##6##]. More recently, leiomyosarcoma due to Epstein-Barr Virus (EBV) infection has emerged as a malignant soft tissue tumor that may arise in setting of HIV infection [##REF##9402327##7##,##REF##15844077##8##]. Of interest, there has been one case report in which AIDS-KS infiltrated the gastrocnemius muscle [##REF##12473815##9##]. In our case there was no apparent involvement of skeletal muscle.</p>","<p>KS lesions develop as a result of the following combination of factors: HHV8, altered immunity (immunosuppression), and an inflammatory/angiogenic milieu [##REF##17912148##10##]. The etiology for KS arising primarily in the subcutaneous (i.e. fatty subcutis) tissue is puzzling. KS has been shown to be of lymphatic origin [##REF##15770083##11##], and lymphatic vessels are certainly present in subcutaneous tissue. However, KS tumorigenesis typically arises from dermal (superficial more often than deep) lymphatics in the skin, and not the hypodermis as in this case. Chronic lymphedema has previously been reported in several patients to promote KS development probably due to a combination of collateral vessels, lympahngiogenesis and immune impairment [##REF##12077591##12##]. However, our patient reported no leg and or foot swelling and clinically we found no lymphedema. Localization of KS to sites of previous iatrogenic trauma has been documented [##REF##11961149##13##,##REF##1430374##14##]. It is plausible that trauma to our patient's thigh, perhaps related to his previous hip replacement, predisposed to him KS in this location. However, he had bilateral hip replacements and the KS lesion identified in this case was unilateral. Moreover, some of these publications describe KS arising after surgery relatively soon (e.g. within 6 days) after the patient's trauma [##REF##1430374##14##].</p>","<p>In our case, imaging studies revealed a solid vascular subcutaneous mass with features highly concerning for malignancy. In such a case a definitive tissue-based diagnosis is key to guiding appropriate KS therapy. KS needs to be high in the differential diagnosis in the setting of HIV infection, to avoid a major sarcoma surgical operation. KS disease was not identified elsewhere in or patient, confirming the unusual diagnosis of primary subcutaneous KS. For a soft tissue abscess MRI will show a well-demarcated fluid collection that is hypointense on T1-weighted images, hyperintense on T2-weighted images, surrounded by a low-signal-intensity pseudocapsule with all sequences, and will likely demonstrate peripheral rim enhancement after intravenous administration of gadolinium-based contrast material [##REF##15256627##15##]. For computerized tomography (CT) scans and MRI, AIDS-related KS is characterized by relatively strong tumoral enhancement after contrast material administration, a finding that may suggest the diagnosis in the appropriate clinical setting (ie, typical skin lesions), even though this finding is considered nonspecific [##REF##16844940##16##]. CT is also helpful in assessing the involvement of deep tissue planes as well as the extent of possible nodal disease. Earlier imaging modalities, such as scintigraphy with sequential thallium and gallium scanning, have also been used to evaluate KS. Gallium uptake is usually negative in KS but positive in infection and lymphoma, whereas thallium uptake is positive in KS and lymphoma [##REF##17267331##17##]. Finally, once a diagnosis of KS is a reached, considered an AIDS-defining neoplasm in an HIV-positive individual, appropriate therapy is required including HAART and if indicated chemotherapy.</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>This report represents the first documented case of isolated KS manifesting primarily in the soft tissue of the thigh. Lee et al reported a case describing a subcutaneous AIDS-KS tumor in a 58-year-old HIV seropositive man that presented initially with KS skin nodules over his lower legs [##REF##2390823##3##]. We are aware of another case of AIDS-KS in which the patient, a 57-year-old man, manifested with several subcutaneous noduli spread out over his entire legs [##REF##7655117##4##]. This patient, however, presented with pronounced non-pitting lower extremity edema and visible KS skin plaques and nodules. In our case, there were no cutaneous changes at all.</p>\",\n \"<p>The differential diagnosis of a subcutaneous thigh mass in an HIV-positive person is broad and includes infection (e.g. abscess, cryptococcus), reactive/benign conditions (e.g. nodular fasciitis), benign neoplasms (e.g. lipoma), and malignant neoplasms (e.g. liposarcoma, metastasis). The anterior thigh compartment is an uncommon site for an enlarged lymph node to manifest. Although infection should always be excluded in the context of immunosuppression, other than tenderness to palpation there were no findings prior to biopsy in our case that were particularly indicative of infection. Soft tissue abscess due to mycobacterial infection has been noted in patients with AIDS [##REF##17823760##5##]. In our patient there was no antecedent trauma which may have caused localized nodular fat necrosis or fasciitis. Multiple subcutaneous lipomas induced by antiretroviral drugs have been reported [##REF##18087023##6##]. More recently, leiomyosarcoma due to Epstein-Barr Virus (EBV) infection has emerged as a malignant soft tissue tumor that may arise in setting of HIV infection [##REF##9402327##7##,##REF##15844077##8##]. Of interest, there has been one case report in which AIDS-KS infiltrated the gastrocnemius muscle [##REF##12473815##9##]. In our case there was no apparent involvement of skeletal muscle.</p>\",\n \"<p>KS lesions develop as a result of the following combination of factors: HHV8, altered immunity (immunosuppression), and an inflammatory/angiogenic milieu [##REF##17912148##10##]. The etiology for KS arising primarily in the subcutaneous (i.e. fatty subcutis) tissue is puzzling. KS has been shown to be of lymphatic origin [##REF##15770083##11##], and lymphatic vessels are certainly present in subcutaneous tissue. However, KS tumorigenesis typically arises from dermal (superficial more often than deep) lymphatics in the skin, and not the hypodermis as in this case. Chronic lymphedema has previously been reported in several patients to promote KS development probably due to a combination of collateral vessels, lympahngiogenesis and immune impairment [##REF##12077591##12##]. However, our patient reported no leg and or foot swelling and clinically we found no lymphedema. Localization of KS to sites of previous iatrogenic trauma has been documented [##REF##11961149##13##,##REF##1430374##14##]. It is plausible that trauma to our patient's thigh, perhaps related to his previous hip replacement, predisposed to him KS in this location. However, he had bilateral hip replacements and the KS lesion identified in this case was unilateral. Moreover, some of these publications describe KS arising after surgery relatively soon (e.g. within 6 days) after the patient's trauma [##REF##1430374##14##].</p>\",\n \"<p>In our case, imaging studies revealed a solid vascular subcutaneous mass with features highly concerning for malignancy. In such a case a definitive tissue-based diagnosis is key to guiding appropriate KS therapy. KS needs to be high in the differential diagnosis in the setting of HIV infection, to avoid a major sarcoma surgical operation. KS disease was not identified elsewhere in or patient, confirming the unusual diagnosis of primary subcutaneous KS. For a soft tissue abscess MRI will show a well-demarcated fluid collection that is hypointense on T1-weighted images, hyperintense on T2-weighted images, surrounded by a low-signal-intensity pseudocapsule with all sequences, and will likely demonstrate peripheral rim enhancement after intravenous administration of gadolinium-based contrast material [##REF##15256627##15##]. For computerized tomography (CT) scans and MRI, AIDS-related KS is characterized by relatively strong tumoral enhancement after contrast material administration, a finding that may suggest the diagnosis in the appropriate clinical setting (ie, typical skin lesions), even though this finding is considered nonspecific [##REF##16844940##16##]. CT is also helpful in assessing the involvement of deep tissue planes as well as the extent of possible nodal disease. Earlier imaging modalities, such as scintigraphy with sequential thallium and gallium scanning, have also been used to evaluate KS. Gallium uptake is usually negative in KS but positive in infection and lymphoma, whereas thallium uptake is positive in KS and lymphoma [##REF##17267331##17##]. Finally, once a diagnosis of KS is a reached, considered an AIDS-defining neoplasm in an HIV-positive individual, appropriate therapy is required including HAART and if indicated chemotherapy.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>We present the first documented case of primary subcutaneous KS occurring in the setting of AIDS. The differential diagnosis of an isolated subcutaneous soft tissue tumor in an HIV-infected individual is broad, and requires imaging evaluation and a definitive pathological diagnosis in order to guide appropriate therapy. Awareness that KS can occur as an isolated deep soft tissue mass may avoid potential misdiagnosis.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>We present the first documented case of primary subcutaneous KS occurring in the setting of AIDS. The differential diagnosis of an isolated subcutaneous soft tissue tumor in an HIV-infected individual is broad, and requires imaging evaluation and a definitive pathological diagnosis in order to guide appropriate therapy. Awareness that KS can occur as an isolated deep soft tissue mass may avoid potential misdiagnosis.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>Involvement of the subcutis by Kaposi sarcoma (KS) occurs primarily when cutaneous KS lesions evolve into deep penetrating nodular tumors. Primary KS of the subcutaneous tissue is an exceptional manifestation of this low-grade vascular neoplasm.</p>","<title>Case presentation</title>","<p>We present a unique case of acquired immune deficiency syndrome (AIDS)-associated KS manifesting primarily in the subcutaneous tissue of the anterior thigh in a 43-year-old male, which occurred without overlying visible skin changes or concomitant KS disease elsewhere. Radiological imaging and tissue biopsy confirmed the diagnosis of KS.</p>","<title>Conclusion</title>","<p>This is the first documented case of primary subcutaneous KS occurring in the setting of AIDS. The differential diagnosis of an isolated subcutaneous lesion in an human immunodeficiency virus (HIV)-infected individual is broad, and requires both imaging and a histopathological diagnosis to guide appropriate therapy.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>Involvement of the subcutis by Kaposi sarcoma (KS) occurs primarily when cutaneous KS lesions evolve into deep penetrating nodular tumors. Primary KS of the subcutaneous tissue is an exceptional manifestation of this low-grade vascular neoplasm.</p>\",\n \"<title>Case presentation</title>\",\n \"<p>We present a unique case of acquired immune deficiency syndrome (AIDS)-associated KS manifesting primarily in the subcutaneous tissue of the anterior thigh in a 43-year-old male, which occurred without overlying visible skin changes or concomitant KS disease elsewhere. Radiological imaging and tissue biopsy confirmed the diagnosis of KS.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>This is the first documented case of primary subcutaneous KS occurring in the setting of AIDS. The differential diagnosis of an isolated subcutaneous lesion in an human immunodeficiency virus (HIV)-infected individual is broad, and requires both imaging and a histopathological diagnosis to guide appropriate therapy.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Case presentation</title>","<p>A 43-year-old homosexual man who was HIV positive for 18 years presented with a one-year history of a slowly enlarging mass in the proximal left anterior thigh. He described stabbing pain, often experiencing sharp shooting pains down the left thigh. He had been on and off antiretroviral medication, which he had stopped three years prior to this presentation. He had bilateral total hip replacements for avascular necrosis and osteoarthritis approximately three years prior to this visit. He reported no specific trauma or previous injection to his left thigh.</p>","<p>On physical examination, he appeared to be in good health. His gait was antalgic. He had no visible mucocutaneous KS lesions and he did not exhibit features of fat maldistribution. There was a firm 3 cm mass present deep in his left thigh that was tender to palpation. The mass was well away from the groin and inguinal region. In particular, there were no overlying skin changes or associated lymphedema. He had enlarged axillary lymph nodes. His complete blood count was unremarkable and his CD4 T-cell count was 249 cells/mm<sup>3 </sup>and HIV viral load 72 copies/mL while off all antiretroviral medications.</p>","<p>An ultrasound test showed a 2.6 × 1.8 × 1.2 cm solid, vascular, heterogeneous lesion within the deep thigh soft tissue. A magnetic resonance image (MRI) showed a solid, vascular enhancing mass with spiculated margins (Figure ##FIG##0##1##) located within the subcutaneous fat, superficial to muscle, in the left anterior thigh. The mass measured 2.2 cm in greatest diameter, and was associated with a second inferior satellite 1.4 cm subcutaneous tumor. Tumor was isointense to muscle on T1W1 and heterogeneous, but mostly hyperintense on T2WI. After gadolinium administration, both lesions enhanced. The larger index lesion enhanced heterogeneously and vessels were identified entering the proximal and distal aspects (Figure ##FIG##1##2##). No nodal disease was reported. Fecal occult blood test performed for evidence of gastrointestinal KS was negative and a chest x-ray showed no evidence of pulmonary KS.</p>","<p>Fine needle aspiration with a 22-gauge needle yielded only few atypical spindle cells. Therefore, an ultrasound-guided core biopsy was performed which showed KS with spindled tumor cells (Figure ##FIG##2##3##). KS tumor cells were immunoreactive for the vascular markers CD34 and CD31, for the lymphatic endothelial marker D2-40, positive for the HHV8 marker LNA-1, and demonstrated no staining with actin, desmin, cytokeratin cocktail, epithelial membrane antigen and S-100. The patient received pegylated liposomal doxorubicin with subsequent shrinkage of tumor and amelioration of his symptoms.</p>","<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>BJD, LP, and JM were involved in conception and design, in the drafting of the manuscript. All authors have read the final manuscript and approve of its submission.</p>"],"string":"[\n \"<title>Case presentation</title>\",\n \"<p>A 43-year-old homosexual man who was HIV positive for 18 years presented with a one-year history of a slowly enlarging mass in the proximal left anterior thigh. He described stabbing pain, often experiencing sharp shooting pains down the left thigh. He had been on and off antiretroviral medication, which he had stopped three years prior to this presentation. He had bilateral total hip replacements for avascular necrosis and osteoarthritis approximately three years prior to this visit. He reported no specific trauma or previous injection to his left thigh.</p>\",\n \"<p>On physical examination, he appeared to be in good health. His gait was antalgic. He had no visible mucocutaneous KS lesions and he did not exhibit features of fat maldistribution. There was a firm 3 cm mass present deep in his left thigh that was tender to palpation. The mass was well away from the groin and inguinal region. In particular, there were no overlying skin changes or associated lymphedema. He had enlarged axillary lymph nodes. His complete blood count was unremarkable and his CD4 T-cell count was 249 cells/mm<sup>3 </sup>and HIV viral load 72 copies/mL while off all antiretroviral medications.</p>\",\n \"<p>An ultrasound test showed a 2.6 × 1.8 × 1.2 cm solid, vascular, heterogeneous lesion within the deep thigh soft tissue. A magnetic resonance image (MRI) showed a solid, vascular enhancing mass with spiculated margins (Figure ##FIG##0##1##) located within the subcutaneous fat, superficial to muscle, in the left anterior thigh. The mass measured 2.2 cm in greatest diameter, and was associated with a second inferior satellite 1.4 cm subcutaneous tumor. Tumor was isointense to muscle on T1W1 and heterogeneous, but mostly hyperintense on T2WI. After gadolinium administration, both lesions enhanced. The larger index lesion enhanced heterogeneously and vessels were identified entering the proximal and distal aspects (Figure ##FIG##1##2##). No nodal disease was reported. Fecal occult blood test performed for evidence of gastrointestinal KS was negative and a chest x-ray showed no evidence of pulmonary KS.</p>\",\n \"<p>Fine needle aspiration with a 22-gauge needle yielded only few atypical spindle cells. Therefore, an ultrasound-guided core biopsy was performed which showed KS with spindled tumor cells (Figure ##FIG##2##3##). KS tumor cells were immunoreactive for the vascular markers CD34 and CD31, for the lymphatic endothelial marker D2-40, positive for the HHV8 marker LNA-1, and demonstrated no staining with actin, desmin, cytokeratin cocktail, epithelial membrane antigen and S-100. The patient received pegylated liposomal doxorubicin with subsequent shrinkage of tumor and amelioration of his symptoms.</p>\",\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>BJD, LP, and JM were involved in conception and design, in the drafting of the manuscript. All authors have read the final manuscript and approve of its submission.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>Written consent was obtained from the patient for publication of this case report.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>Written consent was obtained from the patient for publication of this case report.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>MRI shows a solid, vascular enhancing subcutaneous thigh mass with spiculated margins.</bold>(see arrow)</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Core needle biopsy of Kaposi sarcoma.</bold> Fascicles comprised of spindled tumor cells are shown (H&E stain).</p></caption></fig>","<fig position=\"float\" id=\"F3\"><label>Figure 3</label><caption><p>Higher power magnification shows infiltrating Kaposi sarcoma comprised of spindle-shaped tumor cells admixed with abnormal vascular channels (H&E stain).</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p><bold>MRI shows a solid, vascular enhancing subcutaneous thigh mass with spiculated margins.</bold>(see arrow)</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p><bold>Core needle biopsy of Kaposi sarcoma.</bold> Fascicles comprised of spindled tumor cells are shown (H&E stain).</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F3\\\"><label>Figure 3</label><caption><p>Higher power magnification shows infiltrating Kaposi sarcoma comprised of spindle-shaped tumor cells admixed with abnormal vascular channels (H&E stain).</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":[],"string":"[]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1477-7819-6-94-1\"/>","<graphic xlink:href=\"1477-7819-6-94-2\"/>","<graphic xlink:href=\"1477-7819-6-94-3\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1477-7819-6-94-1\\\"/>\",\n \"<graphic xlink:href=\\\"1477-7819-6-94-2\\\"/>\",\n \"<graphic xlink:href=\\\"1477-7819-6-94-3\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":17,"string":"17"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:38"},"citation":{"kind":"string","value":"World J Surg Oncol. 2008 Sep 2; 6:94"},"package_file":{"kind":"string","value":"oa_package/7e/43/PMC2538530.tar.gz"}}},{"rowIdx":119695,"cells":{"accession_id":{"kind":"string","value":"PMC2538533"},"pmid":{"kind":"string","value":"18727824"},"introduction":{"kind":"list like","value":["<title>Introduction</title>","<p>In the past, when unpurified insulins were used, allergic reactions to the drug were reported in 10% to 56% of patients [##UREF##0##1##]. Since human insulin and its analogues have been introduced, insulin allergies are rare and currently reported in only 0.1% to 2% of all patients treated with insulin [##REF##16306568##2##]. In most cases, allergic reactions are restricted to the skin and are either of a local immediate or delayed reaction type. These skin reactions are often self-limited under continuation of therapy. However, systemic, potentially life-threatening reactions such as urticaria or anaphylaxis have also been reported [##UREF##0##1##]. Both types of hypersensitivity may result from the insulin molecule itself, and also from protamine, which is used in many preparations to delay insulin absorption [##REF##1831420##3##, ####REF##10580216##4##, ##REF##15982236##5####15982236##5##]. Protamine sulphate is a low-molecular weight polycationic protein isolated from sperm of salmon or salmon-like fish. Besides its use as an insulin additive, protamine is also used to reverse the therapeutic effects of heparin. The intravenous or subcutaneous administration of protamine can provoke pseudoallergic reactions through non-immune mediated histamine release [##REF##15982236##5##]. In patients with diabetes mellitus, subcutaneous administration of protamine-containing insulin preparations can also provoke delayed, T-cell mediated skin reactions or granulomatous hypersensitivity [##REF##1390174##6##]. In addition to protamine, cresol and phenol, which both serve as preservatives in pharmaceutical products, may provoke allergic reactions [##REF##16930241##7##].</p>","<p>Successful treatment of insulin allergies has been reported using a continuous subcutaneous pump infusion of insulin [##REF##16369203##8##, ####UREF##1##9##, ##REF##14514615##10####14514615##10##], switching from human insulin to insulin aspart or lispro [##REF##15793215##11##,##REF##16375762##12##], or in severe cases, by pancreas transplantation [##REF##16771868##13##,##UREF##2##14##].</p>","<p>In the case presented, we suggest tolerance induction using an ultra-rush desensitization protocol as an easy-to-perform and well-tolerated therapy for patients with insulin allergies.</p>"],"string":"[\n \"<title>Introduction</title>\",\n \"<p>In the past, when unpurified insulins were used, allergic reactions to the drug were reported in 10% to 56% of patients [##UREF##0##1##]. Since human insulin and its analogues have been introduced, insulin allergies are rare and currently reported in only 0.1% to 2% of all patients treated with insulin [##REF##16306568##2##]. In most cases, allergic reactions are restricted to the skin and are either of a local immediate or delayed reaction type. These skin reactions are often self-limited under continuation of therapy. However, systemic, potentially life-threatening reactions such as urticaria or anaphylaxis have also been reported [##UREF##0##1##]. Both types of hypersensitivity may result from the insulin molecule itself, and also from protamine, which is used in many preparations to delay insulin absorption [##REF##1831420##3##, ####REF##10580216##4##, ##REF##15982236##5####15982236##5##]. Protamine sulphate is a low-molecular weight polycationic protein isolated from sperm of salmon or salmon-like fish. Besides its use as an insulin additive, protamine is also used to reverse the therapeutic effects of heparin. The intravenous or subcutaneous administration of protamine can provoke pseudoallergic reactions through non-immune mediated histamine release [##REF##15982236##5##]. In patients with diabetes mellitus, subcutaneous administration of protamine-containing insulin preparations can also provoke delayed, T-cell mediated skin reactions or granulomatous hypersensitivity [##REF##1390174##6##]. In addition to protamine, cresol and phenol, which both serve as preservatives in pharmaceutical products, may provoke allergic reactions [##REF##16930241##7##].</p>\",\n \"<p>Successful treatment of insulin allergies has been reported using a continuous subcutaneous pump infusion of insulin [##REF##16369203##8##, ####UREF##1##9##, ##REF##14514615##10####14514615##10##], switching from human insulin to insulin aspart or lispro [##REF##15793215##11##,##REF##16375762##12##], or in severe cases, by pancreas transplantation [##REF##16771868##13##,##UREF##2##14##].</p>\",\n \"<p>In the case presented, we suggest tolerance induction using an ultra-rush desensitization protocol as an easy-to-perform and well-tolerated therapy for patients with insulin allergies.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":[],"string":"[]","isConversational":false},"results":{"kind":"list like","value":[],"string":"[]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>Successful treatment of allergies due to insulin preparations has been reported during the last few years. In cases of hypersensitivity against protamine, the replacement of protamine-containing insulins by insulins without this additive is the simplest strategy to solve the problem. In patients in whom the insulin molecule itself causes local or systemic allergies, the management of these complications becomes much more difficult. Many authors have reported effective treatment using the insulin analogues, aspart and lispro, instead of human regular insulin [##REF##15793215##11##,##REF##16375762##12##,##REF##11679473##16##]. Unfortunately, in our patient, intracutaneous testing of insulin lispro, insulin aspart, and insulin glulisine also caused an allergic test reaction. Therefore, a change to one of the less immunogenic insulins did not seem to be a promising option. Other groups have managed insulin allergies with continuous subcutaneous insulin infusions or with intravenously injected insulins [##REF##16369203##8##,##UREF##1##9##,##REF##16421379##17##]. In all cases, these forms of therapy were successful, but were in part associated with a restricted quality-of-life. In severe cases, a solitary pancreas transplantation was the last chance to treat a life-threatening insulin allergy [##REF##16771868##13##,##UREF##2##14##].</p>","<p>According to cases reported by Wessbecher et al. [##REF##11551264##18##] in 2001 and Barranco et al. [##REF##12757463##19##] in 2003, we devised an ultra-rush treatment scheme using the subcutaneous administration of human insulin. After 3 days of therapy, our patient tolerated the formerly incompatible glargine insulin and showed only minimal local reactions at the injection site and which did not exceed a diameter of 2 mm.</p>","<p>The mechanism of tolerance induction in general and in our patient in particular still remains unclear. The most common type of insulin allergy is related to an IgE-mediated type I allergic reaction of the Coombs and Gell classification [##REF##16306568##2##]. Less frequently, type III Arthus-type reactions have been reported [##REF##16306568##2##]. In addition, insulin hypersensitivity can be related to a T-cell mediated type IV reaction. Our patient exhibited two different forms of hypersensitivity: 1) hypersensitivity against protamine and 2) hypersensitivity against the insulin molecule itself. As epicutaneous testing was completely negative, a T-cell mediated form of allergy seemed to be improbable. Histologic evaluation of a skin biopsy obtained from a local reaction proved an Arthus-type reaction, clearly indicating a type III reaction. Nevertheless, desensitization, such as performed in our patient and usually only successful in IgE-mediated type I reactions, was able to induce tolerance against formerly incompatible insulins.</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>Successful treatment of allergies due to insulin preparations has been reported during the last few years. In cases of hypersensitivity against protamine, the replacement of protamine-containing insulins by insulins without this additive is the simplest strategy to solve the problem. In patients in whom the insulin molecule itself causes local or systemic allergies, the management of these complications becomes much more difficult. Many authors have reported effective treatment using the insulin analogues, aspart and lispro, instead of human regular insulin [##REF##15793215##11##,##REF##16375762##12##,##REF##11679473##16##]. Unfortunately, in our patient, intracutaneous testing of insulin lispro, insulin aspart, and insulin glulisine also caused an allergic test reaction. Therefore, a change to one of the less immunogenic insulins did not seem to be a promising option. Other groups have managed insulin allergies with continuous subcutaneous insulin infusions or with intravenously injected insulins [##REF##16369203##8##,##UREF##1##9##,##REF##16421379##17##]. In all cases, these forms of therapy were successful, but were in part associated with a restricted quality-of-life. In severe cases, a solitary pancreas transplantation was the last chance to treat a life-threatening insulin allergy [##REF##16771868##13##,##UREF##2##14##].</p>\",\n \"<p>According to cases reported by Wessbecher et al. [##REF##11551264##18##] in 2001 and Barranco et al. [##REF##12757463##19##] in 2003, we devised an ultra-rush treatment scheme using the subcutaneous administration of human insulin. After 3 days of therapy, our patient tolerated the formerly incompatible glargine insulin and showed only minimal local reactions at the injection site and which did not exceed a diameter of 2 mm.</p>\",\n \"<p>The mechanism of tolerance induction in general and in our patient in particular still remains unclear. The most common type of insulin allergy is related to an IgE-mediated type I allergic reaction of the Coombs and Gell classification [##REF##16306568##2##]. Less frequently, type III Arthus-type reactions have been reported [##REF##16306568##2##]. In addition, insulin hypersensitivity can be related to a T-cell mediated type IV reaction. Our patient exhibited two different forms of hypersensitivity: 1) hypersensitivity against protamine and 2) hypersensitivity against the insulin molecule itself. As epicutaneous testing was completely negative, a T-cell mediated form of allergy seemed to be improbable. Histologic evaluation of a skin biopsy obtained from a local reaction proved an Arthus-type reaction, clearly indicating a type III reaction. Nevertheless, desensitization, such as performed in our patient and usually only successful in IgE-mediated type I reactions, was able to induce tolerance against formerly incompatible insulins.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>We would like to recommend insulin desensitization using an ultra-rush protocol with subcutaneous insulin applications as a rapid and easy method of treatment, even in cases in which intracutaneous testing is positive for several or all insulin preparations on-hand.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>We would like to recommend insulin desensitization using an ultra-rush protocol with subcutaneous insulin applications as a rapid and easy method of treatment, even in cases in which intracutaneous testing is positive for several or all insulin preparations on-hand.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Introduction</title>","<p>Insulin allergy may occur in patients treated with subcutaneous applications of insulin preparations. Besides additives in the insulin preparation such as protamine, cresol, and phenol, the insulin molecule itself may be the cause of the allergy. In the latter case, therapeutic options are rare.</p>","<title>Case presentation</title>","<p>A 68-year-old man with poorly controlled type 2 diabetes mellitus received different insulin preparations subcutaneously while on oral medication. Six to eight hours after each subcutaneous application, he developed pruritic plaques with a diameter of >15 cm at the injection sites that persisted for several days. Allergologic testing revealed positive reactions against every insulin preparation and against protamine. Investigation of serum samples demonstrated IgG antibodies against human and porcine insulin. We treated the patient with human insulin using an ultra-rush protocol beginning with 0.004 IU and a rapid augmentation in dose up to 5 IU. Therapy was accompanied by antihistamine therapy. Subsequent conversion to therapy with glargine insulin (6 IE twice daily) was well-tolerated.</p>","<title>Conclusion</title>","<p>As reported in this case, desensitization with subcutaneously administered human insulin using an ultra-rush protocol in patients with an insulin allergy may present an easy form of therapy that is successful within a few days.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Introduction</title>\",\n \"<p>Insulin allergy may occur in patients treated with subcutaneous applications of insulin preparations. Besides additives in the insulin preparation such as protamine, cresol, and phenol, the insulin molecule itself may be the cause of the allergy. In the latter case, therapeutic options are rare.</p>\",\n \"<title>Case presentation</title>\",\n \"<p>A 68-year-old man with poorly controlled type 2 diabetes mellitus received different insulin preparations subcutaneously while on oral medication. Six to eight hours after each subcutaneous application, he developed pruritic plaques with a diameter of >15 cm at the injection sites that persisted for several days. Allergologic testing revealed positive reactions against every insulin preparation and against protamine. Investigation of serum samples demonstrated IgG antibodies against human and porcine insulin. We treated the patient with human insulin using an ultra-rush protocol beginning with 0.004 IU and a rapid augmentation in dose up to 5 IU. Therapy was accompanied by antihistamine therapy. Subsequent conversion to therapy with glargine insulin (6 IE twice daily) was well-tolerated.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>As reported in this case, desensitization with subcutaneously administered human insulin using an ultra-rush protocol in patients with an insulin allergy may present an easy form of therapy that is successful within a few days.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Case presentation</title>","<p>We evaluated a 68-year-old man in our dermatologic outpatient unit. He suffered from type 2 diabetes and was initially treated with oral anti-diabetic medication. As normoglycaemia was not being achieved using maximal oral treatment and a low caloric diet, the patient was treated with insulin. The administration of different insulins (i.e. insulin detemir, insulin glargine, and human insulin) resulted in the development of pruritic plaques with a diameter of >15 cm at each injection site and which persisted for several days. Splitting of the dose and changing of the injection sites were not successful in resolving the reaction. Local factors, such as poor injection technique, misuse of the insulin injector, incorrect use of local disinfectants, or contact allergy to disinfectants were ruled out.</p>","<title>Skin tests</title>","<p>Intradermal tests were performed with 0.05 ml of different standard insulins and with a <italic>Lantus<sup>© </sup></italic>test kit from Sanofi Aventis (Frankfurt/Main, Germany) on the volar forearm. Physiological saline and histamine (0.01% histamine solution; Bencard, Munich, Germany) served as controls. Table ##TAB##0##1## shows the results of intradermal testing in detail. Figures ##FIG##0##1## and ##FIG##1##2## show positive intradermal testing with <italic>Levemir<sup>©</sup>, Huminsulin basal<sup>© </sup>Humalog<sup>©</sup></italic>, and <italic>Lantus<sup>© </sup></italic>(Fig. ##FIG##0##1##) and positive reactions against protamine-containing test solutions (Fig. ##FIG##1##2##).</p>","<p>Patch testing of the same substances and of different local disinfectants was negative.</p>","<title>Laboratory testing</title>","<p>Analysis of a blood sample showed normal islet cell antibodies (<1:10), elevated IgG antibodies against human insulin (56 U/ml; normal value, <1 U/ml), and elevated IgG antibodies against porcine insulin (12.4 ratio; normal value, <10.0). IgE antibodies against human and porcine insulin and against protamine were negative.</p>","<title>Histology</title>","<p>A skin biopsy taken from a plaque on an injection site of the abdominal wall showed an Arthus-type reaction (Fig. ##FIG##2##3##).</p>","<title>Therapy</title>","<p>On day 1, we treated the patient with subcutaneous injections of human insulin (0.004, 0.01, 0.02, 0.04, 0.1, 0.2, 0.5, and 1.0 IU) using injection intervals of 30 minutes with a daily allowance of 1.874 IU. Fexofenadin (180 mg twice daily) was used as a concomitant medication as recommended by Grammer and coworkers [##REF##6337201##15##]. On day 2, we injected 1.0, 2.0, 3.0, and 5 IU using injection intervals of 30 minutes. A daily allowance of 11 IU human insulin was reached. On day 3, we switched to the formerly incompatible insulin, <italic>Lantus<sup>©</sup></italic>, given twice daily at a dose of 6 IU. Therapy was well-tolerated on all days with normoglycaemic values. On day 3, the local reactions decreased to slight cutaneous reactions of 2 mm in diameter. Up to the present time, the patient has tolerated this form of therapy and fexofenadin treatment was reduced to 180 mg daily, and then stopped completely, 6 months after desensitization.</p>","<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>CP, CSLM, DOH and WT were involved in drafting the manuscript. CP and DOH performed the allergological testing and desensitization while CSLM carried out the histologic analysis of the skin biopsy. All authors have read and approved the final manuscript.</p>","<title>Consent</title>","<p>Written informed consent was obtained from the patient for publication of the case report and any accompanying images. A copy of the written informed consent is available for review by the Editor-in-Chief of this journal.</p>"],"string":"[\n \"<title>Case presentation</title>\",\n \"<p>We evaluated a 68-year-old man in our dermatologic outpatient unit. He suffered from type 2 diabetes and was initially treated with oral anti-diabetic medication. As normoglycaemia was not being achieved using maximal oral treatment and a low caloric diet, the patient was treated with insulin. The administration of different insulins (i.e. insulin detemir, insulin glargine, and human insulin) resulted in the development of pruritic plaques with a diameter of >15 cm at each injection site and which persisted for several days. Splitting of the dose and changing of the injection sites were not successful in resolving the reaction. Local factors, such as poor injection technique, misuse of the insulin injector, incorrect use of local disinfectants, or contact allergy to disinfectants were ruled out.</p>\",\n \"<title>Skin tests</title>\",\n \"<p>Intradermal tests were performed with 0.05 ml of different standard insulins and with a <italic>Lantus<sup>© </sup></italic>test kit from Sanofi Aventis (Frankfurt/Main, Germany) on the volar forearm. Physiological saline and histamine (0.01% histamine solution; Bencard, Munich, Germany) served as controls. Table ##TAB##0##1## shows the results of intradermal testing in detail. Figures ##FIG##0##1## and ##FIG##1##2## show positive intradermal testing with <italic>Levemir<sup>©</sup>, Huminsulin basal<sup>© </sup>Humalog<sup>©</sup></italic>, and <italic>Lantus<sup>© </sup></italic>(Fig. ##FIG##0##1##) and positive reactions against protamine-containing test solutions (Fig. ##FIG##1##2##).</p>\",\n \"<p>Patch testing of the same substances and of different local disinfectants was negative.</p>\",\n \"<title>Laboratory testing</title>\",\n \"<p>Analysis of a blood sample showed normal islet cell antibodies (<1:10), elevated IgG antibodies against human insulin (56 U/ml; normal value, <1 U/ml), and elevated IgG antibodies against porcine insulin (12.4 ratio; normal value, <10.0). IgE antibodies against human and porcine insulin and against protamine were negative.</p>\",\n \"<title>Histology</title>\",\n \"<p>A skin biopsy taken from a plaque on an injection site of the abdominal wall showed an Arthus-type reaction (Fig. ##FIG##2##3##).</p>\",\n \"<title>Therapy</title>\",\n \"<p>On day 1, we treated the patient with subcutaneous injections of human insulin (0.004, 0.01, 0.02, 0.04, 0.1, 0.2, 0.5, and 1.0 IU) using injection intervals of 30 minutes with a daily allowance of 1.874 IU. Fexofenadin (180 mg twice daily) was used as a concomitant medication as recommended by Grammer and coworkers [##REF##6337201##15##]. On day 2, we injected 1.0, 2.0, 3.0, and 5 IU using injection intervals of 30 minutes. A daily allowance of 11 IU human insulin was reached. On day 3, we switched to the formerly incompatible insulin, <italic>Lantus<sup>©</sup></italic>, given twice daily at a dose of 6 IU. Therapy was well-tolerated on all days with normoglycaemic values. On day 3, the local reactions decreased to slight cutaneous reactions of 2 mm in diameter. Up to the present time, the patient has tolerated this form of therapy and fexofenadin treatment was reduced to 180 mg daily, and then stopped completely, 6 months after desensitization.</p>\",\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>CP, CSLM, DOH and WT were involved in drafting the manuscript. CP and DOH performed the allergological testing and desensitization while CSLM carried out the histologic analysis of the skin biopsy. All authors have read and approved the final manuscript.</p>\",\n \"<title>Consent</title>\",\n \"<p>Written informed consent was obtained from the patient for publication of the case report and any accompanying images. A copy of the written informed consent is available for review by the Editor-in-Chief of this journal.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title/>"],"string":"[\n \"<title/>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Intradermal testing showing positive reactions against <italic>Levemir<sup>© </sup>(1), Huminsulin basal<sup>© </sup>(2), Humalog<sup>© </sup>(3)</italic>, and <italic>Lantus<sup>© </sup></italic>(4) 20 minutes after injection</bold>. Histamine (H) served as a positive, aqua dest. (Ø) as a negative control.</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Results of intradermal testing using the Sanofi Aventis Insuman<sup>© </sup>test kit</bold>. Protamine-containing test solutions (6 and 7) showed clear positive results 20 minutes after injections, while other components were negative.</p></caption></fig>","<fig position=\"float\" id=\"F3\"><label>Figure 3</label><caption><p><bold>Histologic slide of a skin biopsy obtained from an allergic skin reaction on the injection site: regular epidermis; congestion of different inflammatory cells in blood vessels with emission in the adjacent connective tissue of deeper dermal parts</bold>. Hematoxylin/eosin staining, magnification ×200; inset: Giemsa staining, magnification ×200.</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p><bold>Intradermal testing showing positive reactions against <italic>Levemir<sup>© </sup>(1), Huminsulin basal<sup>© </sup>(2), Humalog<sup>© </sup>(3)</italic>, and <italic>Lantus<sup>© </sup></italic>(4) 20 minutes after injection</bold>. Histamine (H) served as a positive, aqua dest. (Ø) as a negative control.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p><bold>Results of intradermal testing using the Sanofi Aventis Insuman<sup>© </sup>test kit</bold>. Protamine-containing test solutions (6 and 7) showed clear positive results 20 minutes after injections, while other components were negative.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F3\\\"><label>Figure 3</label><caption><p><bold>Histologic slide of a skin biopsy obtained from an allergic skin reaction on the injection site: regular epidermis; congestion of different inflammatory cells in blood vessels with emission in the adjacent connective tissue of deeper dermal parts</bold>. Hematoxylin/eosin staining, magnification ×200; inset: Giemsa staining, magnification ×200.</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Substances used in intradermal testing</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"left\"><bold>Substance</bold></td><td align=\"left\"><bold>20 minutes</bold></td><td align=\"left\"><bold>24 hours</bold></td><td align=\"left\"><bold>48 hours</bold></td></tr></thead><tbody><tr><td align=\"left\">1</td><td align=\"left\"><bold><italic>Levemir<sup>© </sup></italic></bold>(insulin glargine, m-cresol, glycerol)</td><td align=\"left\">+</td><td align=\"left\">++</td><td align=\"left\">++</td></tr><tr><td align=\"left\">2</td><td align=\"left\"><bold><italic>Huminsulin basal<sup>© </sup></italic></bold>(human insulin, m-cresol, phenol, glycerol, protamine)</td><td align=\"left\">+</td><td align=\"left\">++</td><td align=\"left\">++</td></tr><tr><td align=\"left\">3</td><td align=\"left\"><bold><italic>Lantus<sup>© </sup></italic></bold>(insulin glargine, m-cresol, glycerol)</td><td align=\"left\">+</td><td align=\"left\">++</td><td align=\"left\">++</td></tr><tr><td align=\"left\">4</td><td align=\"left\"><bold><italic>Actrapid penfill<sup>© </sup></italic></bold>(human insulin, m-cresol, glycerol)</td><td align=\"left\">+</td><td align=\"left\">++</td><td align=\"left\">++</td></tr><tr><td align=\"left\">5</td><td align=\"left\"><bold><italic>Insuman rapid<sup>© </sup></italic></bold>(human insulin, m-cresol)</td><td align=\"left\">+</td><td align=\"left\">++</td><td align=\"left\">++</td></tr><tr><td align=\"left\">6</td><td align=\"left\"><bold><italic>Berlinsulin H normal<sup>© </sup></italic></bold>(human insulin, phenol, protamine, glycerol)</td><td align=\"left\">+</td><td align=\"left\">++</td><td align=\"left\">++</td></tr><tr><td align=\"left\">7</td><td align=\"left\"><bold><italic>Insulin Novo semilente<sup>© </sup></italic></bold>(porcine insulin, methyl-4-hydroxybenzoate, natrium acetate)</td><td align=\"left\">+</td><td align=\"left\">++</td><td align=\"left\">++</td></tr><tr><td align=\"left\">8</td><td align=\"left\"><bold><italic>Humalog<sup>© </sup></italic></bold>(insulin lispro, m-cresol, glycerol, NaH<sub>2</sub>PO<sub>4 </sub>× H<sub>2</sub>O, zinc oxide)</td><td align=\"left\">+</td><td align=\"left\">+</td><td align=\"left\">+</td></tr><tr><td align=\"left\">9</td><td align=\"left\"><bold><italic>Novorapid<sup>© </sup></italic></bold>(insulin aspart, glycerol, m-cresol, phenol, NaH<sub>2</sub>PO<sub>4 </sub>× H<sub>2</sub>O)</td><td align=\"left\">+</td><td align=\"left\">+</td><td align=\"left\">+</td></tr><tr><td align=\"left\">10</td><td align=\"left\"><bold><italic>Apidra<sup>© </sup></italic></bold>(insulin glulisine, m-cresol, trometamol, polysorbate 20)</td><td align=\"left\">+</td><td align=\"left\">+</td><td align=\"left\">+</td></tr><tr><td align=\"left\">11</td><td align=\"left\"><bold>Test solution A </bold>(NaH<sub>2</sub>PO<sub>4 </sub>× H<sub>2</sub>O 2.1 mg, glycerol 85% 18.8 mg, phenol 0.6 mg, m-cresol 1.5 mg in aqua dest. ad 1.0 ml)</td><td align=\"left\">-</td><td align=\"left\">-</td><td align=\"left\">-</td></tr><tr><td align=\"left\">12</td><td align=\"left\"><bold>Test solution B </bold>(glycerol 85% 18.8 mg, phenol 0.6 mg, m-cresol 1.5 mg in aqua dest. ad 1.0 ml)</td><td align=\"left\">-</td><td align=\"left\">-</td><td align=\"left\">-</td></tr><tr><td align=\"left\">13</td><td align=\"left\"><bold>Test solution C </bold>(phenol 0.6 mg, m-cresol 1.5 mg in aqua dest. ad 1.0 ml)</td><td align=\"left\">+</td><td align=\"left\">-</td><td align=\"left\">-</td></tr><tr><td align=\"left\">14</td><td align=\"left\"><bold>Test solution D </bold>(phenol 0.6 mg in aqua dest. ad 1.0 ml)</td><td align=\"left\">+</td><td align=\"left\">-</td><td align=\"left\">-</td></tr><tr><td align=\"left\">15</td><td align=\"left\"><bold>Test solution E </bold>(m-cresol 1.5 mg in aqua dest. ad 1.0 ml)</td><td align=\"left\">+</td><td align=\"left\">-</td><td align=\"left\">-</td></tr><tr><td align=\"left\">16</td><td align=\"left\"><bold>Test solution F </bold>(protamine 0.1 mg, NaH<sub>2</sub>PO<sub>4 </sub>× H<sub>2</sub>O 2.1 mg, glycerol 85% 18.8 mg, phenol 0.6 mg, m-cresol 1.5 mg in aqua dest. ad 1.0 ml)</td><td align=\"left\">+</td><td align=\"left\">++</td><td align=\"left\">++</td></tr><tr><td align=\"left\">17</td><td align=\"left\"><bold>Test solution G </bold>(protamine 0.1 mg in aqua dest. ad 1.0 ml)</td><td align=\"left\">-</td><td align=\"left\">++</td><td align=\"left\">++</td></tr><tr><td align=\"left\">18</td><td align=\"left\"><bold>Test solution H </bold>(zinc chloride 0.06 mg, glycerol 85% 20 mg, m-cresol 2.7 mg in aqua dest. ad 1.0 ml)</td><td align=\"left\">-</td><td align=\"left\">-</td><td align=\"left\">-</td></tr><tr><td align=\"left\">19</td><td align=\"left\"><bold>Test solution I </bold>(glycerol 85% 20 mg, m-cresol 2.7 mg in aqua dest. ad 1.0 ml)</td><td align=\"left\">-</td><td align=\"left\">-</td><td align=\"left\">-</td></tr><tr><td align=\"left\">20</td><td align=\"left\"><bold>Test solution J </bold>(m-cresol 2.7 mg in aqua dest. ad 1.0 ml)</td><td align=\"left\">-</td><td align=\"left\">-</td><td align=\"left\">-</td></tr><tr><td align=\"left\">21</td><td align=\"left\"><bold>Aqua dest.</bold></td><td align=\"left\">-</td><td align=\"left\">-</td><td align=\"left\">-</td></tr><tr><td align=\"left\">22</td><td align=\"left\"><bold>NaCl 0.9%</bold></td><td align=\"left\">-</td><td align=\"left\">-</td><td align=\"left\">-</td></tr><tr><td align=\"left\">23</td><td align=\"left\"><bold>Histamine 0.01%</bold></td><td align=\"left\">+</td><td align=\"left\">-</td><td align=\"left\">-</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Substances used in intradermal testing</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td/><td align=\\\"left\\\"><bold>Substance</bold></td><td align=\\\"left\\\"><bold>20 minutes</bold></td><td align=\\\"left\\\"><bold>24 hours</bold></td><td align=\\\"left\\\"><bold>48 hours</bold></td></tr></thead><tbody><tr><td align=\\\"left\\\">1</td><td align=\\\"left\\\"><bold><italic>Levemir<sup>© </sup></italic></bold>(insulin glargine, m-cresol, glycerol)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">++</td><td align=\\\"left\\\">++</td></tr><tr><td align=\\\"left\\\">2</td><td align=\\\"left\\\"><bold><italic>Huminsulin basal<sup>© </sup></italic></bold>(human insulin, m-cresol, phenol, glycerol, protamine)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">++</td><td align=\\\"left\\\">++</td></tr><tr><td align=\\\"left\\\">3</td><td align=\\\"left\\\"><bold><italic>Lantus<sup>© </sup></italic></bold>(insulin glargine, m-cresol, glycerol)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">++</td><td align=\\\"left\\\">++</td></tr><tr><td align=\\\"left\\\">4</td><td align=\\\"left\\\"><bold><italic>Actrapid penfill<sup>© </sup></italic></bold>(human insulin, m-cresol, glycerol)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">++</td><td align=\\\"left\\\">++</td></tr><tr><td align=\\\"left\\\">5</td><td align=\\\"left\\\"><bold><italic>Insuman rapid<sup>© </sup></italic></bold>(human insulin, m-cresol)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">++</td><td align=\\\"left\\\">++</td></tr><tr><td align=\\\"left\\\">6</td><td align=\\\"left\\\"><bold><italic>Berlinsulin H normal<sup>© </sup></italic></bold>(human insulin, phenol, protamine, glycerol)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">++</td><td align=\\\"left\\\">++</td></tr><tr><td align=\\\"left\\\">7</td><td align=\\\"left\\\"><bold><italic>Insulin Novo semilente<sup>© </sup></italic></bold>(porcine insulin, methyl-4-hydroxybenzoate, natrium acetate)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">++</td><td align=\\\"left\\\">++</td></tr><tr><td align=\\\"left\\\">8</td><td align=\\\"left\\\"><bold><italic>Humalog<sup>© </sup></italic></bold>(insulin lispro, m-cresol, glycerol, NaH<sub>2</sub>PO<sub>4 </sub>× H<sub>2</sub>O, zinc oxide)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">+</td></tr><tr><td align=\\\"left\\\">9</td><td align=\\\"left\\\"><bold><italic>Novorapid<sup>© </sup></italic></bold>(insulin aspart, glycerol, m-cresol, phenol, NaH<sub>2</sub>PO<sub>4 </sub>× H<sub>2</sub>O)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">+</td></tr><tr><td align=\\\"left\\\">10</td><td align=\\\"left\\\"><bold><italic>Apidra<sup>© </sup></italic></bold>(insulin glulisine, m-cresol, trometamol, polysorbate 20)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">+</td></tr><tr><td align=\\\"left\\\">11</td><td align=\\\"left\\\"><bold>Test solution A </bold>(NaH<sub>2</sub>PO<sub>4 </sub>× H<sub>2</sub>O 2.1 mg, glycerol 85% 18.8 mg, phenol 0.6 mg, m-cresol 1.5 mg in aqua dest. ad 1.0 ml)</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr><tr><td align=\\\"left\\\">12</td><td align=\\\"left\\\"><bold>Test solution B </bold>(glycerol 85% 18.8 mg, phenol 0.6 mg, m-cresol 1.5 mg in aqua dest. ad 1.0 ml)</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr><tr><td align=\\\"left\\\">13</td><td align=\\\"left\\\"><bold>Test solution C </bold>(phenol 0.6 mg, m-cresol 1.5 mg in aqua dest. ad 1.0 ml)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr><tr><td align=\\\"left\\\">14</td><td align=\\\"left\\\"><bold>Test solution D </bold>(phenol 0.6 mg in aqua dest. ad 1.0 ml)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr><tr><td align=\\\"left\\\">15</td><td align=\\\"left\\\"><bold>Test solution E </bold>(m-cresol 1.5 mg in aqua dest. ad 1.0 ml)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr><tr><td align=\\\"left\\\">16</td><td align=\\\"left\\\"><bold>Test solution F </bold>(protamine 0.1 mg, NaH<sub>2</sub>PO<sub>4 </sub>× H<sub>2</sub>O 2.1 mg, glycerol 85% 18.8 mg, phenol 0.6 mg, m-cresol 1.5 mg in aqua dest. ad 1.0 ml)</td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">++</td><td align=\\\"left\\\">++</td></tr><tr><td align=\\\"left\\\">17</td><td align=\\\"left\\\"><bold>Test solution G </bold>(protamine 0.1 mg in aqua dest. ad 1.0 ml)</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">++</td><td align=\\\"left\\\">++</td></tr><tr><td align=\\\"left\\\">18</td><td align=\\\"left\\\"><bold>Test solution H </bold>(zinc chloride 0.06 mg, glycerol 85% 20 mg, m-cresol 2.7 mg in aqua dest. ad 1.0 ml)</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr><tr><td align=\\\"left\\\">19</td><td align=\\\"left\\\"><bold>Test solution I </bold>(glycerol 85% 20 mg, m-cresol 2.7 mg in aqua dest. ad 1.0 ml)</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr><tr><td align=\\\"left\\\">20</td><td align=\\\"left\\\"><bold>Test solution J </bold>(m-cresol 2.7 mg in aqua dest. ad 1.0 ml)</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr><tr><td align=\\\"left\\\">21</td><td align=\\\"left\\\"><bold>Aqua dest.</bold></td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr><tr><td align=\\\"left\\\">22</td><td align=\\\"left\\\"><bold>NaCl 0.9%</bold></td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr><tr><td align=\\\"left\\\">23</td><td align=\\\"left\\\"><bold>Histamine 0.01%</bold></td><td align=\\\"left\\\">+</td><td align=\\\"left\\\">-</td><td align=\\\"left\\\">-</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":["<table-wrap-foot><p>Test solutions A-J were obtained from the Sanofi Aventis Insuman<sup>© </sup>test kit. Test results were noted 20 minutes, 24 hours, and 48 hours after injection. Interpretation of test results: -, no skin reaction; +, erythema and infiltrate with a diameter of <20 mm; ++, erythema and infiltrate with a diameter of >20 mm.</p></table-wrap-foot>"],"string":"[\n \"<table-wrap-foot><p>Test solutions A-J were obtained from the Sanofi Aventis Insuman<sup>© </sup>test kit. Test results were noted 20 minutes, 24 hours, and 48 hours after injection. Interpretation of test results: -, no skin reaction; +, erythema and infiltrate with a diameter of <20 mm; ++, erythema and infiltrate with a diameter of >20 mm.</p></table-wrap-foot>\"\n]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1752-1947-2-283-1\"/>","<graphic xlink:href=\"1752-1947-2-283-2\"/>","<graphic xlink:href=\"1752-1947-2-283-3\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1752-1947-2-283-1\\\"/>\",\n \"<graphic xlink:href=\\\"1752-1947-2-283-2\\\"/>\",\n \"<graphic xlink:href=\\\"1752-1947-2-283-3\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Liebermann\"], \"given-names\": [\"P\"], \"article-title\": [\"Allergic reactions to insulin\"], \"source\": [\"J Am Med Assoc\"], \"year\": [\"1971\"], \"volume\": [\"215\"], \"fpage\": [\"1106\"], \"lpage\": [\"1112\"], \"pub-id\": [\"10.1001/jama.215.7.1106\"]}, {\"surname\": [\"Moyes\"], \"given-names\": [\"V\"], \"article-title\": [\"Insulin allergy in a patient with Type 2 diabetes successfully treated with continuous subcutaneous insulin infusion\"], \"source\": [\"Diabetes Med\"], \"year\": [\"2006\"], \"volume\": [\"23\"], \"fpage\": [\"204\"], \"lpage\": [\"206\"], \"pub-id\": [\"10.1111/j.1464-5491.2006.01811.x\"]}, {\"surname\": [\"Malaise\"], \"given-names\": [\"J\"], \"article-title\": [\"Pancreas transplantation for treatment of generalized allergy to human insulin in type 1 diabetes\"], \"source\": [\"Transpl Proc\"], \"year\": [\"2005\"], \"volume\": [\"37\"], \"fpage\": [\"2839\"], \"pub-id\": [\"10.1016/j.transproceed.2005.05.020\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":19,"string":"19"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:38"},"citation":{"kind":"string","value":"J Med Case Reports. 2008 Aug 26; 2:283"},"package_file":{"kind":"string","value":"oa_package/f7/e5/PMC2538533.tar.gz"}}},{"rowIdx":119696,"cells":{"accession_id":{"kind":"string","value":"PMC2538534"},"pmid":{"kind":"string","value":"18700978"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>The flavonoid biosynthesis pathway is central to the formation of the phenolic compounds involved in many plant traits, including resistance to abiotic and biotic stresses [##UREF##0##1##, ####UREF##1##2##, ##REF##11724379##3##, ##UREF##2##4####2##4##]. One branch of the pathway is responsible for the generation of anthocyanin, which is present in various plant organs in most plant species, including the allohexaploid crop species, bread wheat (<italic>Triticum aestivum </italic>L.). Two major groups of anthocyanin pigmentation genes are present in wheat: the first includes <italic>Rc-1</italic>, <italic>Pc-1</italic>, <italic>Pan-1</italic>, <italic>Plb-1 </italic>and <italic>Pls-1 </italic>which encode the pigmentation in, respectively, the coleoptile, culm, anthers, leaf blades and leaf sheaths; while the second consists of <italic>Pp </italic>and <italic>Ra</italic>, which are expressed in, respectively, the pericarp and auricle [##UREF##3##5##]. The former genes are closely linked to one another on each of the short arms of the homoeologous group 7 chromosomes. An orthologue of maize gene <italic>c1 </italic>(which encodes a Myb-like transcriptional factor controlling tissue-specific anthocyanin biosynthesis [##REF##3428265##6##]) was mapped earlier on each of the short arms of wheat homoeologous group 7 chromosomes, too [##UREF##4##7##] in positions highly comparable to those of <italic>Rc-1 </italic>(red coleoptile) genes [##UREF##3##5##,##REF##12582667##8##]. Furthermore, it was shown that <italic>c1</italic>, when transferred to wheat, was able to induce anthocyanin pigmentation in non-pigmented wheat coleoptiles [##UREF##5##9##]. At the same time <italic>Rc-1 </italic>was shown to upregulate a number of wheat flavonoid biosynthesis pathway genes – <italic>DFR </italic>(dihydroflavonol-4-reductase), <italic>ANS </italic>(anthocyanidin synthase) and <italic>UFGT </italic>(UDPG flavonol 3-0-glucosyl transferase) [##UREF##6##10##,##REF##16094442##11##]. Recognizing elements for <italic>c1 </italic>have also been identified in the promoter sequence of <italic>Arabidopsis thaliana F3H </italic>gene (flavanone 3-hydroxylase – one of the key enzymes involved in the biosynthesis of flavonoid compounds [##REF##15821875##12##]), suggesting that <italic>Rc-1 </italic>can probably exert a regulatory role for wheat <italic>F3H</italic>, too. <italic>F3H </italic>orthologues have been isolated in barley and maize [##UREF##7##13##,##REF##7773305##14##] as well as in a range of other plant species <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.ncbi.nlm.nih.gov/Database/\"/>, but have yet to be described in wheat.</p>","<p>The patterns of expression of homoeologous genes in wheat have been intensively studied in recent years [##REF##16160850##15##, ####REF##16899084##16##, ##REF##16158239##17##, ##REF##16306141##18##, ##REF##15952073##19##, ##REF##16260753##20##, ##REF##17586655##21####17586655##21##], but the interaction between structural genes and their homoeologous regulatory genes is unclear. The question remains as to whether, in an allopolyploid, this interaction is genome-specific, or whether regulation cuts across genomes. The <italic>Rc-1 </italic>and <italic>F3H </italic>genes are a suitable model to investigate just this issue, as the expression of <italic>Rc-1 </italic>generates a clear phenotype, and the latter are well-characterized at the molecular level. In this paper, we describe the cloning, sequence analysis, mapping and expression of <italic>F3H </italic>orthologues in bread wheat and its relatives, and the interaction between <italic>F3H </italic>and the <italic>Rc-1 </italic>homoeologues.</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>The flavonoid biosynthesis pathway is central to the formation of the phenolic compounds involved in many plant traits, including resistance to abiotic and biotic stresses [##UREF##0##1##, ####UREF##1##2##, ##REF##11724379##3##, ##UREF##2##4####2##4##]. One branch of the pathway is responsible for the generation of anthocyanin, which is present in various plant organs in most plant species, including the allohexaploid crop species, bread wheat (<italic>Triticum aestivum </italic>L.). Two major groups of anthocyanin pigmentation genes are present in wheat: the first includes <italic>Rc-1</italic>, <italic>Pc-1</italic>, <italic>Pan-1</italic>, <italic>Plb-1 </italic>and <italic>Pls-1 </italic>which encode the pigmentation in, respectively, the coleoptile, culm, anthers, leaf blades and leaf sheaths; while the second consists of <italic>Pp </italic>and <italic>Ra</italic>, which are expressed in, respectively, the pericarp and auricle [##UREF##3##5##]. The former genes are closely linked to one another on each of the short arms of the homoeologous group 7 chromosomes. An orthologue of maize gene <italic>c1 </italic>(which encodes a Myb-like transcriptional factor controlling tissue-specific anthocyanin biosynthesis [##REF##3428265##6##]) was mapped earlier on each of the short arms of wheat homoeologous group 7 chromosomes, too [##UREF##4##7##] in positions highly comparable to those of <italic>Rc-1 </italic>(red coleoptile) genes [##UREF##3##5##,##REF##12582667##8##]. Furthermore, it was shown that <italic>c1</italic>, when transferred to wheat, was able to induce anthocyanin pigmentation in non-pigmented wheat coleoptiles [##UREF##5##9##]. At the same time <italic>Rc-1 </italic>was shown to upregulate a number of wheat flavonoid biosynthesis pathway genes – <italic>DFR </italic>(dihydroflavonol-4-reductase), <italic>ANS </italic>(anthocyanidin synthase) and <italic>UFGT </italic>(UDPG flavonol 3-0-glucosyl transferase) [##UREF##6##10##,##REF##16094442##11##]. Recognizing elements for <italic>c1 </italic>have also been identified in the promoter sequence of <italic>Arabidopsis thaliana F3H </italic>gene (flavanone 3-hydroxylase – one of the key enzymes involved in the biosynthesis of flavonoid compounds [##REF##15821875##12##]), suggesting that <italic>Rc-1 </italic>can probably exert a regulatory role for wheat <italic>F3H</italic>, too. <italic>F3H </italic>orthologues have been isolated in barley and maize [##UREF##7##13##,##REF##7773305##14##] as well as in a range of other plant species <ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www.ncbi.nlm.nih.gov/Database/\\\"/>, but have yet to be described in wheat.</p>\",\n \"<p>The patterns of expression of homoeologous genes in wheat have been intensively studied in recent years [##REF##16160850##15##, ####REF##16899084##16##, ##REF##16158239##17##, ##REF##16306141##18##, ##REF##15952073##19##, ##REF##16260753##20##, ##REF##17586655##21####17586655##21##], but the interaction between structural genes and their homoeologous regulatory genes is unclear. The question remains as to whether, in an allopolyploid, this interaction is genome-specific, or whether regulation cuts across genomes. The <italic>Rc-1 </italic>and <italic>F3H </italic>genes are a suitable model to investigate just this issue, as the expression of <italic>Rc-1 </italic>generates a clear phenotype, and the latter are well-characterized at the molecular level. In this paper, we describe the cloning, sequence analysis, mapping and expression of <italic>F3H </italic>orthologues in bread wheat and its relatives, and the interaction between <italic>F3H </italic>and the <italic>Rc-1 </italic>homoeologues.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<title>Plant materials and RNA extraction</title>","<p>The bread wheat cultivars 'Chinese Spring', 'Opata', 'Flair', 'Prinz', 'Golubka', 'Novosibirskaya 67', the synthetic hexaploid wheat 'W7984', tetraploid <italic>T. timopheevii </italic>k-38555 (AAGG) and the diploids <italic>T. urartu </italic>TMU06 (AA), <italic>Aegilops speltoides </italic>TS01 (SS) and <italic>Ae. tauschii </italic>TQ17 (DD) were used for PCR-based cloning. The complete set of 'Chinese Spring' nulli-tetrasomic lines [##UREF##14##34##], a subset of homoeologous group 2 chromosome deletion lines [##UREF##15##35##], introgression line 842 derived from the cross <italic>T. aestivum </italic>cv. 'Saratovskaya 29' × <italic>T. timopheevii </italic>[##UREF##8##22##] were exploited to establish chromosome bin locations. Eight progeny from the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732' [##REF##12582667##8##] and a set of six homozygous lines each containing a different chromosome 7D segment derived from <italic>Ae. tauschii </italic>in a 'Chinese Spring' background [##REF##16341683##23##] were used for RT-PCR. Quantitative examination of <italic>F3H </italic>expression was measured in 'Chinese Spring' and 'Mironovskaya 808' and the single chromosome substitution lines 'Chinese Spring' ('Hope' 7A) and 'Chinese Spring' ('Hope' 7B). DNA was extracted from seven day old seedlings following the procedure described earlier [##UREF##16##36##]. RNA was extracted from seedlings grown at 20°C under a 12 h day/12 h night regime using the QIAGEN <ext-link ext-link-type=\"uri\" xlink:href=\"http://www1.qiagen.com/\"/> Plant Rneasy Kit, followed by DNAse treatment. For RT-PCR, RNA was extracted on the fourth day after germination. For quantitative RT-PCR, RNA was extracted every 24 h from two to six day old seedlings.</p>","<title>PCR-based cloning and sequence analysis</title>","<p>The barley <italic>F3H </italic>cDNA sequence [##UREF##7##13##] was aligned with matching wheat ESTs lodged in <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.ncbi.nlm.nih.gov/Database/\"/>, employing Multalin v5.4.1 (using absolute alignment score with gap value of 12 and gap length value of 2) [##REF##2849754##37##]. Sets of primers flanking various <italic>F3H </italic>gene segments were designed using OLIGO software (Table ##TAB##5##6##) [##REF##2587212##38##], with one primer pair as described earlier [##REF##16094442##11##]. PCR reaction mixtures (50 μl) contained 50 ng template, 67 mM Tris HCl pH8.8, 1.8 mM MgCl<sub>2</sub>, 0.01% Tween 20, 18 mM (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>, 0.2 mM dNTP, 0.25 mM each primer and 1 U Taq DNA polymerase. PCR amplifications began with a 94°C/5 min incubation, followed by 45 cycles of 94°C/1 min, 60°C/2 min, 72°C/2 min, and a final extension of 72°C/10 min. PCR fragments were recovered from 1% agarose gels, purified using a QIAGEN MinElute Gel Extraction Kit, and cloned with a QIAGEN PCR Cloning Kit. Between five and ten clones per each primer combination per diploid genome were sequenced in both directions to eliminate PCR and sequencing errors or PCR-generated chimeras. Sequencing was effected using an ABI PRISM Dye Terminator Cycle Sequencing ready reaction kit (\"Perkin Elmer\") with pUC/M13 forward and reverse primers. Full-(or partial) length sequences of various <italic>F3H </italic>gene copies were constructed from overlapping sequences. Cluster analysis was performed on MEGA v3.1 software [##REF##15260895##39##] using the UPGMA (unweighted pair-group method with arithmetic average) algorithm and 500 bootstrap trials.</p>","<title>Chromosomal assignment and physical mapping of F3H</title>","<p>Specific primer pairs were designed to amplify each wheat <italic>F3H </italic>copy (Table ##TAB##5##6##). To obtain a unique amplification product, the 3' end of at least one of the two primers matched the copy-specific sequence. A touchdown PCR protocol was used to amplify from templates of the 'Chinese Spring' nulli-tetrasomic and deletion lines and the <italic>T. aestivum </italic>× <italic>T. timopheevii </italic>introgression line 842 in 20 μl reactions by applying a denaturing step of 94°C/2 min, 13 cycles of 94°C/15 s, 65°C/30 s (decreasing by 0.7°C/cycle), 72°C/45 s, 24 cycles of 94°C/15 s, 56/30 s, 72°C/45 s; and a final extension of 72°C/5 min. The specificity of the amplifications was confirmed by cloning and sequencing of the PCR product from 'Chinese Spring'. The microsatellite analysis of the 'Chinese Spring' deletion lines was performed using procedures described earlier [##REF##9691054##40##]. The microsatellite genotypic data of the <italic>T. aestivum </italic>× <italic>T. timopheevii </italic>introgression line 842 have been published [##UREF##8##22##].</p>","<title>RT-PCR and qRT-PCR</title>","<p>Single-stranded cDNA was synthesized from 1 mg total RNA using a (dT)<sub>15 </sub>primer and the QIAGEN Omniscript Reverse Transcription kit in a 20 μl reaction mixture. RT-PCR was performed with <italic>F3H </italic>primers published earlier [##REF##16094442##11##] or with <italic>F3H </italic>gene copy-specific primers (Table ##TAB##5##6##). The standardization of cDNA template was performed using ubiquitin (UBC) primers [##REF##16094442##11##]. PCR products were separated by 2% agarose gel electrophoresis. <italic>F3H </italic>gene copy-specific primers were also applied for qRT-PCR, which used a QIAGEN QuantiTect SYBR Green kit. UBC and GAPDH primers were used to standardize the cDNA template. The amplifications were performed in an Applied Biosystems 7900 HT fast real time PCR system. Pre-determined amounts of cloned cDNA were used to generate standard curves. Each sample was run in three replicates. The specificity of the qRT-PCR products was confirmed by 2% agarose gel electrophoresis. Statistical significance of differences in <italic>F3H </italic>expression level either between <italic>F3H </italic>homoeologues or between different genotypes was assessed by Student's t-test for matched pairs. When <italic>F3H </italic>homoeologues were compared, T-values were calculated for each pair (<italic>F3H-A1 vs F3H-B1</italic>, etc.) in each genotype (Table ##TAB##2##3##), and 'matched pairs' were represented by expression level values obtained for respective pair of <italic>F3H </italic>homoeologues at the same day in the same genotype. When comparison was made between genotypes, T-values were calculated for each pair of genotypes ('Chinese Spring' ('Hope' 7A) <italic>vs </italic>'Chinese Spring' ('Hope' 7B), etc.; Table ##TAB##3##4##), and 'matched pairs' were represented by expression level values obtained in respective pair of genotypes at the same day for the same <italic>F3H </italic>gene copy.</p>","<title>Accession numbers for sequence data</title>","<p>GenBank: <ext-link ext-link-type=\"gen\" xlink:href=\"EF463100\">EF463100</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"EU402957\">EU402957</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"EU402958\">EU402958</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"DQ233636\">DQ233636</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"EU402959\">EU402959</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"EU402960\">EU402960</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"EU402961\">EU402961</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"EU402963\">EU402963</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"DQ233637\">DQ233637</ext-link>.</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<title>Plant materials and RNA extraction</title>\",\n \"<p>The bread wheat cultivars 'Chinese Spring', 'Opata', 'Flair', 'Prinz', 'Golubka', 'Novosibirskaya 67', the synthetic hexaploid wheat 'W7984', tetraploid <italic>T. timopheevii </italic>k-38555 (AAGG) and the diploids <italic>T. urartu </italic>TMU06 (AA), <italic>Aegilops speltoides </italic>TS01 (SS) and <italic>Ae. tauschii </italic>TQ17 (DD) were used for PCR-based cloning. The complete set of 'Chinese Spring' nulli-tetrasomic lines [##UREF##14##34##], a subset of homoeologous group 2 chromosome deletion lines [##UREF##15##35##], introgression line 842 derived from the cross <italic>T. aestivum </italic>cv. 'Saratovskaya 29' × <italic>T. timopheevii </italic>[##UREF##8##22##] were exploited to establish chromosome bin locations. Eight progeny from the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732' [##REF##12582667##8##] and a set of six homozygous lines each containing a different chromosome 7D segment derived from <italic>Ae. tauschii </italic>in a 'Chinese Spring' background [##REF##16341683##23##] were used for RT-PCR. Quantitative examination of <italic>F3H </italic>expression was measured in 'Chinese Spring' and 'Mironovskaya 808' and the single chromosome substitution lines 'Chinese Spring' ('Hope' 7A) and 'Chinese Spring' ('Hope' 7B). DNA was extracted from seven day old seedlings following the procedure described earlier [##UREF##16##36##]. RNA was extracted from seedlings grown at 20°C under a 12 h day/12 h night regime using the QIAGEN <ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www1.qiagen.com/\\\"/> Plant Rneasy Kit, followed by DNAse treatment. For RT-PCR, RNA was extracted on the fourth day after germination. For quantitative RT-PCR, RNA was extracted every 24 h from two to six day old seedlings.</p>\",\n \"<title>PCR-based cloning and sequence analysis</title>\",\n \"<p>The barley <italic>F3H </italic>cDNA sequence [##UREF##7##13##] was aligned with matching wheat ESTs lodged in <ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www.ncbi.nlm.nih.gov/Database/\\\"/>, employing Multalin v5.4.1 (using absolute alignment score with gap value of 12 and gap length value of 2) [##REF##2849754##37##]. Sets of primers flanking various <italic>F3H </italic>gene segments were designed using OLIGO software (Table ##TAB##5##6##) [##REF##2587212##38##], with one primer pair as described earlier [##REF##16094442##11##]. PCR reaction mixtures (50 μl) contained 50 ng template, 67 mM Tris HCl pH8.8, 1.8 mM MgCl<sub>2</sub>, 0.01% Tween 20, 18 mM (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>, 0.2 mM dNTP, 0.25 mM each primer and 1 U Taq DNA polymerase. PCR amplifications began with a 94°C/5 min incubation, followed by 45 cycles of 94°C/1 min, 60°C/2 min, 72°C/2 min, and a final extension of 72°C/10 min. PCR fragments were recovered from 1% agarose gels, purified using a QIAGEN MinElute Gel Extraction Kit, and cloned with a QIAGEN PCR Cloning Kit. Between five and ten clones per each primer combination per diploid genome were sequenced in both directions to eliminate PCR and sequencing errors or PCR-generated chimeras. Sequencing was effected using an ABI PRISM Dye Terminator Cycle Sequencing ready reaction kit (\\\"Perkin Elmer\\\") with pUC/M13 forward and reverse primers. Full-(or partial) length sequences of various <italic>F3H </italic>gene copies were constructed from overlapping sequences. Cluster analysis was performed on MEGA v3.1 software [##REF##15260895##39##] using the UPGMA (unweighted pair-group method with arithmetic average) algorithm and 500 bootstrap trials.</p>\",\n \"<title>Chromosomal assignment and physical mapping of F3H</title>\",\n \"<p>Specific primer pairs were designed to amplify each wheat <italic>F3H </italic>copy (Table ##TAB##5##6##). To obtain a unique amplification product, the 3' end of at least one of the two primers matched the copy-specific sequence. A touchdown PCR protocol was used to amplify from templates of the 'Chinese Spring' nulli-tetrasomic and deletion lines and the <italic>T. aestivum </italic>× <italic>T. timopheevii </italic>introgression line 842 in 20 μl reactions by applying a denaturing step of 94°C/2 min, 13 cycles of 94°C/15 s, 65°C/30 s (decreasing by 0.7°C/cycle), 72°C/45 s, 24 cycles of 94°C/15 s, 56/30 s, 72°C/45 s; and a final extension of 72°C/5 min. The specificity of the amplifications was confirmed by cloning and sequencing of the PCR product from 'Chinese Spring'. The microsatellite analysis of the 'Chinese Spring' deletion lines was performed using procedures described earlier [##REF##9691054##40##]. The microsatellite genotypic data of the <italic>T. aestivum </italic>× <italic>T. timopheevii </italic>introgression line 842 have been published [##UREF##8##22##].</p>\",\n \"<title>RT-PCR and qRT-PCR</title>\",\n \"<p>Single-stranded cDNA was synthesized from 1 mg total RNA using a (dT)<sub>15 </sub>primer and the QIAGEN Omniscript Reverse Transcription kit in a 20 μl reaction mixture. RT-PCR was performed with <italic>F3H </italic>primers published earlier [##REF##16094442##11##] or with <italic>F3H </italic>gene copy-specific primers (Table ##TAB##5##6##). The standardization of cDNA template was performed using ubiquitin (UBC) primers [##REF##16094442##11##]. PCR products were separated by 2% agarose gel electrophoresis. <italic>F3H </italic>gene copy-specific primers were also applied for qRT-PCR, which used a QIAGEN QuantiTect SYBR Green kit. UBC and GAPDH primers were used to standardize the cDNA template. The amplifications were performed in an Applied Biosystems 7900 HT fast real time PCR system. Pre-determined amounts of cloned cDNA were used to generate standard curves. Each sample was run in three replicates. The specificity of the qRT-PCR products was confirmed by 2% agarose gel electrophoresis. Statistical significance of differences in <italic>F3H </italic>expression level either between <italic>F3H </italic>homoeologues or between different genotypes was assessed by Student's t-test for matched pairs. When <italic>F3H </italic>homoeologues were compared, T-values were calculated for each pair (<italic>F3H-A1 vs F3H-B1</italic>, etc.) in each genotype (Table ##TAB##2##3##), and 'matched pairs' were represented by expression level values obtained for respective pair of <italic>F3H </italic>homoeologues at the same day in the same genotype. When comparison was made between genotypes, T-values were calculated for each pair of genotypes ('Chinese Spring' ('Hope' 7A) <italic>vs </italic>'Chinese Spring' ('Hope' 7B), etc.; Table ##TAB##3##4##), and 'matched pairs' were represented by expression level values obtained in respective pair of genotypes at the same day for the same <italic>F3H </italic>gene copy.</p>\",\n \"<title>Accession numbers for sequence data</title>\",\n \"<p>GenBank: <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EF463100\\\">EF463100</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402957\\\">EU402957</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402958\\\">EU402958</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"DQ233636\\\">DQ233636</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402959\\\">EU402959</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402960\\\">EU402960</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402961\\\">EU402961</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402963\\\">EU402963</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"DQ233637\\\">DQ233637</ext-link>.</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<title>Sequence analysis of <italic>F3H </italic>genes in wheat and its relatives</title>","<p>Nine <italic>F3H </italic>copies were isolated by PCR cloning from bread wheat (genome AABBDD), the tetraploid wild wheat <italic>T. timopheevii </italic>(AAGG) and the presumed diploid progenitors of the A, B/G and D genomes (A: <italic>T. urartu</italic>, B/G:<italic>Ae. speltoides</italic>, D: <italic>Ae. tauschii</italic>) (Table ##TAB##0##1##). Four of the copies were isolated from bread wheat. The length of the coding sequence, which was split into three exons, was 1137 bp, and the first intron varied in length among the homoeologues by some hundreds of base pairs (Figure ##FIG##0##1##). The sequence of the segments of the first intron of the bread wheat copies <italic>F3H1</italic>, <italic>F3H2 </italic>and <italic>F3H3 </italic>not affected by deletions/insertions shared over 80% homology, but the first intron of <italic>F3H4 </italic>was quite distinct. Sequence alignment of <italic>T. aestivum F3H </italic>sequences (coding regions) with barley <italic>F3H </italic>[##UREF##7##13##] is shown in Figure ##FIG##1##2a##. Sequence comparisons between exon 2 of the <italic>Triticum </italic>and <italic>Aegilops F3H </italic>genes (as well as other <italic>F3H </italic>sequences lodged in GenBank) are illustrated as dendrogram in Figure ##FIG##1##2b##. The <italic>F3H4 </italic>sequence departs significantly from that of the other <italic>Triticum </italic>and <italic>Aegilops </italic>copies (Figure ##FIG##1##2##). <italic>T. aestivum F3H1 </italic>and <italic>T. timopheevii F3H1</italic><sup><italic>t </italic></sup>sequences are probably derived from the A genome, whereas <italic>F3H2 </italic>and <italic>F3H2</italic><sup><italic>t </italic></sup>are suggested to belong to the genomes D and G, respectively (Figure ##FIG##1##2b##). <italic>F3H3 </italic>occupies an intermediate position between the two main <italic>Triticum</italic>-<italic>Aegilops </italic>clusters (Figure ##FIG##1##2b##). Patterns of sequence divergence across the structural region of wheat <italic>F3H1 </italic>and <italic>F3H2 </italic>suggest that the second exon is the most variable at the nucleotide level, but is most well conserved at the amino acid level (Figure ##FIG##2##3##, Table ##TAB##1##2##). Exon 2, intron 2 and the beginning of exon 3 (Segment 3, see Figure ##FIG##0##1##) were re-sequenced from a panel of seven diverse bread wheat genotypes, but no intraspecific variation was detected.</p>","<title>Chromosomal assignment and physical mapping of <italic>F3H </italic>genes in hexaploid wheat</title>","<p>Primer pairs amplifying specifically fragments from individual <italic>F3H </italic>copies (referred further as \"gene copy-specific primer pairs\") were designed and used in PCR analysis of 'Chinese Spring' nulli-tetrasomic lines. It was shown that <italic>F3H1 </italic>and <italic>2 </italic>are on, respectively, chromosomes 2A and 2D, while <italic>3 </italic>and <italic>4 </italic>both map to chromosome 2B (Table ##TAB##0##1##, Figure ##FIG##3##4##). A deletion line analysis was then used to define the intra-chromosomal location of <italic>F3H1 </italic>to the sub-terminal bin (2AL3) of chromosome 2AL, both <italic>F3H3 </italic>and <italic>F3H4 </italic>to the terminal bin (2BL6) of chromosome 2BL, and <italic>F3H2 </italic>to the terminal bin (2DL6) of chromosome 2DL (Figure ##FIG##4##5##). Since the location of <italic>F3H3 </italic>and <italic>F3H4 </italic>could not be distinguished by this method, an introgression line derived from the cross <italic>T. aestivum </italic>× <italic>T. timopheevii</italic>, which contains a 2BL/2GL breakpoint within chromosome bin 2BL6 between the microsatellite loci <italic>Xgwm1067 </italic>and <italic>Xgwm0526 </italic>[##UREF##8##22##], was used to show that <italic>F3H3 </italic>and <italic>-4 </italic>are discrete loci (Figure ##FIG##5##6a## and ##FIG##5##6b##, respectively). <italic>F3H3 </italic>lies proximal to the to the 2BL/2GL breakpoint, whereas <italic>F3H4 </italic>location is distal. A specific PCR assay for the <italic>T. timopheevii F3H2</italic><sup><italic>t </italic></sup>sequence (Figure ##FIG##5##6c##) proved that it, like <italic>T. aestivum F3H3</italic>, too lies proximal to the 2BL/2GL breakpoint, thus suggesting that these two loci, along with <italic>F3H1 </italic>and <italic>F3H2</italic>, belong to an <italic>F3H </italic>homoeoallelic series, whereas <italic>F3H4 </italic>appears to be a non-homoelogous duplication. Accordingly, the genes were re-designated <italic>F3H-A1 </italic>(<italic>F3H1</italic>), <italic>F3H-B1 </italic>(<italic>F3H3</italic>), <italic>F3H-D1 </italic>(<italic>F3H2</italic>), <italic>F3H-G1 </italic>(<italic>F3H2</italic><sup><italic>t</italic></sup>) and <italic>F3H-B2 </italic>(<italic>F3H4</italic>).</p>","<title>Expression analysis of <italic>F3H </italic>in lines with and without pigmented coleoptiles</title>","<p>To explore the role of the <italic>Rc-1 </italic>(red coleoptile) genes as regulators for F3H expression, eight progeny from the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732', along with a set of six different chromosome 7D introgression lines of <italic>Ae. tauschii </italic>into 'Chinese Spring', varying with respect to the dominant allele at either <italic>Rc-B1 </italic>or <italic>Rc-D1</italic>, were subjected to RT-PCR analysis from cDNA derived from four day old seedlings. The parental genotypes with pigmented coleoptiles ('Chinese Spring' ('Hope' 7B) and 'Chinese Spring (<italic>Ae. tauschii </italic>7D) both showed a high level of F3H expression, whereas those with non-pigmented coleoptiles showed either little ('TRI 2732') or none ('Chinese Spring') (Figure ##FIG##6##7##). When this result was compared with the microsatellite-based genotype of the lines [##REF##12582667##8##,##REF##16341683##23##], the regulator of F3H expression on chromosome 7B was mapped between <italic>Xgwm0263 </italic>and <italic>Xgwm0573</italic>, co-segregating with <italic>Rc-B1 </italic>(Figure ##FIG##6##7a##); similarly, the equivalent locus on chromosome 7D co-segregated with <italic>Rc-D1 </italic>within the genetic interval <italic>Xgwm0044 </italic>and <italic>Xgwm0111 </italic>(Figure ##FIG##6##7b##). RT-PCR was also used to study contribution of single genes <italic>F3H-A1</italic>, <italic>F3H-B1</italic>, <italic>F3H-B2 </italic>and <italic>F3H-D1 </italic>to total F3H expression. It was shown that <italic>F3H-B2 </italic>is not expressed whether or not the coleoptiles are pigmented (Figure ##FIG##7##8##). In contrast, <italic>F3H-A1</italic>, <italic>F3H-B1 </italic>and <italic>F3H-D1 </italic>were actively expressed in lines with pigmented coleoptiles ('Chinese Spring' ('Hope' 7B) and respective recombinant lines; Figure ##FIG##7##8##, lines 1, 3, 4, 9, 10), whereas those with non-pigmented coleoptiles ('TRI 2732' and respective recombinant lines) showed a low level of expression of only <italic>F3H-A1 </italic>and <italic>F3H-B1 </italic>(Figure ##FIG##7##8##: faint bands in lines 2, 5–8, respectively).</p>","<title>Temporal pattern and the genome specificity of <italic>F3H </italic>expression</title>","<p>To investigate the possibility of more subtle differences between expression levels of the <italic>F3H </italic>homoeologues in presence of particular alleles of <italic>Rc-1</italic>, quantitative RT-PCR was applied to a set of cDNAs sampled from two to six day old seedlings (Figure ##FIG##8##9##). The test genotypes were 'Chinese Spring' ('Hope' 7A) [<italic>Rc-A1b</italic>], 'Chinese Spring' ('Hope' 7B) [<italic>Rc-B1b</italic>] and cv. 'Mironovskaya 808' [<italic>Rc-D1b</italic>], along with the control 'Chinese Spring' which carries the non-pigmented alleles at all three <italic>Rc-1 </italic>loci. In the latter, none of the <italic>F3H </italic>copies was expressed at any time during the sampling period. <italic>F3H-B2 </italic>was not expressed in any of three test line seedlings, but <italic>F3H-A1</italic>, <italic>F3H-B1 </italic>and <italic>F3H-D1 </italic>were all expressed in these lines. No within genotype significant difference (p = 0.05) in the expression level of the three homoeologues could be detected at any of the sampling times (Table ##TAB##2##3##). However, the overall level of F3H expression differed very significantly between each pair of lines (Table ##TAB##3##4##). The level was lowest in 'Mironovskaya 808' and highest in 'Chinese Spring' ('Hope' 7A). The highest expression level in 'Mironovskaya 808' was reached three days after germination, while in 'Chinese Spring' ('Hope' 7A) and 'Chinese Spring' ('Hope' 7B), the maximum was detected on the fourth day. In 'Chinese Spring' ('Hope' 7B), expression started later and declined more rapidly than in 'Chinese Spring' ('Hope' 7A). The delayed start and lower total level of expression in 'Chinese Spring' ('Hope' 7B) was consistent with the observed temporal development of pigmentation in the coleoptiles. Overall, therefore, each <italic>Rc-1 </italic>gene appeared to regulate the expression of the three <italic>F3H </italic>homoeologues equally, but the level of <italic>F3H </italic>expression was dependent on the identity of the dominant <italic>Rc-1 </italic>allele present.</p>"],"string":"[\n \"<title>Results</title>\",\n \"<title>Sequence analysis of <italic>F3H </italic>genes in wheat and its relatives</title>\",\n \"<p>Nine <italic>F3H </italic>copies were isolated by PCR cloning from bread wheat (genome AABBDD), the tetraploid wild wheat <italic>T. timopheevii </italic>(AAGG) and the presumed diploid progenitors of the A, B/G and D genomes (A: <italic>T. urartu</italic>, B/G:<italic>Ae. speltoides</italic>, D: <italic>Ae. tauschii</italic>) (Table ##TAB##0##1##). Four of the copies were isolated from bread wheat. The length of the coding sequence, which was split into three exons, was 1137 bp, and the first intron varied in length among the homoeologues by some hundreds of base pairs (Figure ##FIG##0##1##). The sequence of the segments of the first intron of the bread wheat copies <italic>F3H1</italic>, <italic>F3H2 </italic>and <italic>F3H3 </italic>not affected by deletions/insertions shared over 80% homology, but the first intron of <italic>F3H4 </italic>was quite distinct. Sequence alignment of <italic>T. aestivum F3H </italic>sequences (coding regions) with barley <italic>F3H </italic>[##UREF##7##13##] is shown in Figure ##FIG##1##2a##. Sequence comparisons between exon 2 of the <italic>Triticum </italic>and <italic>Aegilops F3H </italic>genes (as well as other <italic>F3H </italic>sequences lodged in GenBank) are illustrated as dendrogram in Figure ##FIG##1##2b##. The <italic>F3H4 </italic>sequence departs significantly from that of the other <italic>Triticum </italic>and <italic>Aegilops </italic>copies (Figure ##FIG##1##2##). <italic>T. aestivum F3H1 </italic>and <italic>T. timopheevii F3H1</italic><sup><italic>t </italic></sup>sequences are probably derived from the A genome, whereas <italic>F3H2 </italic>and <italic>F3H2</italic><sup><italic>t </italic></sup>are suggested to belong to the genomes D and G, respectively (Figure ##FIG##1##2b##). <italic>F3H3 </italic>occupies an intermediate position between the two main <italic>Triticum</italic>-<italic>Aegilops </italic>clusters (Figure ##FIG##1##2b##). Patterns of sequence divergence across the structural region of wheat <italic>F3H1 </italic>and <italic>F3H2 </italic>suggest that the second exon is the most variable at the nucleotide level, but is most well conserved at the amino acid level (Figure ##FIG##2##3##, Table ##TAB##1##2##). Exon 2, intron 2 and the beginning of exon 3 (Segment 3, see Figure ##FIG##0##1##) were re-sequenced from a panel of seven diverse bread wheat genotypes, but no intraspecific variation was detected.</p>\",\n \"<title>Chromosomal assignment and physical mapping of <italic>F3H </italic>genes in hexaploid wheat</title>\",\n \"<p>Primer pairs amplifying specifically fragments from individual <italic>F3H </italic>copies (referred further as \\\"gene copy-specific primer pairs\\\") were designed and used in PCR analysis of 'Chinese Spring' nulli-tetrasomic lines. It was shown that <italic>F3H1 </italic>and <italic>2 </italic>are on, respectively, chromosomes 2A and 2D, while <italic>3 </italic>and <italic>4 </italic>both map to chromosome 2B (Table ##TAB##0##1##, Figure ##FIG##3##4##). A deletion line analysis was then used to define the intra-chromosomal location of <italic>F3H1 </italic>to the sub-terminal bin (2AL3) of chromosome 2AL, both <italic>F3H3 </italic>and <italic>F3H4 </italic>to the terminal bin (2BL6) of chromosome 2BL, and <italic>F3H2 </italic>to the terminal bin (2DL6) of chromosome 2DL (Figure ##FIG##4##5##). Since the location of <italic>F3H3 </italic>and <italic>F3H4 </italic>could not be distinguished by this method, an introgression line derived from the cross <italic>T. aestivum </italic>× <italic>T. timopheevii</italic>, which contains a 2BL/2GL breakpoint within chromosome bin 2BL6 between the microsatellite loci <italic>Xgwm1067 </italic>and <italic>Xgwm0526 </italic>[##UREF##8##22##], was used to show that <italic>F3H3 </italic>and <italic>-4 </italic>are discrete loci (Figure ##FIG##5##6a## and ##FIG##5##6b##, respectively). <italic>F3H3 </italic>lies proximal to the to the 2BL/2GL breakpoint, whereas <italic>F3H4 </italic>location is distal. A specific PCR assay for the <italic>T. timopheevii F3H2</italic><sup><italic>t </italic></sup>sequence (Figure ##FIG##5##6c##) proved that it, like <italic>T. aestivum F3H3</italic>, too lies proximal to the 2BL/2GL breakpoint, thus suggesting that these two loci, along with <italic>F3H1 </italic>and <italic>F3H2</italic>, belong to an <italic>F3H </italic>homoeoallelic series, whereas <italic>F3H4 </italic>appears to be a non-homoelogous duplication. Accordingly, the genes were re-designated <italic>F3H-A1 </italic>(<italic>F3H1</italic>), <italic>F3H-B1 </italic>(<italic>F3H3</italic>), <italic>F3H-D1 </italic>(<italic>F3H2</italic>), <italic>F3H-G1 </italic>(<italic>F3H2</italic><sup><italic>t</italic></sup>) and <italic>F3H-B2 </italic>(<italic>F3H4</italic>).</p>\",\n \"<title>Expression analysis of <italic>F3H </italic>in lines with and without pigmented coleoptiles</title>\",\n \"<p>To explore the role of the <italic>Rc-1 </italic>(red coleoptile) genes as regulators for F3H expression, eight progeny from the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732', along with a set of six different chromosome 7D introgression lines of <italic>Ae. tauschii </italic>into 'Chinese Spring', varying with respect to the dominant allele at either <italic>Rc-B1 </italic>or <italic>Rc-D1</italic>, were subjected to RT-PCR analysis from cDNA derived from four day old seedlings. The parental genotypes with pigmented coleoptiles ('Chinese Spring' ('Hope' 7B) and 'Chinese Spring (<italic>Ae. tauschii </italic>7D) both showed a high level of F3H expression, whereas those with non-pigmented coleoptiles showed either little ('TRI 2732') or none ('Chinese Spring') (Figure ##FIG##6##7##). When this result was compared with the microsatellite-based genotype of the lines [##REF##12582667##8##,##REF##16341683##23##], the regulator of F3H expression on chromosome 7B was mapped between <italic>Xgwm0263 </italic>and <italic>Xgwm0573</italic>, co-segregating with <italic>Rc-B1 </italic>(Figure ##FIG##6##7a##); similarly, the equivalent locus on chromosome 7D co-segregated with <italic>Rc-D1 </italic>within the genetic interval <italic>Xgwm0044 </italic>and <italic>Xgwm0111 </italic>(Figure ##FIG##6##7b##). RT-PCR was also used to study contribution of single genes <italic>F3H-A1</italic>, <italic>F3H-B1</italic>, <italic>F3H-B2 </italic>and <italic>F3H-D1 </italic>to total F3H expression. It was shown that <italic>F3H-B2 </italic>is not expressed whether or not the coleoptiles are pigmented (Figure ##FIG##7##8##). In contrast, <italic>F3H-A1</italic>, <italic>F3H-B1 </italic>and <italic>F3H-D1 </italic>were actively expressed in lines with pigmented coleoptiles ('Chinese Spring' ('Hope' 7B) and respective recombinant lines; Figure ##FIG##7##8##, lines 1, 3, 4, 9, 10), whereas those with non-pigmented coleoptiles ('TRI 2732' and respective recombinant lines) showed a low level of expression of only <italic>F3H-A1 </italic>and <italic>F3H-B1 </italic>(Figure ##FIG##7##8##: faint bands in lines 2, 5–8, respectively).</p>\",\n \"<title>Temporal pattern and the genome specificity of <italic>F3H </italic>expression</title>\",\n \"<p>To investigate the possibility of more subtle differences between expression levels of the <italic>F3H </italic>homoeologues in presence of particular alleles of <italic>Rc-1</italic>, quantitative RT-PCR was applied to a set of cDNAs sampled from two to six day old seedlings (Figure ##FIG##8##9##). The test genotypes were 'Chinese Spring' ('Hope' 7A) [<italic>Rc-A1b</italic>], 'Chinese Spring' ('Hope' 7B) [<italic>Rc-B1b</italic>] and cv. 'Mironovskaya 808' [<italic>Rc-D1b</italic>], along with the control 'Chinese Spring' which carries the non-pigmented alleles at all three <italic>Rc-1 </italic>loci. In the latter, none of the <italic>F3H </italic>copies was expressed at any time during the sampling period. <italic>F3H-B2 </italic>was not expressed in any of three test line seedlings, but <italic>F3H-A1</italic>, <italic>F3H-B1 </italic>and <italic>F3H-D1 </italic>were all expressed in these lines. No within genotype significant difference (p = 0.05) in the expression level of the three homoeologues could be detected at any of the sampling times (Table ##TAB##2##3##). However, the overall level of F3H expression differed very significantly between each pair of lines (Table ##TAB##3##4##). The level was lowest in 'Mironovskaya 808' and highest in 'Chinese Spring' ('Hope' 7A). The highest expression level in 'Mironovskaya 808' was reached three days after germination, while in 'Chinese Spring' ('Hope' 7A) and 'Chinese Spring' ('Hope' 7B), the maximum was detected on the fourth day. In 'Chinese Spring' ('Hope' 7B), expression started later and declined more rapidly than in 'Chinese Spring' ('Hope' 7A). The delayed start and lower total level of expression in 'Chinese Spring' ('Hope' 7B) was consistent with the observed temporal development of pigmentation in the coleoptiles. Overall, therefore, each <italic>Rc-1 </italic>gene appeared to regulate the expression of the three <italic>F3H </italic>homoeologues equally, but the level of <italic>F3H </italic>expression was dependent on the identity of the dominant <italic>Rc-1 </italic>allele present.</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<title>Cloning and analysis of <italic>F3H </italic>sequences</title>","<p><italic>F3H </italic>genes have been isolated from barley, maize and <italic>Arabidopsis thaliana </italic>[##UREF##7##13##,##REF##7773305##14##,##REF##8685272##24##] as well as from a range of other plant species <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.ncbi.nlm.nih.gov/Database/\"/>. In wheat, only one single partial <italic>F3H </italic>sequence has been published to date [##REF##16094442##11##]. The relationship between the wheat and <italic>Aegilops </italic>sp. <italic>F3H </italic>sequences reported here (with the exception of <italic>F3H-B2</italic>) and those lodged in GenBank (Figure ##FIG##1##2##) is consistent with standard taxonomic treatment [##UREF##9##25##] and with known phylogenies within the <italic>Triticum</italic>/<italic>Aegilops </italic>complex [##UREF##10##26##]. The <italic>F3H </italic>sequences of diploid progenitors of wheat were useful for the genome assignment of the homoeologous gene copies in polyploid wheat. The substantial structural divergence between <italic>F3H-B2 </italic>and that of three <italic>F3H-1 </italic>homoeologues is accompanied by a functional difference. The lack of <italic>F3H-B2 </italic>expression in pigmented coleoptiles does not reflect its complete non-functionality, since a highly identical root EST has been reported (Table ##TAB##0##1##, Figure ##FIG##9##10##). The presence of two B genome copies of <italic>F3H </italic>is not a particularly unusual result, as <italic>F3H </italic>copy number in diploids varies from one [##UREF##7##13##,##REF##7773305##14##,##REF##8685272##24##] to two [##REF##8193299##27##,##UREF##11##28##]. Silent divergence (Ka/Ks) appears to be homogeneously distributed throughout the coding region of <italic>Arabidopsis thaliana F3H</italic>, being rarest in the second, and most frequent in the third exon [##REF##11141187##29##]. A similar pattern applies to the wheat A and D genome <italic>F3H </italic>homoeologues (Figure ##FIG##2##3##, Table ##TAB##1##2##).</p>","<p>A PCR-based cloning approach has been used to clone other flavonoid biosynthesis pathway genes in hexaploid wheat (Table ##TAB##4##5##), whereas in barley and other diploid species they have been isolated from cDNA libraries [##UREF##7##13##,##REF##7858218##30##]. It has recently become clear that not all members of a homoeologous series in wheat are co-expressed [##REF##16899084##16##,##REF##16306141##18##,##REF##11973318##31##], so the genomic PCR-based cloning approach is probably the more preferable strategy to capture a full set of homoeologues. Although PCR-based cloning has some disadvantages when applied in an allopolyploid (specifically in the generation of PCR chimeras – however, this problem can usually be overcome by the cloning and sequencing of several replicates), it is an effective strategy for the design of gene copy-specific primers, the chromosomal localization of genes and expression analysis.</p>","<title>Expression of the three homoeologous <italic>F3H </italic>loci in lines with and without pigmented coleoptiles</title>","<p>The patterns of expression of flavanone 3-hydroxylase in lines with and without pigmented coleoptiles indicated that <italic>Rc-B1 </italic>and <italic>Rc-D1 </italic>are coincident with the genes regulating its expression (Figure ##FIG##6##7##). This is in accordance with the suggestion that <italic>Rc-1 </italic>genes exert a regulatory role for <italic>F3H </italic>genes, which could be made on the base of combined results obtained earlier [##UREF##3##5##, ####REF##3428265##6##, ##UREF##4##7##, ##REF##12582667##8##, ##UREF##5##9####5##9##,##REF##15821875##12##]. The patterns of temporal expression among the <italic>F3H </italic>homoeologues in the presence of different dominant <italic>Rc-1 </italic>alleles allowed for an examination as to whether, in an allopolyploid context, there are any genome-specific relationships between the structural and regulatory genes. No such relationship was apparent, since in pigmented coleoptiles, <italic>F3H-A1</italic>, <italic>F3H-B1 </italic>and <italic>F3H-D1 </italic>were all expressed at a similar level (Figure ##FIG##8##9##). Many sets of wheat homoeologous genes are known to be equally expressed in this way [##REF##16899084##16##,##REF##15952073##19##,##REF##17586655##21##], but in others, the expression of one or more members may be either completely [##REF##16899084##16##,##REF##16306141##18##,##REF##11973318##31##] or partially [##REF##16160850##15##,##REF##16260753##20##,##REF##17586655##21##] suppressed. Generally, when <italic>F3H </italic>homoeologues are expressed actively (as in pigmented coleoptiles), then they are expressed equally, but where overall <italic>F3H </italic>transcription level is low, then selective expression of <italic>F3H </italic>homoeologues could be observed (i.e. <italic>F3H-A1 </italic>and <italic>F3H-B1 </italic>were expressed in the green coleoptiles of 'TRI 2732', but <italic>F3H-D1 </italic>was not; Figure ##FIG##7##8##). These outcomes are consistent with the activity-selectivity principle [##UREF##12##32##] acting at the transcriptional level.</p>","<title>Functional difference between homoeologous <italic>Rc-1 </italic>genes</title>","<p>Whereas each dominant <italic>Rc-1 </italic>allele affects the expression of each of the three <italic>F3H </italic>homoeologues equally, overall F3H expression was dependent on the identity of which dominant <italic>Rc-1 </italic>allele was present (Figure ##FIG##8##9##). This difference was observed not only at specific time points, but also from the total amounts of <italic>F3H </italic>mRNA produced over the period of coleoptile pigmentation. The delayed start of expression and the lesser level of transcript present in 'Chinese Spring' ('Hope' 7B) compared to 'Chinese Spring' ('Hope' 7A) was consistent with the observed accumulation of pigmentation in the coleoptile, both in the present experiments and in those reported earlier [##UREF##13##33##]. In order to test for background effects on <italic>F3H </italic>expression or variability within transcriptional factors encoded by dominant <italic>Rc-1 </italic>alleles in other genotypes, it would be of interest to investigate the extent to which the profiles of <italic>F3H </italic>expression of 'Chinese Spring' ('Hope' 7A), 'Chinese Spring' ('Hope' 7B) and 'Mironovskaya 808' are typical, i.e. for instance to compare profile of 'Mironovskaya 808' to those of some other varieties carrying the same dominant allele (<italic>Rc-D1</italic>).</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<title>Cloning and analysis of <italic>F3H </italic>sequences</title>\",\n \"<p><italic>F3H </italic>genes have been isolated from barley, maize and <italic>Arabidopsis thaliana </italic>[##UREF##7##13##,##REF##7773305##14##,##REF##8685272##24##] as well as from a range of other plant species <ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www.ncbi.nlm.nih.gov/Database/\\\"/>. In wheat, only one single partial <italic>F3H </italic>sequence has been published to date [##REF##16094442##11##]. The relationship between the wheat and <italic>Aegilops </italic>sp. <italic>F3H </italic>sequences reported here (with the exception of <italic>F3H-B2</italic>) and those lodged in GenBank (Figure ##FIG##1##2##) is consistent with standard taxonomic treatment [##UREF##9##25##] and with known phylogenies within the <italic>Triticum</italic>/<italic>Aegilops </italic>complex [##UREF##10##26##]. The <italic>F3H </italic>sequences of diploid progenitors of wheat were useful for the genome assignment of the homoeologous gene copies in polyploid wheat. The substantial structural divergence between <italic>F3H-B2 </italic>and that of three <italic>F3H-1 </italic>homoeologues is accompanied by a functional difference. The lack of <italic>F3H-B2 </italic>expression in pigmented coleoptiles does not reflect its complete non-functionality, since a highly identical root EST has been reported (Table ##TAB##0##1##, Figure ##FIG##9##10##). The presence of two B genome copies of <italic>F3H </italic>is not a particularly unusual result, as <italic>F3H </italic>copy number in diploids varies from one [##UREF##7##13##,##REF##7773305##14##,##REF##8685272##24##] to two [##REF##8193299##27##,##UREF##11##28##]. Silent divergence (Ka/Ks) appears to be homogeneously distributed throughout the coding region of <italic>Arabidopsis thaliana F3H</italic>, being rarest in the second, and most frequent in the third exon [##REF##11141187##29##]. A similar pattern applies to the wheat A and D genome <italic>F3H </italic>homoeologues (Figure ##FIG##2##3##, Table ##TAB##1##2##).</p>\",\n \"<p>A PCR-based cloning approach has been used to clone other flavonoid biosynthesis pathway genes in hexaploid wheat (Table ##TAB##4##5##), whereas in barley and other diploid species they have been isolated from cDNA libraries [##UREF##7##13##,##REF##7858218##30##]. It has recently become clear that not all members of a homoeologous series in wheat are co-expressed [##REF##16899084##16##,##REF##16306141##18##,##REF##11973318##31##], so the genomic PCR-based cloning approach is probably the more preferable strategy to capture a full set of homoeologues. Although PCR-based cloning has some disadvantages when applied in an allopolyploid (specifically in the generation of PCR chimeras – however, this problem can usually be overcome by the cloning and sequencing of several replicates), it is an effective strategy for the design of gene copy-specific primers, the chromosomal localization of genes and expression analysis.</p>\",\n \"<title>Expression of the three homoeologous <italic>F3H </italic>loci in lines with and without pigmented coleoptiles</title>\",\n \"<p>The patterns of expression of flavanone 3-hydroxylase in lines with and without pigmented coleoptiles indicated that <italic>Rc-B1 </italic>and <italic>Rc-D1 </italic>are coincident with the genes regulating its expression (Figure ##FIG##6##7##). This is in accordance with the suggestion that <italic>Rc-1 </italic>genes exert a regulatory role for <italic>F3H </italic>genes, which could be made on the base of combined results obtained earlier [##UREF##3##5##, ####REF##3428265##6##, ##UREF##4##7##, ##REF##12582667##8##, ##UREF##5##9####5##9##,##REF##15821875##12##]. The patterns of temporal expression among the <italic>F3H </italic>homoeologues in the presence of different dominant <italic>Rc-1 </italic>alleles allowed for an examination as to whether, in an allopolyploid context, there are any genome-specific relationships between the structural and regulatory genes. No such relationship was apparent, since in pigmented coleoptiles, <italic>F3H-A1</italic>, <italic>F3H-B1 </italic>and <italic>F3H-D1 </italic>were all expressed at a similar level (Figure ##FIG##8##9##). Many sets of wheat homoeologous genes are known to be equally expressed in this way [##REF##16899084##16##,##REF##15952073##19##,##REF##17586655##21##], but in others, the expression of one or more members may be either completely [##REF##16899084##16##,##REF##16306141##18##,##REF##11973318##31##] or partially [##REF##16160850##15##,##REF##16260753##20##,##REF##17586655##21##] suppressed. Generally, when <italic>F3H </italic>homoeologues are expressed actively (as in pigmented coleoptiles), then they are expressed equally, but where overall <italic>F3H </italic>transcription level is low, then selective expression of <italic>F3H </italic>homoeologues could be observed (i.e. <italic>F3H-A1 </italic>and <italic>F3H-B1 </italic>were expressed in the green coleoptiles of 'TRI 2732', but <italic>F3H-D1 </italic>was not; Figure ##FIG##7##8##). These outcomes are consistent with the activity-selectivity principle [##UREF##12##32##] acting at the transcriptional level.</p>\",\n \"<title>Functional difference between homoeologous <italic>Rc-1 </italic>genes</title>\",\n \"<p>Whereas each dominant <italic>Rc-1 </italic>allele affects the expression of each of the three <italic>F3H </italic>homoeologues equally, overall F3H expression was dependent on the identity of which dominant <italic>Rc-1 </italic>allele was present (Figure ##FIG##8##9##). This difference was observed not only at specific time points, but also from the total amounts of <italic>F3H </italic>mRNA produced over the period of coleoptile pigmentation. The delayed start of expression and the lesser level of transcript present in 'Chinese Spring' ('Hope' 7B) compared to 'Chinese Spring' ('Hope' 7A) was consistent with the observed accumulation of pigmentation in the coleoptile, both in the present experiments and in those reported earlier [##UREF##13##33##]. In order to test for background effects on <italic>F3H </italic>expression or variability within transcriptional factors encoded by dominant <italic>Rc-1 </italic>alleles in other genotypes, it would be of interest to investigate the extent to which the profiles of <italic>F3H </italic>expression of 'Chinese Spring' ('Hope' 7A), 'Chinese Spring' ('Hope' 7B) and 'Mironovskaya 808' are typical, i.e. for instance to compare profile of 'Mironovskaya 808' to those of some other varieties carrying the same dominant allele (<italic>Rc-D1</italic>).</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>There are at least four flavanone 3-hydroxylase gene copies in the hexaploid genome of bread wheat, three of which are the homoeologues on chromosomes 2AL, 2BL and 2DL, highly similar at structural and functional level, while the fourth one represents a distinct non-homoeologous copy on chromosome 2BL with suppressed expression in red coleoptiles.</p>","<p>Expression of the F3H homoeologues (<italic>F3H-1</italic>) in wheat coleoptiles is determined by the presence of dominant alleles in <italic>Rc-1 </italic>(red coleoptiles) loci. <italic>Rc-1 </italic>and <italic>F3H-1 </italic>genes represent a suitable model to investigate relationship between homoeologous regulatory and homoeologous structural genes in allopolyploid wheat genome (which have never been studied before). The lack of any genome-specific relationship between <italic>F3H-1 </italic>and <italic>Rc-1 </italic>observed in the present study implies an integrative evolutionary process among the three diploid genomes, following the formation of hexaploid wheat.</p>","<p>Furthermore, based on <italic>F3H </italic>expression analysis it was observed for the first time that activity-selectivity principle [##UREF##12##32##] acts at the transcriptional level.</p>","<p>Our general conclusion is that regulatory genes probably contribute more to the functional divergence between the wheat genomes than do the structural genes themselves. This is in line with the growing consensus which suggests that although heritable morphological traits are determined by the expression of structural genes, it is the regulatory genes which are the prime determinants of allelic identity.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>There are at least four flavanone 3-hydroxylase gene copies in the hexaploid genome of bread wheat, three of which are the homoeologues on chromosomes 2AL, 2BL and 2DL, highly similar at structural and functional level, while the fourth one represents a distinct non-homoeologous copy on chromosome 2BL with suppressed expression in red coleoptiles.</p>\",\n \"<p>Expression of the F3H homoeologues (<italic>F3H-1</italic>) in wheat coleoptiles is determined by the presence of dominant alleles in <italic>Rc-1 </italic>(red coleoptiles) loci. <italic>Rc-1 </italic>and <italic>F3H-1 </italic>genes represent a suitable model to investigate relationship between homoeologous regulatory and homoeologous structural genes in allopolyploid wheat genome (which have never been studied before). The lack of any genome-specific relationship between <italic>F3H-1 </italic>and <italic>Rc-1 </italic>observed in the present study implies an integrative evolutionary process among the three diploid genomes, following the formation of hexaploid wheat.</p>\",\n \"<p>Furthermore, based on <italic>F3H </italic>expression analysis it was observed for the first time that activity-selectivity principle [##UREF##12##32##] acts at the transcriptional level.</p>\",\n \"<p>Our general conclusion is that regulatory genes probably contribute more to the functional divergence between the wheat genomes than do the structural genes themselves. This is in line with the growing consensus which suggests that although heritable morphological traits are determined by the expression of structural genes, it is the regulatory genes which are the prime determinants of allelic identity.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>The patterns of expression of homoeologous genes in hexaploid bread wheat have been intensively studied in recent years, but the interaction between structural genes and their homoeologous regulatory genes remained unclear. The question was as to whether, in an allopolyploid, this interaction is genome-specific, or whether regulation cuts across genomes. The aim of the present study was cloning, sequence analysis, mapping and expression analysis of <italic>F3H </italic>(flavanone 3-hydroxylase – one of the key enzymes in the plant flavonoid biosynthesis pathway) homoeologues in bread wheat and study of the interaction between <italic>F3H </italic>and their regulatory genes homoeologues – <italic>Rc </italic>(red coleoptiles).</p>","<title>Results</title>","<p>PCR-based cloning of <italic>F3H </italic>sequences from hexaploid bread wheat (<italic>Triticum aestivum </italic>L.), a wild tetraploid wheat (<italic>T. timopheevii</italic>) and their putative diploid progenitors was employed to localize, physically map and analyse the expression of four distinct bread wheat <italic>F3H </italic>copies. Three of these form a homoeologous set, mapping to the chromosomes of homoeologous group 2; they are highly similar to one another at the structural and functional levels. However, the fourth copy is less homologous, and was not expressed in anthocyanin pigmented coleoptiles. The presence of dominant alleles at the <italic>Rc-1 </italic>homoeologous loci, which are responsible for anthocyanin pigmentation in the coleoptile, was correlated with <italic>F3H </italic>expression in pigmented coleoptiles. Each dominant <italic>Rc-1 </italic>allele affected the expression of the three <italic>F3H </italic>homoeologues equally, but the level of <italic>F3H </italic>expression was dependent on the identity of the dominant <italic>Rc-1 </italic>allele present. Thus, the homoeologous <italic>Rc-1 </italic>genes contribute more to functional divergence than do the structural <italic>F3H </italic>genes.</p>","<title>Conclusion</title>","<p>The lack of any genome-specific relationship between <italic>F3H-1 </italic>and <italic>Rc-1 </italic>implies an integrative evolutionary process among the three diploid genomes, following the formation of hexaploid wheat. Regulatory genes probably contribute more to the functional divergence between the wheat genomes than do the structural genes themselves. This is in line with the growing consensus which suggests that although heritable morphological traits are determined by the expression of structural genes, it is the regulatory genes which are the prime determinants of allelic identity.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>The patterns of expression of homoeologous genes in hexaploid bread wheat have been intensively studied in recent years, but the interaction between structural genes and their homoeologous regulatory genes remained unclear. The question was as to whether, in an allopolyploid, this interaction is genome-specific, or whether regulation cuts across genomes. The aim of the present study was cloning, sequence analysis, mapping and expression analysis of <italic>F3H </italic>(flavanone 3-hydroxylase – one of the key enzymes in the plant flavonoid biosynthesis pathway) homoeologues in bread wheat and study of the interaction between <italic>F3H </italic>and their regulatory genes homoeologues – <italic>Rc </italic>(red coleoptiles).</p>\",\n \"<title>Results</title>\",\n \"<p>PCR-based cloning of <italic>F3H </italic>sequences from hexaploid bread wheat (<italic>Triticum aestivum </italic>L.), a wild tetraploid wheat (<italic>T. timopheevii</italic>) and their putative diploid progenitors was employed to localize, physically map and analyse the expression of four distinct bread wheat <italic>F3H </italic>copies. Three of these form a homoeologous set, mapping to the chromosomes of homoeologous group 2; they are highly similar to one another at the structural and functional levels. However, the fourth copy is less homologous, and was not expressed in anthocyanin pigmented coleoptiles. The presence of dominant alleles at the <italic>Rc-1 </italic>homoeologous loci, which are responsible for anthocyanin pigmentation in the coleoptile, was correlated with <italic>F3H </italic>expression in pigmented coleoptiles. Each dominant <italic>Rc-1 </italic>allele affected the expression of the three <italic>F3H </italic>homoeologues equally, but the level of <italic>F3H </italic>expression was dependent on the identity of the dominant <italic>Rc-1 </italic>allele present. Thus, the homoeologous <italic>Rc-1 </italic>genes contribute more to functional divergence than do the structural <italic>F3H </italic>genes.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>The lack of any genome-specific relationship between <italic>F3H-1 </italic>and <italic>Rc-1 </italic>implies an integrative evolutionary process among the three diploid genomes, following the formation of hexaploid wheat. Regulatory genes probably contribute more to the functional divergence between the wheat genomes than do the structural genes themselves. This is in line with the growing consensus which suggests that although heritable morphological traits are determined by the expression of structural genes, it is the regulatory genes which are the prime determinants of allelic identity.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Authors' contributions</title>","<p>EKK carried out the molecular genetic studies, sequence alignment, primer design and statistical analysis, she conceived of the study, participated in its design and drafted the manuscript. MSR and EAS coordinated the study, contributed to its conception and design, to interpretation of data and to revising the manuscript critically. All authors read and approved the final manuscript.</p>"],"string":"[\n \"<title>Authors' contributions</title>\",\n \"<p>EKK carried out the molecular genetic studies, sequence alignment, primer design and statistical analysis, she conceived of the study, participated in its design and drafted the manuscript. MSR and EAS coordinated the study, contributed to its conception and design, to interpretation of data and to revising the manuscript critically. All authors read and approved the final manuscript.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>We thank Drs. A. Börner and B.S. Gill for seed of the wheat cultivars and lines, Drs. I. Leonova and E. Pestsova for providing the microsatellite genotyping data for, respectively, <italic>T. aestivum </italic>x. <italic>timopheevii </italic>and <italic>T. aestivum/Ae. tauschii </italic>introgression lines. We also thank Dr. R. Koebner for fruitful discussion and Stefanie Lück for valuable suggestions regarding qRT-PCR. This study was supported by the Russian Foundation for Basic Research (08-04-00368-a), INTAS (04-83-3786), the program \"Biodiversity and Dynamics of Gene Pools\" of the Presidium of the Russian Academy of Sciences, SB RAS (Lavrentjev grant and Integration Project 5.8), the Russian Science Support Foundation, Timofeeff-Ressovsky Scientific Society \"Biosphere and Mankind\", and a grant from the President of the Russian Federation (MK-566.2007.4). We also thank www.smartenglish.co.uk for linguistic advice in the preparation of this manuscript.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>We thank Drs. A. Börner and B.S. Gill for seed of the wheat cultivars and lines, Drs. I. Leonova and E. Pestsova for providing the microsatellite genotyping data for, respectively, <italic>T. aestivum </italic>x. <italic>timopheevii </italic>and <italic>T. aestivum/Ae. tauschii </italic>introgression lines. We also thank Dr. R. Koebner for fruitful discussion and Stefanie Lück for valuable suggestions regarding qRT-PCR. This study was supported by the Russian Foundation for Basic Research (08-04-00368-a), INTAS (04-83-3786), the program \\\"Biodiversity and Dynamics of Gene Pools\\\" of the Presidium of the Russian Academy of Sciences, SB RAS (Lavrentjev grant and Integration Project 5.8), the Russian Science Support Foundation, Timofeeff-Ressovsky Scientific Society \\\"Biosphere and Mankind\\\", and a grant from the President of the Russian Federation (MK-566.2007.4). We also thank www.smartenglish.co.uk for linguistic advice in the preparation of this manuscript.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>The structure of wheat <italic>F3H</italic>.</bold> Different gene segments referred in the paper text and tables are indicated in the figure part <bold>(a)</bold>, length of introns of the different <italic>T. aestivum F3H </italic>gene copies are indicated in part <bold>(b)</bold>; partial sequences are extended with dotted lines, whereas solid lines correspond to sequences cloned and analysed in the present study.</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><italic><bold>F3H </bold></italic><bold>sequences comparison: </bold><bold>(a) </bold>alignment of complete coding sequences of barley <italic>F3H </italic>[##UREF##7##13##] and wheat <italic>F3H1 </italic>and <italic>F3H2 </italic>and partial wheat <italic>F3H3 </italic>and <italic>F3H4 </italic>copies cloned in the present study (introns are not included into alignment); <bold>(b) </bold>similarity of part of <italic>F3H </italic>exon 2 (specified as segment 6 in Figure 1) from various plant species – the species from which <italic>F3H </italic>copies were cloned and analysed in the present study are underlined, others were obtained from GenBank; for species with more than one <italic>F3H </italic>gene, each copy is identified by a number in parentheses.</p></caption></fig>","<fig position=\"float\" id=\"F3\"><label>Figure 3</label><caption><p><bold>Gene divergence between the hexaploid wheat A and D genome <italic>F3H </italic>gene copies: </bold><bold>(a) </bold>percentage of nucleotide substitutions in exons, <bold>(b) </bold>ratio of non-synonymous (Ka) to synonymous (Ks) nucleotide substitutions.</p></caption></fig>","<fig position=\"float\" id=\"F4\"><label>Figure 4</label><caption><p><bold>PCR profiles of the 'Chinese Spring' nulli-tetrasomic lines and the diploid donors of hexaploid wheat, amplified with <italic>F3H </italic>copy-specific primers.</bold> The length of the PCR products is given in base pairs to the right. Designations '1A', '1B' etc. correspond to 'nulli' chromosome in the certain nulli-tetrasomic line; 'Tu' – <italic>T. urartu</italic>, 'Aes' – <italic>Ae. speltoides</italic>, 'Aet' – <italic>Ae. tauschii</italic>.</p></caption></fig>","<fig position=\"float\" id=\"F5\"><label>Figure 5</label><caption><p><bold>Physical mapping of <italic>F3H </italic>loci in bread wheat performed using subset of <italic>T. aestivum </italic>cv. 'Chinese Spring' homoeologous group 2 chromosomes deletion lines.</bold> Microsatellite markers (<italic>Xgwm</italic>) designations are given to the right from each chromosome scheme, chromosome bin names are indicated to the left.</p></caption></fig>","<fig position=\"float\" id=\"F6\"><label>Figure 6</label><caption><p>PCR profiles of 'Saratovskaya 29' (1), <italic>T. timopheevii </italic>(2) and 'Saratovskaya 29'x <italic>T. timopheevii </italic>introgression line 842 (3), amplified with gene copy-specific primers for <italic>T. aestivum F3H3 </italic>(a) and <italic>F3H4 </italic>(b) and <italic>T. timopheevii F3H2</italic><sup><italic>t </italic></sup>(c).</p></caption></fig>","<fig position=\"float\" id=\"F7\"><label>Figure 7</label><caption><p><bold>RT-PCR analysis of total F3H expression in four day old seedlings of <bold>(a) </bold>'Chinese Spring' ('Hope' 7B) (1), 'TRI 2732' (2) and progeny of the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732' (3–10); <bold>(b) </bold>substitution 'Chinese Spring' (<italic>Ae. tauschii </italic>7D) (1), 'Chinese Spring' (2) and the 'Chinese Spring'/<italic>Ae. tauschii </italic>7D introgression lines (3–8).</bold> Anthocyanin pigmentation in coleoptiles of the corresponding lines is shown above, whereas the status of chromosomes 7B <bold>(a) </bold>or 7D <bold>(b) </bold>of each line is indicated in the lower part of the panel.</p></caption></fig>","<fig position=\"float\" id=\"F8\"><label>Figure 8</label><caption><p><italic><bold>F3H </bold></italic><bold>copy-specific RT-PCR analysis from four day old seedlings of 'Chinese Spring' ('Hope' 7B) (1), 'TRI 2732' (2) and progeny of the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732' (3–10).</bold> Anthocyanin pigmentation in coleoptiles of the corresponding lines is shown below. The length of the RT-PCR products is given in base pairs to the right.</p></caption></fig>","<fig position=\"float\" id=\"F9\"><label>Figure 9</label><caption><p>Quantitative RT-PCR analysis with respect to the various copies of <italic>F3H </italic>in 'Chinese Spring' (CS), 'Chinese Spring' ('Hope' 7A), 'Chinese Spring' ('Hope' 7B) and 'Mironovskaya 808' (M808).</p></caption></fig>","<fig position=\"float\" id=\"F10\"><label>Figure 10</label><caption><p><bold>Comparison of <italic>T. aestivum F3H </italic>copies <italic>vs </italic>homologous wheat ESTs.</bold> The highest identity value for each EST is indicated with black arrow.</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p><bold>The structure of wheat <italic>F3H</italic>.</bold> Different gene segments referred in the paper text and tables are indicated in the figure part <bold>(a)</bold>, length of introns of the different <italic>T. aestivum F3H </italic>gene copies are indicated in part <bold>(b)</bold>; partial sequences are extended with dotted lines, whereas solid lines correspond to sequences cloned and analysed in the present study.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p><italic><bold>F3H </bold></italic><bold>sequences comparison: </bold><bold>(a) </bold>alignment of complete coding sequences of barley <italic>F3H </italic>[##UREF##7##13##] and wheat <italic>F3H1 </italic>and <italic>F3H2 </italic>and partial wheat <italic>F3H3 </italic>and <italic>F3H4 </italic>copies cloned in the present study (introns are not included into alignment); <bold>(b) </bold>similarity of part of <italic>F3H </italic>exon 2 (specified as segment 6 in Figure 1) from various plant species – the species from which <italic>F3H </italic>copies were cloned and analysed in the present study are underlined, others were obtained from GenBank; for species with more than one <italic>F3H </italic>gene, each copy is identified by a number in parentheses.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F3\\\"><label>Figure 3</label><caption><p><bold>Gene divergence between the hexaploid wheat A and D genome <italic>F3H </italic>gene copies: </bold><bold>(a) </bold>percentage of nucleotide substitutions in exons, <bold>(b) </bold>ratio of non-synonymous (Ka) to synonymous (Ks) nucleotide substitutions.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F4\\\"><label>Figure 4</label><caption><p><bold>PCR profiles of the 'Chinese Spring' nulli-tetrasomic lines and the diploid donors of hexaploid wheat, amplified with <italic>F3H </italic>copy-specific primers.</bold> The length of the PCR products is given in base pairs to the right. Designations '1A', '1B' etc. correspond to 'nulli' chromosome in the certain nulli-tetrasomic line; 'Tu' – <italic>T. urartu</italic>, 'Aes' – <italic>Ae. speltoides</italic>, 'Aet' – <italic>Ae. tauschii</italic>.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F5\\\"><label>Figure 5</label><caption><p><bold>Physical mapping of <italic>F3H </italic>loci in bread wheat performed using subset of <italic>T. aestivum </italic>cv. 'Chinese Spring' homoeologous group 2 chromosomes deletion lines.</bold> Microsatellite markers (<italic>Xgwm</italic>) designations are given to the right from each chromosome scheme, chromosome bin names are indicated to the left.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F6\\\"><label>Figure 6</label><caption><p>PCR profiles of 'Saratovskaya 29' (1), <italic>T. timopheevii </italic>(2) and 'Saratovskaya 29'x <italic>T. timopheevii </italic>introgression line 842 (3), amplified with gene copy-specific primers for <italic>T. aestivum F3H3 </italic>(a) and <italic>F3H4 </italic>(b) and <italic>T. timopheevii F3H2</italic><sup><italic>t </italic></sup>(c).</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F7\\\"><label>Figure 7</label><caption><p><bold>RT-PCR analysis of total F3H expression in four day old seedlings of <bold>(a) </bold>'Chinese Spring' ('Hope' 7B) (1), 'TRI 2732' (2) and progeny of the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732' (3–10); <bold>(b) </bold>substitution 'Chinese Spring' (<italic>Ae. tauschii </italic>7D) (1), 'Chinese Spring' (2) and the 'Chinese Spring'/<italic>Ae. tauschii </italic>7D introgression lines (3–8).</bold> Anthocyanin pigmentation in coleoptiles of the corresponding lines is shown above, whereas the status of chromosomes 7B <bold>(a) </bold>or 7D <bold>(b) </bold>of each line is indicated in the lower part of the panel.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F8\\\"><label>Figure 8</label><caption><p><italic><bold>F3H </bold></italic><bold>copy-specific RT-PCR analysis from four day old seedlings of 'Chinese Spring' ('Hope' 7B) (1), 'TRI 2732' (2) and progeny of the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732' (3–10).</bold> Anthocyanin pigmentation in coleoptiles of the corresponding lines is shown below. The length of the RT-PCR products is given in base pairs to the right.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F9\\\"><label>Figure 9</label><caption><p>Quantitative RT-PCR analysis with respect to the various copies of <italic>F3H </italic>in 'Chinese Spring' (CS), 'Chinese Spring' ('Hope' 7A), 'Chinese Spring' ('Hope' 7B) and 'Mironovskaya 808' (M808).</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F10\\\"><label>Figure 10</label><caption><p><bold>Comparison of <italic>T. aestivum F3H </italic>copies <italic>vs </italic>homologous wheat ESTs.</bold> The highest identity value for each EST is indicated with black arrow.</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Length, Genbank accession numbers and chromosome locations for <italic>F3H </italic>nucleotide sequences determined in the present study.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Species, gene</td><td align=\"center\">Length in base pairs (gene segment specification according Figure 1)</td><td align=\"center\">Genbank accession number</td><td align=\"center\">Identical wheat ESTs*</td><td align=\"center\">Chromosome location</td></tr></thead><tbody><tr><td align=\"left\"><italic>T. aestivum, F3H1</italic></td><td align=\"center\">1852, complete structural part of gene (Segments 1+2+3+4)</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"EF463100\">EF463100</ext-link></td><td align=\"center\">BG262227</td><td align=\"center\">2A</td></tr><tr><td align=\"left\"><italic>T. aestivum, F3H2</italic></td><td align=\"center\">1374, complete structural part of gene (Segments 1+4+5)</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"DQ233636\">DQ233636</ext-link></td><td align=\"center\">BJ237068 BJ242608</td><td align=\"center\">2D</td></tr><tr><td align=\"left\"><italic>T. aestivum, F3H3</italic></td><td align=\"center\">1626, partial (Segments 2+3+4)</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"EU402957\">EU402957</ext-link></td><td align=\"center\">BQ240612 BG262749 CA705431</td><td align=\"center\">2B</td></tr><tr><td align=\"left\"><italic>T. aestivum, F3H4</italic></td><td align=\"center\">562, partial (Segment 2)</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"EU402958\">EU402958</ext-link></td><td align=\"center\">BE414777</td><td align=\"center\">2B</td></tr><tr><td align=\"left\"><italic>T. timopheevii, F3H1</italic><sup><italic>t</italic></sup></td><td align=\"center\">542, partial (Segment 3)</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"EU402959\">EU402959</ext-link></td><td align=\"center\">BG262227</td><td align=\"center\">2A</td></tr><tr><td align=\"left\"><italic>T. timopheevii, F3H2</italic><sup><italic>t</italic></sup></td><td align=\"center\">539, partial (Segment 3)</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"EU402960\">EU402960</ext-link></td><td align=\"center\">-</td><td align=\"center\">2G</td></tr><tr><td align=\"left\"><italic>T. urartu, F3H</italic></td><td align=\"center\">542, partial (Segment 3)</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"EU402961\">EU402961</ext-link></td><td align=\"center\">BG262227</td><td align=\"center\">Suggested 2A</td></tr><tr><td align=\"left\"><italic>Ae. speltoides, F3H</italic></td><td align=\"center\">542, partial (Segment 3)</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"EU402963\">EU402963</ext-link></td><td align=\"center\">-</td><td align=\"center\">Suggested 2S</td></tr><tr><td align=\"left\"><italic>Ae. tauschii, F3H</italic></td><td align=\"center\">1326, partial (Segment 5)</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"DQ233637\">DQ233637</ext-link></td><td align=\"center\">BJ237068 BJ242608</td><td align=\"center\">Suggested 2D</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T2\"><label>Table 2</label><caption><p>Sequence homology and divergence among <italic>F3H1 </italic>and <italic>F3H2 </italic>genes.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">Part of gene</td><td align=\"center\">Length: <italic>F3H1</italic>/<italic>F3H2 </italic>(in bp)</td><td align=\"center\">Nucleotide sequences homology (%)</td><td align=\"center\">Ka/Ks*</td></tr></thead><tbody><tr><td align=\"left\">Exon1</td><td align=\"center\">369/369</td><td align=\"center\">98</td><td align=\"center\">0.125</td></tr><tr><td align=\"left\">Intron 1</td><td align=\"center\">614/136</td><td align=\"center\">There are two major deletion regions, other segments have over 90% homology</td><td align=\"center\">-</td></tr><tr><td align=\"left\">Exon 2</td><td align=\"center\">429/429</td><td align=\"center\">97</td><td align=\"center\">0.000</td></tr><tr><td align=\"left\">Intron 2</td><td align=\"center\">101/101</td><td align=\"center\">97</td><td align=\"center\">-</td></tr><tr><td align=\"left\">Exon 3</td><td align=\"center\">339/339</td><td align=\"center\">98</td><td align=\"center\">0.167</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T3\"><label>Table 3</label><caption><p>T-values for expression levels of different <italic>F3H </italic>homoeologues in coleoptiles (p = 0.05 for all presented values).</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\"><italic>F3H-A1 vs F3H-B1</italic></td><td align=\"center\"><italic>F3H-A1 vs F3H-D1</italic></td><td align=\"center\"><italic>F3H-D1 vs F3H-B1</italic></td></tr></thead><tbody><tr><td align=\"center\">'Chinese Spring' ('Hope' 7A)</td><td align=\"center\">0.28</td><td align=\"center\">0.40</td><td align=\"center\">0.40</td></tr><tr><td align=\"center\">'Chinese Spring' ('Hope' 7B)</td><td align=\"center\">0.04</td><td align=\"center\">0.48</td><td align=\"center\">1.92</td></tr><tr><td align=\"center\">'Mironovskaya 808'</td><td align=\"center\">1.39</td><td align=\"center\">0.27</td><td align=\"center\">0.52</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T4\"><label>Table 4</label><caption><p>T-values for F3H expression in different wheat genotypes.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">Genotypes compared</td><td align=\"center\">'Chinese Spring' ('Hope' 7A) <italic>vs </italic>'Chinese Spring' ('Hope' 7B)</td><td align=\"center\">'Chinese Spring' ('Hope' 7A) <italic>vs </italic>'Mironovskaya 808'</td><td align=\"center\">'Chinese Spring' ('Hope' 7B) <italic>vs </italic>'Mironovskaya 808'</td></tr></thead><tbody><tr><td align=\"center\">T</td><td align=\"center\">6.17</td><td align=\"center\">4.29</td><td align=\"center\">2.76</td></tr><tr><td align=\"center\">P ></td><td align=\"center\">0.999</td><td align=\"center\">0.999</td><td align=\"center\">0.95</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T5\"><label>Table 5</label><caption><p>Previously characterised flavonoid biosynthesis pathway genes in wheat.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\" colspan=\"3\">Gene cloning</td><td align=\"center\">Mapping</td></tr><tr><td/><td colspan=\"3\"><hr/></td><td colspan=\"1\"><hr/></td></tr><tr><td align=\"left\">Enzyme</td><td align=\"center\">Cloning approach</td><td align=\"center\">Number of cloned copies</td><td align=\"center\">Genbank accessions; references</td><td align=\"center\">Chromosome location; references</td></tr></thead><tbody><tr><td align=\"left\">PAL – phenylalanine ammonialyase</td><td align=\"center\">Isolation from genomic library</td><td align=\"center\">2 complete</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"X99705\">X99705</ext-link>[##UREF##17##41##,##REF##14669506##42##]</td><td align=\"center\">3A, 3B, 3D, 6A, 6B, 6D [##UREF##4##7##]</td></tr><tr><td align=\"left\">CHS – chalcone synthase</td><td align=\"center\">PCR-based cloning</td><td align=\"center\">4 complete</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"AY286093\">AY286093</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"AY286095\">AY286095</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"AY286096\">AY286096</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"AY286097\">AY286097</ext-link>[##UREF##18##43##]</td><td align=\"center\">1A, 1B, 1D, 2A, 2B, 2D [##UREF##4##7##]</td></tr><tr><td align=\"left\">CHI – chalcone-flavanone isomerase</td><td align=\"center\">PCR-based cloning</td><td align=\"center\">1 partial</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"AB187026\">AB187026</ext-link>[##REF##16094442##11##]</td><td align=\"center\">5A, 5B, 5D [##UREF##4##7##]</td></tr><tr><td align=\"left\">F3H – flavanone 3-hydroxylase</td><td align=\"center\">PCR-based cloning</td><td align=\"center\">1 partial</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"AB187027\">AB187027</ext-link>[##REF##16094442##11##]</td><td align=\"center\">-</td></tr><tr><td align=\"left\">F3'5'H – flavonoid 3',5'-hydroxylase</td><td align=\"center\">PCR-based cloning</td><td align=\"center\">1 partial</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"AY519468\">AY519468</ext-link>[##UREF##18##43##]</td><td align=\"center\">-</td></tr><tr><td align=\"left\">DFR – dihydroflavonol-4-reductase</td><td align=\"center\">PCR-based cloning</td><td align=\"center\">3 complete</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"AB162138\">AB162138</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"AB162139\">AB162139</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"AB162140\">AB162140</ext-link>[##REF##14718498##44##]</td><td align=\"center\">3AL, 3BL, 3DL [##REF##14718498##44##,##REF##15514041##45##]</td></tr><tr><td align=\"left\">ANS – anthocyanidin synthase</td><td align=\"center\">Not described</td><td align=\"center\">5 complete</td><td align=\"center\"><ext-link ext-link-type=\"gen\" xlink:href=\"AB247917\">AB247917</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"AB247918\">AB247918</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"AB247919\">AB247919</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"AB247920\">AB247920</ext-link>, <ext-link ext-link-type=\"gen\" xlink:href=\"AB247921\">AB247921</ext-link>[##UREF##19##46##]</td><td align=\"center\">6AS (2 copies), 6BS (2 copies), 6DS [##UREF##19##46##]</td></tr><tr><td align=\"left\">FMT – flavonoid 7-O-methyltransferase</td><td align=\"center\">-</td><td align=\"center\">-</td><td align=\"center\">-</td><td align=\"center\">1A, 1B, 1D [##UREF##4##7##]</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T6\"><label>Table 6</label><caption><p>Primers designed to amplify wheat <italic>F3H </italic>for cloning, chromosomal localization and for expression analysis.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Purpose</td><td align=\"left\">Gene</td><td align=\"left\">Gene segment specification (according Figure 1) or former gene name</td><td align=\"left\">DNA/cDNA-derived PCR product length (bp)</td><td align=\"left\">Forward primers</td><td align=\"left\">Reverse primers</td></tr></thead><tbody><tr><td align=\"left\">PCR-based cloning</td><td align=\"left\"><italic>F3H</italic></td><td align=\"left\">Segment 1</td><td align=\"left\">variable</td><td align=\"left\">atggcgccggtgagcaac</td><td align=\"left\">tttacgtggcatggcatgcat</td></tr><tr><td/><td align=\"left\"><italic>F3H</italic></td><td align=\"left\">Segment 2</td><td align=\"left\">variable</td><td align=\"left\">atgacgcgcctctctcgcg</td><td align=\"left\">tggacggtgatccaggtcttg</td></tr><tr><td/><td align=\"left\"><italic>F3H</italic></td><td align=\"left\">Segment 3</td><td align=\"left\">variable</td><td align=\"left\">[##REF##16094442##11##]</td><td align=\"left\">[##REF##16094442##11##]</td></tr><tr><td/><td align=\"left\"><italic>F3H</italic></td><td align=\"left\">Segment 4</td><td align=\"left\">variable</td><td align=\"left\">tctcgatcgatcgaccaccaa</td><td align=\"left\">ctaggcaagaatttcgttgaggg</td></tr><tr><td/><td align=\"left\"><italic>F3H</italic></td><td align=\"left\">Segment 5</td><td align=\"left\">variable</td><td align=\"left\">ccggtgagcaacgagacgttc</td><td align=\"left\">ggcaagaatttcgttgagggg</td></tr><tr><td align=\"left\">Chromosomal assignment and</td><td align=\"left\"><italic>F3H</italic>-<italic>A</italic>1</td><td align=\"left\"><italic>T. aestivum F3H1</italic></td><td align=\"left\">703/-</td><td align=\"left\">gccacctgcaggtatacacgcat</td><td align=\"left\">ccaccgcccgtagtccct</td></tr><tr><td align=\"left\">physical mapping</td><td align=\"left\"><italic>F3H</italic>-<italic>B</italic>1</td><td align=\"left\"><italic>T. aestivum F3H3</italic></td><td align=\"left\">333/-</td><td align=\"left\">gcgtgctgtccgaggcgc</td><td align=\"left\">cgatcgatcgattaaggatt</td></tr><tr><td/><td align=\"left\"><italic>F3H</italic>-<italic>B2</italic></td><td align=\"left\"><italic>T. aestivum F3H4</italic></td><td align=\"left\">255/155</td><td align=\"left\">gctgcctgccgaggacaagg</td><td align=\"left\">aacgcccgtagtcccgtgcc</td></tr><tr><td/><td align=\"left\"><italic>F3H</italic>-<italic>D</italic>1</td><td align=\"left\"><italic>T. aestivum F3H2</italic></td><td align=\"left\">225/-</td><td align=\"left\">gccacctgcaggtacccacacat</td><td align=\"left\">ccacctcccgtagtcccg</td></tr><tr><td/><td align=\"left\"><italic>F3H</italic>-<italic>G</italic>1</td><td align=\"left\"><italic>T. timopheevii F3H2</italic><sup><italic>t</italic></sup></td><td align=\"left\">371/-</td><td align=\"left\">acgactcatggggctgtca</td><td align=\"left\">caattggtggtcgatcgatcag</td></tr><tr><td align=\"left\">qRT-PCR, RT-PCR</td><td align=\"left\"><italic>F3H</italic>-<italic>A</italic>1</td><td align=\"left\"><italic>T. aestivum F3H1</italic></td><td align=\"left\">800/186</td><td align=\"left\">atgacacgcctctctcgcg</td><td align=\"left\">ccaccgcccgtagtccct</td></tr><tr><td/><td align=\"left\"><italic>F3H</italic>-<italic>B</italic>1</td><td align=\"left\"><italic>T. aestivum F3H3</italic></td><td align=\"left\">830/183</td><td align=\"left\">tgacgcgcctctctcgcgag</td><td align=\"left\">accgcccgtagtcccgtgct</td></tr><tr><td/><td align=\"left\"><italic>F3H</italic>-<italic>B2</italic></td><td align=\"left\"><italic>T. aestivum F3H4</italic></td><td align=\"left\">255/155</td><td align=\"left\">gctgcctgccgaggacaagg</td><td align=\"left\">aacgcccgtagtcccgtgcc</td></tr><tr><td/><td align=\"left\"><italic>F3H</italic>-<italic>D</italic>1</td><td align=\"left\"><italic>T. aestivum F3H2</italic></td><td align=\"left\">281/145</td><td align=\"left\">atcgtctccagccacctgcag</td><td align=\"left\">cgctgtatcgctccaccacg</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Length, Genbank accession numbers and chromosome locations for <italic>F3H </italic>nucleotide sequences determined in the present study.</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\">Species, gene</td><td align=\\\"center\\\">Length in base pairs (gene segment specification according Figure 1)</td><td align=\\\"center\\\">Genbank accession number</td><td align=\\\"center\\\">Identical wheat ESTs*</td><td align=\\\"center\\\">Chromosome location</td></tr></thead><tbody><tr><td align=\\\"left\\\"><italic>T. aestivum, F3H1</italic></td><td align=\\\"center\\\">1852, complete structural part of gene (Segments 1+2+3+4)</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EF463100\\\">EF463100</ext-link></td><td align=\\\"center\\\">BG262227</td><td align=\\\"center\\\">2A</td></tr><tr><td align=\\\"left\\\"><italic>T. aestivum, F3H2</italic></td><td align=\\\"center\\\">1374, complete structural part of gene (Segments 1+4+5)</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"DQ233636\\\">DQ233636</ext-link></td><td align=\\\"center\\\">BJ237068 BJ242608</td><td align=\\\"center\\\">2D</td></tr><tr><td align=\\\"left\\\"><italic>T. aestivum, F3H3</italic></td><td align=\\\"center\\\">1626, partial (Segments 2+3+4)</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402957\\\">EU402957</ext-link></td><td align=\\\"center\\\">BQ240612 BG262749 CA705431</td><td align=\\\"center\\\">2B</td></tr><tr><td align=\\\"left\\\"><italic>T. aestivum, F3H4</italic></td><td align=\\\"center\\\">562, partial (Segment 2)</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402958\\\">EU402958</ext-link></td><td align=\\\"center\\\">BE414777</td><td align=\\\"center\\\">2B</td></tr><tr><td align=\\\"left\\\"><italic>T. timopheevii, F3H1</italic><sup><italic>t</italic></sup></td><td align=\\\"center\\\">542, partial (Segment 3)</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402959\\\">EU402959</ext-link></td><td align=\\\"center\\\">BG262227</td><td align=\\\"center\\\">2A</td></tr><tr><td align=\\\"left\\\"><italic>T. timopheevii, F3H2</italic><sup><italic>t</italic></sup></td><td align=\\\"center\\\">539, partial (Segment 3)</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402960\\\">EU402960</ext-link></td><td align=\\\"center\\\">-</td><td align=\\\"center\\\">2G</td></tr><tr><td align=\\\"left\\\"><italic>T. urartu, F3H</italic></td><td align=\\\"center\\\">542, partial (Segment 3)</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402961\\\">EU402961</ext-link></td><td align=\\\"center\\\">BG262227</td><td align=\\\"center\\\">Suggested 2A</td></tr><tr><td align=\\\"left\\\"><italic>Ae. speltoides, F3H</italic></td><td align=\\\"center\\\">542, partial (Segment 3)</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"EU402963\\\">EU402963</ext-link></td><td align=\\\"center\\\">-</td><td align=\\\"center\\\">Suggested 2S</td></tr><tr><td align=\\\"left\\\"><italic>Ae. tauschii, F3H</italic></td><td align=\\\"center\\\">1326, partial (Segment 5)</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"DQ233637\\\">DQ233637</ext-link></td><td align=\\\"center\\\">BJ237068 BJ242608</td><td align=\\\"center\\\">Suggested 2D</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T2\\\"><label>Table 2</label><caption><p>Sequence homology and divergence among <italic>F3H1 </italic>and <italic>F3H2 </italic>genes.</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"center\\\">Part of gene</td><td align=\\\"center\\\">Length: <italic>F3H1</italic>/<italic>F3H2 </italic>(in bp)</td><td align=\\\"center\\\">Nucleotide sequences homology (%)</td><td align=\\\"center\\\">Ka/Ks*</td></tr></thead><tbody><tr><td align=\\\"left\\\">Exon1</td><td align=\\\"center\\\">369/369</td><td align=\\\"center\\\">98</td><td align=\\\"center\\\">0.125</td></tr><tr><td align=\\\"left\\\">Intron 1</td><td align=\\\"center\\\">614/136</td><td align=\\\"center\\\">There are two major deletion regions, other segments have over 90% homology</td><td align=\\\"center\\\">-</td></tr><tr><td align=\\\"left\\\">Exon 2</td><td align=\\\"center\\\">429/429</td><td align=\\\"center\\\">97</td><td align=\\\"center\\\">0.000</td></tr><tr><td align=\\\"left\\\">Intron 2</td><td align=\\\"center\\\">101/101</td><td align=\\\"center\\\">97</td><td align=\\\"center\\\">-</td></tr><tr><td align=\\\"left\\\">Exon 3</td><td align=\\\"center\\\">339/339</td><td align=\\\"center\\\">98</td><td align=\\\"center\\\">0.167</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T3\\\"><label>Table 3</label><caption><p>T-values for expression levels of different <italic>F3H </italic>homoeologues in coleoptiles (p = 0.05 for all presented values).</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td/><td align=\\\"center\\\"><italic>F3H-A1 vs F3H-B1</italic></td><td align=\\\"center\\\"><italic>F3H-A1 vs F3H-D1</italic></td><td align=\\\"center\\\"><italic>F3H-D1 vs F3H-B1</italic></td></tr></thead><tbody><tr><td align=\\\"center\\\">'Chinese Spring' ('Hope' 7A)</td><td align=\\\"center\\\">0.28</td><td align=\\\"center\\\">0.40</td><td align=\\\"center\\\">0.40</td></tr><tr><td align=\\\"center\\\">'Chinese Spring' ('Hope' 7B)</td><td align=\\\"center\\\">0.04</td><td align=\\\"center\\\">0.48</td><td align=\\\"center\\\">1.92</td></tr><tr><td align=\\\"center\\\">'Mironovskaya 808'</td><td align=\\\"center\\\">1.39</td><td align=\\\"center\\\">0.27</td><td align=\\\"center\\\">0.52</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T4\\\"><label>Table 4</label><caption><p>T-values for F3H expression in different wheat genotypes.</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"center\\\">Genotypes compared</td><td align=\\\"center\\\">'Chinese Spring' ('Hope' 7A) <italic>vs </italic>'Chinese Spring' ('Hope' 7B)</td><td align=\\\"center\\\">'Chinese Spring' ('Hope' 7A) <italic>vs </italic>'Mironovskaya 808'</td><td align=\\\"center\\\">'Chinese Spring' ('Hope' 7B) <italic>vs </italic>'Mironovskaya 808'</td></tr></thead><tbody><tr><td align=\\\"center\\\">T</td><td align=\\\"center\\\">6.17</td><td align=\\\"center\\\">4.29</td><td align=\\\"center\\\">2.76</td></tr><tr><td align=\\\"center\\\">P ></td><td align=\\\"center\\\">0.999</td><td align=\\\"center\\\">0.999</td><td align=\\\"center\\\">0.95</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T5\\\"><label>Table 5</label><caption><p>Previously characterised flavonoid biosynthesis pathway genes in wheat.</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td/><td align=\\\"center\\\" colspan=\\\"3\\\">Gene cloning</td><td align=\\\"center\\\">Mapping</td></tr><tr><td/><td colspan=\\\"3\\\"><hr/></td><td colspan=\\\"1\\\"><hr/></td></tr><tr><td align=\\\"left\\\">Enzyme</td><td align=\\\"center\\\">Cloning approach</td><td align=\\\"center\\\">Number of cloned copies</td><td align=\\\"center\\\">Genbank accessions; references</td><td align=\\\"center\\\">Chromosome location; references</td></tr></thead><tbody><tr><td align=\\\"left\\\">PAL – phenylalanine ammonialyase</td><td align=\\\"center\\\">Isolation from genomic library</td><td align=\\\"center\\\">2 complete</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"X99705\\\">X99705</ext-link>[##UREF##17##41##,##REF##14669506##42##]</td><td align=\\\"center\\\">3A, 3B, 3D, 6A, 6B, 6D [##UREF##4##7##]</td></tr><tr><td align=\\\"left\\\">CHS – chalcone synthase</td><td align=\\\"center\\\">PCR-based cloning</td><td align=\\\"center\\\">4 complete</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AY286093\\\">AY286093</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AY286095\\\">AY286095</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AY286096\\\">AY286096</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AY286097\\\">AY286097</ext-link>[##UREF##18##43##]</td><td align=\\\"center\\\">1A, 1B, 1D, 2A, 2B, 2D [##UREF##4##7##]</td></tr><tr><td align=\\\"left\\\">CHI – chalcone-flavanone isomerase</td><td align=\\\"center\\\">PCR-based cloning</td><td align=\\\"center\\\">1 partial</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AB187026\\\">AB187026</ext-link>[##REF##16094442##11##]</td><td align=\\\"center\\\">5A, 5B, 5D [##UREF##4##7##]</td></tr><tr><td align=\\\"left\\\">F3H – flavanone 3-hydroxylase</td><td align=\\\"center\\\">PCR-based cloning</td><td align=\\\"center\\\">1 partial</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AB187027\\\">AB187027</ext-link>[##REF##16094442##11##]</td><td align=\\\"center\\\">-</td></tr><tr><td align=\\\"left\\\">F3'5'H – flavonoid 3',5'-hydroxylase</td><td align=\\\"center\\\">PCR-based cloning</td><td align=\\\"center\\\">1 partial</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AY519468\\\">AY519468</ext-link>[##UREF##18##43##]</td><td align=\\\"center\\\">-</td></tr><tr><td align=\\\"left\\\">DFR – dihydroflavonol-4-reductase</td><td align=\\\"center\\\">PCR-based cloning</td><td align=\\\"center\\\">3 complete</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AB162138\\\">AB162138</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AB162139\\\">AB162139</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AB162140\\\">AB162140</ext-link>[##REF##14718498##44##]</td><td align=\\\"center\\\">3AL, 3BL, 3DL [##REF##14718498##44##,##REF##15514041##45##]</td></tr><tr><td align=\\\"left\\\">ANS – anthocyanidin synthase</td><td align=\\\"center\\\">Not described</td><td align=\\\"center\\\">5 complete</td><td align=\\\"center\\\"><ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AB247917\\\">AB247917</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AB247918\\\">AB247918</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AB247919\\\">AB247919</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AB247920\\\">AB247920</ext-link>, <ext-link ext-link-type=\\\"gen\\\" xlink:href=\\\"AB247921\\\">AB247921</ext-link>[##UREF##19##46##]</td><td align=\\\"center\\\">6AS (2 copies), 6BS (2 copies), 6DS [##UREF##19##46##]</td></tr><tr><td align=\\\"left\\\">FMT – flavonoid 7-O-methyltransferase</td><td align=\\\"center\\\">-</td><td align=\\\"center\\\">-</td><td align=\\\"center\\\">-</td><td align=\\\"center\\\">1A, 1B, 1D [##UREF##4##7##]</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T6\\\"><label>Table 6</label><caption><p>Primers designed to amplify wheat <italic>F3H </italic>for cloning, chromosomal localization and for expression analysis.</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\">Purpose</td><td align=\\\"left\\\">Gene</td><td align=\\\"left\\\">Gene segment specification (according Figure 1) or former gene name</td><td align=\\\"left\\\">DNA/cDNA-derived PCR product length (bp)</td><td align=\\\"left\\\">Forward primers</td><td align=\\\"left\\\">Reverse primers</td></tr></thead><tbody><tr><td align=\\\"left\\\">PCR-based cloning</td><td align=\\\"left\\\"><italic>F3H</italic></td><td align=\\\"left\\\">Segment 1</td><td align=\\\"left\\\">variable</td><td align=\\\"left\\\">atggcgccggtgagcaac</td><td align=\\\"left\\\">tttacgtggcatggcatgcat</td></tr><tr><td/><td align=\\\"left\\\"><italic>F3H</italic></td><td align=\\\"left\\\">Segment 2</td><td align=\\\"left\\\">variable</td><td align=\\\"left\\\">atgacgcgcctctctcgcg</td><td align=\\\"left\\\">tggacggtgatccaggtcttg</td></tr><tr><td/><td align=\\\"left\\\"><italic>F3H</italic></td><td align=\\\"left\\\">Segment 3</td><td align=\\\"left\\\">variable</td><td align=\\\"left\\\">[##REF##16094442##11##]</td><td align=\\\"left\\\">[##REF##16094442##11##]</td></tr><tr><td/><td align=\\\"left\\\"><italic>F3H</italic></td><td align=\\\"left\\\">Segment 4</td><td align=\\\"left\\\">variable</td><td align=\\\"left\\\">tctcgatcgatcgaccaccaa</td><td align=\\\"left\\\">ctaggcaagaatttcgttgaggg</td></tr><tr><td/><td align=\\\"left\\\"><italic>F3H</italic></td><td align=\\\"left\\\">Segment 5</td><td align=\\\"left\\\">variable</td><td align=\\\"left\\\">ccggtgagcaacgagacgttc</td><td align=\\\"left\\\">ggcaagaatttcgttgagggg</td></tr><tr><td align=\\\"left\\\">Chromosomal assignment and</td><td align=\\\"left\\\"><italic>F3H</italic>-<italic>A</italic>1</td><td align=\\\"left\\\"><italic>T. aestivum F3H1</italic></td><td align=\\\"left\\\">703/-</td><td align=\\\"left\\\">gccacctgcaggtatacacgcat</td><td align=\\\"left\\\">ccaccgcccgtagtccct</td></tr><tr><td align=\\\"left\\\">physical mapping</td><td align=\\\"left\\\"><italic>F3H</italic>-<italic>B</italic>1</td><td align=\\\"left\\\"><italic>T. aestivum F3H3</italic></td><td align=\\\"left\\\">333/-</td><td align=\\\"left\\\">gcgtgctgtccgaggcgc</td><td align=\\\"left\\\">cgatcgatcgattaaggatt</td></tr><tr><td/><td align=\\\"left\\\"><italic>F3H</italic>-<italic>B2</italic></td><td align=\\\"left\\\"><italic>T. aestivum F3H4</italic></td><td align=\\\"left\\\">255/155</td><td align=\\\"left\\\">gctgcctgccgaggacaagg</td><td align=\\\"left\\\">aacgcccgtagtcccgtgcc</td></tr><tr><td/><td align=\\\"left\\\"><italic>F3H</italic>-<italic>D</italic>1</td><td align=\\\"left\\\"><italic>T. aestivum F3H2</italic></td><td align=\\\"left\\\">225/-</td><td align=\\\"left\\\">gccacctgcaggtacccacacat</td><td align=\\\"left\\\">ccacctcccgtagtcccg</td></tr><tr><td/><td align=\\\"left\\\"><italic>F3H</italic>-<italic>G</italic>1</td><td align=\\\"left\\\"><italic>T. timopheevii F3H2</italic><sup><italic>t</italic></sup></td><td align=\\\"left\\\">371/-</td><td align=\\\"left\\\">acgactcatggggctgtca</td><td align=\\\"left\\\">caattggtggtcgatcgatcag</td></tr><tr><td align=\\\"left\\\">qRT-PCR, RT-PCR</td><td align=\\\"left\\\"><italic>F3H</italic>-<italic>A</italic>1</td><td align=\\\"left\\\"><italic>T. aestivum F3H1</italic></td><td align=\\\"left\\\">800/186</td><td align=\\\"left\\\">atgacacgcctctctcgcg</td><td align=\\\"left\\\">ccaccgcccgtagtccct</td></tr><tr><td/><td align=\\\"left\\\"><italic>F3H</italic>-<italic>B</italic>1</td><td align=\\\"left\\\"><italic>T. aestivum F3H3</italic></td><td align=\\\"left\\\">830/183</td><td align=\\\"left\\\">tgacgcgcctctctcgcgag</td><td align=\\\"left\\\">accgcccgtagtcccgtgct</td></tr><tr><td/><td align=\\\"left\\\"><italic>F3H</italic>-<italic>B2</italic></td><td align=\\\"left\\\"><italic>T. aestivum F3H4</italic></td><td align=\\\"left\\\">255/155</td><td align=\\\"left\\\">gctgcctgccgaggacaagg</td><td align=\\\"left\\\">aacgcccgtagtcccgtgcc</td></tr><tr><td/><td align=\\\"left\\\"><italic>F3H</italic>-<italic>D</italic>1</td><td align=\\\"left\\\"><italic>T. aestivum F3H2</italic></td><td align=\\\"left\\\">281/145</td><td align=\\\"left\\\">atcgtctccagccacctgcag</td><td align=\\\"left\\\">cgctgtatcgctccaccacg</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":["<table-wrap-foot><p>*Correspondence between <italic>F3H </italic>copies and ESTs was first determined based on identity at gene copy-specific sights, and then was confirmed by whole sequences comparison (see Figure 10).</p></table-wrap-foot>","<table-wrap-foot><p>*Ka – non-synonymous nucleotide substitutions, Ks – synonymous nucleotide substitutions.</p></table-wrap-foot>"],"string":"[\n \"<table-wrap-foot><p>*Correspondence between <italic>F3H </italic>copies and ESTs was first determined based on identity at gene copy-specific sights, and then was confirmed by whole sequences comparison (see Figure 10).</p></table-wrap-foot>\",\n \"<table-wrap-foot><p>*Ka – non-synonymous nucleotide substitutions, Ks – synonymous nucleotide substitutions.</p></table-wrap-foot>\"\n]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1471-2229-8-88-1\"/>","<graphic xlink:href=\"1471-2229-8-88-2\"/>","<graphic xlink:href=\"1471-2229-8-88-3\"/>","<graphic xlink:href=\"1471-2229-8-88-4\"/>","<graphic xlink:href=\"1471-2229-8-88-5\"/>","<graphic xlink:href=\"1471-2229-8-88-6\"/>","<graphic xlink:href=\"1471-2229-8-88-7\"/>","<graphic xlink:href=\"1471-2229-8-88-8\"/>","<graphic xlink:href=\"1471-2229-8-88-9\"/>","<graphic xlink:href=\"1471-2229-8-88-10\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1471-2229-8-88-1\\\"/>\",\n \"<graphic xlink:href=\\\"1471-2229-8-88-2\\\"/>\",\n \"<graphic xlink:href=\\\"1471-2229-8-88-3\\\"/>\",\n \"<graphic xlink:href=\\\"1471-2229-8-88-4\\\"/>\",\n \"<graphic xlink:href=\\\"1471-2229-8-88-5\\\"/>\",\n \"<graphic xlink:href=\\\"1471-2229-8-88-6\\\"/>\",\n \"<graphic xlink:href=\\\"1471-2229-8-88-7\\\"/>\",\n \"<graphic xlink:href=\\\"1471-2229-8-88-8\\\"/>\",\n \"<graphic xlink:href=\\\"1471-2229-8-88-9\\\"/>\",\n \"<graphic xlink:href=\\\"1471-2229-8-88-10\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Bogdanova\", \"Sarbaev\", \"Makhmudova\"], \"given-names\": [\"ED\", \"AT\", \"KK\"], \"article-title\": [\"Resistance of common wheat to bunt [abstract]\"], \"source\": [\"Proceedings of the Research Conference on Genetics: 2002; Moscow\"], \"year\": [\"2002\"], \"fpage\": [\"43\"], \"lpage\": [\"44\"]}, {\"surname\": [\"Gould\"], \"given-names\": [\"KS\"], \"article-title\": [\"Nature's swiss army knife: the diverse protective roles of anthocyanins in leaves\"], \"source\": [\"J Biomed Biotech\"], \"year\": [\"2004\"], \"volume\": [\"5\"], \"fpage\": [\"314\"], \"lpage\": [\"320\"], \"pub-id\": [\"10.1155/S1110724304406147\"]}, {\"surname\": [\"Winkel-Shirley\"], \"given-names\": [\"B\"], \"article-title\": [\"Biosynthesis of flavonoids and effects of stress\"], \"source\": [\"Cur Op Plant Biol\"], \"year\": [\"2002\"], \"volume\": [\"5\"], \"fpage\": [\"218\"], \"lpage\": [\"223\"], \"pub-id\": [\"10.1016/S1369-5266(02)00256-X\"]}, {\"surname\": [\"Khlestkina\", \"R\\u00f6der\", \"Pshenichnikova\", \"Simonov\", \"Salina\", \"B\\u00f6rner\", \"Verrity JF, Abbington LE\"], \"given-names\": [\"EK\", \"MS\", \"TA\", \"AV\", \"EA\", \"A\"], \"article-title\": [\"Genes for anthocyanin pigmentation in wheat: review and microsatellite-based mapping\"], \"source\": [\"Chromosome Mapping Research Developments\"], \"year\": [\"2008\"], \"publisher-name\": [\"New York: NOVA Science Publishers, Inc, USA\"], \"fpage\": [\"155\"], \"lpage\": [\"175\"]}, {\"surname\": [\"Li\", \"Faris\", \"Chittoor\", \"Leach\", \"Hulbert\", \"Liu\", \"Chen\", \"Gill\"], \"given-names\": [\"WL\", \"JD\", \"JM\", \"JE\", \"SH\", \"DJ\", \"PD\", \"BS\"], \"article-title\": [\"Genomic mapping of defense response genes in wheat\"], \"source\": [\"Theor Appl Genet\"], \"year\": [\"1999\"], \"volume\": [\"98\"], \"fpage\": [\"226\"], \"lpage\": [\"233\"], \"pub-id\": [\"10.1007/s001220051062\"]}, {\"surname\": [\"Ahmed\", \"Maekawa\", \"Utsugi\", \"Himi\", \"Ablet\", \"Rikiishi\", \"Noda\"], \"given-names\": [\"N\", \"M\", \"S\", \"E\", \"H\", \"K\", \"K\"], \"article-title\": [\"Transient expression of anthocyanin in developing wheat coleoptile by maize \"], \"italic\": [\"c1 \", \"B-peru \"], \"source\": [\"Breed Sci\"], \"year\": [\"2003\"], \"volume\": [\"52\"], \"fpage\": [\"29\"], \"lpage\": [\"43\"], \"pub-id\": [\"10.1270/jsbbs.53.29\"]}, {\"surname\": [\"Ahmed\", \"Maekawa\", \"Utsugi\", \"Rikiishi\", \"Ahmad\", \"Noda\"], \"given-names\": [\"N\", \"M\", \"S\", \"K\", \"A\", \"K\"], \"article-title\": [\"The wheat \"], \"italic\": [\"Rc \"], \"source\": [\"J Cereal Sci\"], \"year\": [\"2006\"], \"volume\": [\"44\"], \"fpage\": [\"54\"], \"lpage\": [\"58\"], \"pub-id\": [\"10.1016/j.jcs.2006.03.002\"]}, {\"surname\": [\"Meldgaard\"], \"given-names\": [\"M\"], \"article-title\": [\"Expression of chalcone synthase, dihydroflavonol reductase, and flavonone-3-hydroxilase in mutants of barley deficient in anthocyanin and proanthocyanidin biosynthesis\"], \"source\": [\"Theor Appl Genet\"], \"year\": [\"1992\"], \"volume\": [\"83\"], \"fpage\": [\"695\"], \"lpage\": [\"706\"], \"pub-id\": [\"10.1007/BF00226687\"]}, {\"surname\": [\"Leonova\", \"B\\u00f6rner\", \"Budashkina\", \"Kalinina\", \"Unger\", \"R\\u00f6der\", \"Salina\"], \"given-names\": [\"I\", \"A\", \"E\", \"N\", \"O\", \"M\", \"E\"], \"article-title\": [\"Identification of microsatellite markers for a leaf rust resistance gene introgressed into common wheat from \"], \"italic\": [\"Triticum timopheevii\"], \"source\": [\"Plant Breed\"], \"year\": [\"2004\"], \"volume\": [\"123\"], \"fpage\": [\"93\"], \"lpage\": [\"95\"], \"pub-id\": [\"10.1046/j.0179-9541.2003.00906.x\"]}, {\"surname\": [\"Dorofeev\", \"Korovina\"], \"given-names\": [\"VF\", \"ON\"], \"collab\": [\"Eds\"], \"source\": [\"Flora of Cultivated Plants\"], \"year\": [\"1979\"], \"publisher-name\": [\"Leningrad: Kolos\"]}, {\"surname\": [\"Feldman\", \"Benjean AP, Angus WJ\"], \"given-names\": [\"M\"], \"article-title\": [\"The origin of Cultivated Wheat\"], \"source\": [\"The Wheat Book A History of Wheat Breeding\"], \"year\": [\"2001\"], \"publisher-name\": [\"Paris: Lavoisier Publishing\"], \"fpage\": [\"3\"], \"lpage\": [\"56\"]}, {\"surname\": [\"Xu\", \"Tang\", \"Chen\", \"Li\", \"Chai\"], \"given-names\": [\"B-B\", \"Z-L\", \"L\", \"J-N\", \"Y-R\"], \"article-title\": [\"Cloning of two flavanone 3-hydroxylase (F3H) genes from oilseed rape (\"], \"italic\": [\"Brassica napus\"], \"source\": [\"GenBank\"], \"year\": [\"2007\"]}, {\"surname\": [\"Smit\", \"Bochkov\", \"Caple\"], \"given-names\": [\"WA\", \"AF\", \"R\"], \"source\": [\"Organic synthesis The science behind the art\"], \"year\": [\"1998\"], \"publisher-name\": [\"Cambridge: The Royal Society of Chemistry Press\"]}, {\"surname\": [\"Gale\", \"Flavell\"], \"given-names\": [\"MD\", \"RB\"], \"article-title\": [\"The genetic control of anthocyanin biosythesis by homoeologous chromosomes in wheat\"], \"source\": [\"Genet Res Camb\"], \"year\": [\"1971\"], \"volume\": [\"18\"], \"fpage\": [\"237\"], \"lpage\": [\"244\"]}, {\"surname\": [\"Sears\"], \"given-names\": [\"ER\"], \"article-title\": [\"Nullisomic analysis in common wheat\"], \"source\": [\"Amer Nat\"], \"year\": [\"1953\"], \"volume\": [\"87\"], \"fpage\": [\"245\"], \"lpage\": [\"252\"], \"pub-id\": [\"10.1086/281780\"]}, {\"surname\": [\"Endo\", \"Gill\"], \"given-names\": [\"TR\", \"BS\"], \"article-title\": [\"The deletion stocks of common wheat\"], \"source\": [\"J Hered\"], \"year\": [\"1996\"], \"volume\": [\"87\"], \"fpage\": [\"295\"], \"lpage\": [\"307\"]}, {\"surname\": [\"Plaschke\", \"Ganal\", \"R\\u00f6der\"], \"given-names\": [\"J\", \"MW\", \"MS\"], \"article-title\": [\"Detection of genetic diversity in closely related bread wheat using microsatellite markers\"], \"source\": [\"Theor Appl Genet\"], \"year\": [\"1995\"], \"volume\": [\"91\"], \"fpage\": [\"1001\"], \"lpage\": [\"1007\"], \"pub-id\": [\"10.1007/BF00223912\"]}, {\"surname\": [\"Liao\", \"Li\", \"Kreuzaler\", \"Fischer\"], \"given-names\": [\"YC\", \"HP\", \"F\", \"R\"], \"article-title\": [\"Nucleotide sequence of one of two tandem genes encoding phenylalanine ammonia-lyase in \"], \"italic\": [\"Triticum aestivum\"], \"source\": [\"Plant Physiol\"], \"year\": [\"1996\"], \"volume\": [\"112\"], \"fpage\": [\"1398\"], \"lpage\": [\"1398\"]}, {\"surname\": [\"Yang\", \"Li\", \"Gao\", \"Liu\", \"Zhao\", \"Zheng\", \"Tong\", \"Li\"], \"given-names\": [\"G\", \"B\", \"J\", \"J\", \"X\", \"Q\", \"Y\", \"Z\"], \"article-title\": [\"Cloning and expression of two chalcone synthase and a flavonoid 3'5'-Hydroxylase 3'-end cDNAs from developing seeds of blue-grained wheat involved in anthocyanin biosynthetic pathway\"], \"source\": [\"J Integr Plant Biol\"], \"year\": [\"2004\"], \"volume\": [\"46\"], \"fpage\": [\"588\"], \"lpage\": [\"594\"]}, {\"surname\": [\"Himi\", \"Osaka\", \"Noda\"], \"given-names\": [\"E\", \"T\", \"K\"], \"article-title\": [\"Isolation and characterization of wheat \"], \"italic\": [\"ANS \"], \"source\": [\"GenBank\"], \"year\": [\"2006\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":46,"string":"46"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:38"},"citation":{"kind":"string","value":"BMC Plant Biol. 2008 Aug 13; 8:88"},"package_file":{"kind":"string","value":"oa_package/7e/8a/PMC2538534.tar.gz"}}},{"rowIdx":119697,"cells":{"accession_id":{"kind":"string","value":"PMC2538535"},"pmid":{"kind":"string","value":"18724866"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>South Africa is at the southern extreme of malaria distribution in Africa. Malaria is endemic in the low-altitude areas of the northern and eastern parts of South Africa along the border with Mozambique and Zimbabwe, with transmission taking place mainly in Limpopo, Mpumalanga and KwaZulu-Natal provinces [##REF##18250936##1##]. Malaria transmission is distinctly seasonal, with transmission limited to the warm and rainy summer months (September to May), hence malaria is unstable and epidemic-prone [##REF##10322323##2##].</p>","<p><italic>Plasmodium falciparum </italic>accounts for the majority of malaria cases in southern Africa and is the predominant species associated with severe and fatal disease. Almost all South Africans lack acquired immunity, including residents of seasonal malaria transmission areas, and are, therefore, at risk for developing severe malaria [##REF##18250936##1##]. In 2006, South Africa reported 12,098 cases of malaria (incidence rate 25.9 per 100,000 person-years) including 87 deaths (case fatality rate [CFR] 0.7%) [##UREF##0##3##,##UREF##1##4##]. Limpopo Province had the highest number of cases (6,369) and deaths (57) that year; the incidence rate was higher in Mpumalanga (140.1 versus 112.3 per 100,000 person-years) and the CFR was similar to that of KwaZulu-Natal (both 0.9%).</p>","<p>The South African Malaria Control Programme is active since 1945 in all three provinces and currently includes: (i) vector control through intensive indoor residual house-spraying (IRS); (ii) case management (diagnosis with <italic>P. falciparum</italic>-specific HRP-2 rapid antigen detection tests [RDTs] [##REF##17556616##5##]; (iii) treatment of uncomplicated malaria with artemisinin combination therapy [ACT] in the form of artemether-lumefantrine) [##UREF##2##6##,##REF##18165491##7##]; (iv) disease surveillance; (v) epidemic preparedness and response; and (vi) health promotion. The key intervention has been IRS since 1945, using both dichlorodiphenyltrichloroethane (DDT) and pyrethroids. The use of DDT has been scaled up since 2000, in order to combat insecticide-resistant <italic>Anopheles funestus </italic>[##REF##15303988##8##].</p>","<p>Data are available from the computerized malaria information system from Limpopo Department of Health and Social Development from 1998–2007. These have been used for national health statistics, including reported numbers of malaria cases and incidence, and reported numbers of deaths from malaria and CFRs [##UREF##0##3##,##UREF##1##4##]. These national health statistics data are available per year and/or malaria season for Limpopo Province as a whole. No data are available for the different sexes and age groups, nor for the district council level.</p>","<p>Several studies have been conducted on malaria epidemiology in KwaZulu-Natal, using data from the provincial malaria information system [##UREF##3##9##, ####REF##15598256##10##, ##REF##15598257##11##, ##REF##11737835##12##, ##REF##11821251##13####11821251##13##]. The aim of this article is to give a detailed overview of malaria incidence and mortality in Limpopo Province, South Africa, for the seasons 1998–1999 to 2006–2007, based on the routinely collected provincial data. It focuses on the reported malaria cases (numbers and incidence rates) and deaths (numbers and CFRs) overall, and by sex, age group and district council.</p>","<p>This information is of importance as there is a basic lack of high-quality epidemiological data (for morbidity and mortality) for epidemic-prone areas [##REF##17306624##14##]. In Africa, the areas with seasonal transmission (and hence with a higher risk of epidemics) are located across the Sahelean belt, down trough the horn of Africa, into East Africa and throughout Southern Africa [##REF##15331829##15##].</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>South Africa is at the southern extreme of malaria distribution in Africa. Malaria is endemic in the low-altitude areas of the northern and eastern parts of South Africa along the border with Mozambique and Zimbabwe, with transmission taking place mainly in Limpopo, Mpumalanga and KwaZulu-Natal provinces [##REF##18250936##1##]. Malaria transmission is distinctly seasonal, with transmission limited to the warm and rainy summer months (September to May), hence malaria is unstable and epidemic-prone [##REF##10322323##2##].</p>\",\n \"<p><italic>Plasmodium falciparum </italic>accounts for the majority of malaria cases in southern Africa and is the predominant species associated with severe and fatal disease. Almost all South Africans lack acquired immunity, including residents of seasonal malaria transmission areas, and are, therefore, at risk for developing severe malaria [##REF##18250936##1##]. In 2006, South Africa reported 12,098 cases of malaria (incidence rate 25.9 per 100,000 person-years) including 87 deaths (case fatality rate [CFR] 0.7%) [##UREF##0##3##,##UREF##1##4##]. Limpopo Province had the highest number of cases (6,369) and deaths (57) that year; the incidence rate was higher in Mpumalanga (140.1 versus 112.3 per 100,000 person-years) and the CFR was similar to that of KwaZulu-Natal (both 0.9%).</p>\",\n \"<p>The South African Malaria Control Programme is active since 1945 in all three provinces and currently includes: (i) vector control through intensive indoor residual house-spraying (IRS); (ii) case management (diagnosis with <italic>P. falciparum</italic>-specific HRP-2 rapid antigen detection tests [RDTs] [##REF##17556616##5##]; (iii) treatment of uncomplicated malaria with artemisinin combination therapy [ACT] in the form of artemether-lumefantrine) [##UREF##2##6##,##REF##18165491##7##]; (iv) disease surveillance; (v) epidemic preparedness and response; and (vi) health promotion. The key intervention has been IRS since 1945, using both dichlorodiphenyltrichloroethane (DDT) and pyrethroids. The use of DDT has been scaled up since 2000, in order to combat insecticide-resistant <italic>Anopheles funestus </italic>[##REF##15303988##8##].</p>\",\n \"<p>Data are available from the computerized malaria information system from Limpopo Department of Health and Social Development from 1998–2007. These have been used for national health statistics, including reported numbers of malaria cases and incidence, and reported numbers of deaths from malaria and CFRs [##UREF##0##3##,##UREF##1##4##]. These national health statistics data are available per year and/or malaria season for Limpopo Province as a whole. No data are available for the different sexes and age groups, nor for the district council level.</p>\",\n \"<p>Several studies have been conducted on malaria epidemiology in KwaZulu-Natal, using data from the provincial malaria information system [##UREF##3##9##, ####REF##15598256##10##, ##REF##15598257##11##, ##REF##11737835##12##, ##REF##11821251##13####11821251##13##]. The aim of this article is to give a detailed overview of malaria incidence and mortality in Limpopo Province, South Africa, for the seasons 1998–1999 to 2006–2007, based on the routinely collected provincial data. It focuses on the reported malaria cases (numbers and incidence rates) and deaths (numbers and CFRs) overall, and by sex, age group and district council.</p>\",\n \"<p>This information is of importance as there is a basic lack of high-quality epidemiological data (for morbidity and mortality) for epidemic-prone areas [##REF##17306624##14##]. In Africa, the areas with seasonal transmission (and hence with a higher risk of epidemics) are located across the Sahelean belt, down trough the horn of Africa, into East Africa and throughout Southern Africa [##REF##15331829##15##].</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<p>For this descriptive study data from the malaria information system of Limpopo Province were used. This system has been developed by the Malaria Research Programme of the South African Medical Research Council using Microsoft Access for data entry and validation [##UREF##4##16##].</p>","<p>Malaria is a notifiable disease in South Africa. The case reporting system aims to capture every parasitologically confirmed infection through both passive and active surveillance, although the latter has been greatly scaled down during the past decade [##UREF##5##17##]. Active surveillance consisted of screening measures by which teams went into a community with a known risk of malaria, or where there was a suspicion of parasite carriers. Smears were taken from all community members, but with emphasis on those with fever, a history of fever, a travel history to a malaria risk area, or possible migrants from malaria endemic areas. There was less need for active surveillance after the introduction of RDTs in 1998, as all suspected malaria patients could now get a blood test at the primary health care (PHC) facilities. Furthermore, the yield of active surveillance became extremely low; only 0.2% of active smears were found to be positive. The passive surveillance system did not change during the study period.</p>","<p>Only cases positively confirmed by either microscopy or RDT are notified and entered into the system. RDTs are available at all primary health care (PHC) facilities throughout the province, and microscopy is available in laboratories e.g. at the hospitals. All PHC facilities and hospitals (including private hospitals) notify all parasitologically confirmed infections and in the areas most at risk, the Malaria Control Programme is actively involved in this process e.g. by visiting facilities twice weekly for the collection and verification of records, or by the placement of a staff member who is responsible for the notification, and by performing regular checks. Since 1996, efforts are also made to stimulate private general practitioners to report cases: however, currently not all of them notify infections (although some of the referral laboratories do so) possibly resulting in some underreporting of malaria cases which we estimate to be less than 5% in any case. Normally it takes between 7–14 days between date of diagnosis and date of entry into the system.</p>","<p>As malaria transmission in South Africa is seasonal, it is best presented using seasonal data. A malaria season was taken to be the period from 1 July to 30 June the following year. For the seasons 1998 – 1999 through 2006 – 2007 the following data were extracted for all reported confirmed malaria cases: date of diagnosis, surveillance type (active or passive), sex, age (in years), district council where the case resided, country or province in South Africa where the case presumably contracted malaria, and death due to malaria (yes/no). Age was grouped into five-year age categories; cases 60 years and older were aggregated into one age group. Until December 2005 Limpopo Province included six districts: Bohlabela, Capricorn, Greater Sekhukhune, Mopani, Vhembe and Waterberg (Figure ##FIG##0##1##). After that, Bohlabela district has been divided between Limpopo and Mpumalanga provinces and thus no longer exists as and administrative entity [##UREF##6##18##]. Therefore, the data analyses for the separate districts have been limited to the seasons 1998 – 1999 to 2004 – 2005. For the years 2001 to 2007 mid-year population estimates for the whole province by sex and age group were obtained from Statistics South Africa [##UREF##7##19##]. The annual population growth rates over these years were calculated. These turned out to be 1.007% per year for the total population of the province, 1.006% per year for the females and 1.008% for the males, and ranged from 0.978% to 1.041% per year for the different age groups. These percentages were then used to calculate mid-year population estimates backward in time for the years 1998, 1999 and 2000.</p>","<p>In order to calculate the malaria incidence rates per 100,000 person-years for the separate seasons for the province as a whole, the number of reported malaria cases per season was divided by the mean of the preceding and the following mid-year population estimates (since this corresponds to the respective mid-malaria season population) and then multiplied by 100,000. The mean incidence rate per season over the whole period of nine seasons for the province as a whole, both sexes and the different age groups was calculated as follows: first, for the specific group the total number of reported malaria cases for this period was divided by the mean of the mid-year estimates of 1998 and 2007 (as these corresponded to the population totals at the beginning and end of the period respectively). Then this number was divided by 9 (seasons), and finally multiplied by 100,000.</p>","<p>Population counts for the district councils were obtained from South Africa's most recent national census, which was carried out in October 2001 [##UREF##8##20##]. As this date corresponds reasonably to the middle of the period ranging from 1 July 1998 to 31 June 2005 (which actually is 31 December 2001), these population estimates were used to calculate the mean incidence rate per season over the whole period of seven seasons for the different districts.</p>","<p>The CFR is defined as the number of deaths due to malaria divided by the number of malaria cases and expressed as a percentage.</p>","<p>The Chi squared test for trend was used to test whether the malaria incidence rate was statistically significant decreasing over the malaria seasons and the CFR increasing by age group. Furthermore, the Chi squared test was used to calculate whether the differences in incidence rate and CFR between both sexes were statistically significant and whether the malaria incidence rate was statistically significant associated with age. All data analyses were conducted in SPSS (version 14.0; SPSS Inc, Chicago Ill).</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<p>For this descriptive study data from the malaria information system of Limpopo Province were used. This system has been developed by the Malaria Research Programme of the South African Medical Research Council using Microsoft Access for data entry and validation [##UREF##4##16##].</p>\",\n \"<p>Malaria is a notifiable disease in South Africa. The case reporting system aims to capture every parasitologically confirmed infection through both passive and active surveillance, although the latter has been greatly scaled down during the past decade [##UREF##5##17##]. Active surveillance consisted of screening measures by which teams went into a community with a known risk of malaria, or where there was a suspicion of parasite carriers. Smears were taken from all community members, but with emphasis on those with fever, a history of fever, a travel history to a malaria risk area, or possible migrants from malaria endemic areas. There was less need for active surveillance after the introduction of RDTs in 1998, as all suspected malaria patients could now get a blood test at the primary health care (PHC) facilities. Furthermore, the yield of active surveillance became extremely low; only 0.2% of active smears were found to be positive. The passive surveillance system did not change during the study period.</p>\",\n \"<p>Only cases positively confirmed by either microscopy or RDT are notified and entered into the system. RDTs are available at all primary health care (PHC) facilities throughout the province, and microscopy is available in laboratories e.g. at the hospitals. All PHC facilities and hospitals (including private hospitals) notify all parasitologically confirmed infections and in the areas most at risk, the Malaria Control Programme is actively involved in this process e.g. by visiting facilities twice weekly for the collection and verification of records, or by the placement of a staff member who is responsible for the notification, and by performing regular checks. Since 1996, efforts are also made to stimulate private general practitioners to report cases: however, currently not all of them notify infections (although some of the referral laboratories do so) possibly resulting in some underreporting of malaria cases which we estimate to be less than 5% in any case. Normally it takes between 7–14 days between date of diagnosis and date of entry into the system.</p>\",\n \"<p>As malaria transmission in South Africa is seasonal, it is best presented using seasonal data. A malaria season was taken to be the period from 1 July to 30 June the following year. For the seasons 1998 – 1999 through 2006 – 2007 the following data were extracted for all reported confirmed malaria cases: date of diagnosis, surveillance type (active or passive), sex, age (in years), district council where the case resided, country or province in South Africa where the case presumably contracted malaria, and death due to malaria (yes/no). Age was grouped into five-year age categories; cases 60 years and older were aggregated into one age group. Until December 2005 Limpopo Province included six districts: Bohlabela, Capricorn, Greater Sekhukhune, Mopani, Vhembe and Waterberg (Figure ##FIG##0##1##). After that, Bohlabela district has been divided between Limpopo and Mpumalanga provinces and thus no longer exists as and administrative entity [##UREF##6##18##]. Therefore, the data analyses for the separate districts have been limited to the seasons 1998 – 1999 to 2004 – 2005. For the years 2001 to 2007 mid-year population estimates for the whole province by sex and age group were obtained from Statistics South Africa [##UREF##7##19##]. The annual population growth rates over these years were calculated. These turned out to be 1.007% per year for the total population of the province, 1.006% per year for the females and 1.008% for the males, and ranged from 0.978% to 1.041% per year for the different age groups. These percentages were then used to calculate mid-year population estimates backward in time for the years 1998, 1999 and 2000.</p>\",\n \"<p>In order to calculate the malaria incidence rates per 100,000 person-years for the separate seasons for the province as a whole, the number of reported malaria cases per season was divided by the mean of the preceding and the following mid-year population estimates (since this corresponds to the respective mid-malaria season population) and then multiplied by 100,000. The mean incidence rate per season over the whole period of nine seasons for the province as a whole, both sexes and the different age groups was calculated as follows: first, for the specific group the total number of reported malaria cases for this period was divided by the mean of the mid-year estimates of 1998 and 2007 (as these corresponded to the population totals at the beginning and end of the period respectively). Then this number was divided by 9 (seasons), and finally multiplied by 100,000.</p>\",\n \"<p>Population counts for the district councils were obtained from South Africa's most recent national census, which was carried out in October 2001 [##UREF##8##20##]. As this date corresponds reasonably to the middle of the period ranging from 1 July 1998 to 31 June 2005 (which actually is 31 December 2001), these population estimates were used to calculate the mean incidence rate per season over the whole period of seven seasons for the different districts.</p>\",\n \"<p>The CFR is defined as the number of deaths due to malaria divided by the number of malaria cases and expressed as a percentage.</p>\",\n \"<p>The Chi squared test for trend was used to test whether the malaria incidence rate was statistically significant decreasing over the malaria seasons and the CFR increasing by age group. Furthermore, the Chi squared test was used to calculate whether the differences in incidence rate and CFR between both sexes were statistically significant and whether the malaria incidence rate was statistically significant associated with age. All data analyses were conducted in SPSS (version 14.0; SPSS Inc, Chicago Ill).</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<p>In total, 58,768 cases of malaria were reported, including 628 deaths, in the seasons 1998 – 1999 to 2006 – 2007. 3,047 (5.2%) of the cases were detected by active surveillance and 55,717 (94.8%) by passive surveillance (for 4 cases no data on surveillance type were available). In Table ##TAB##0##1##, the number of reported malaria cases, the incidence rate per 100,000 person-years (including 95% confidence intervals (CI)), the number of reported malaria deaths and the CFR are given for each of the nine seasons. There were a mean 6,530 cases (standard deviation (SD) 2,236.5) and 70 deaths (SD 27.5) per season, with a mean incidence rate of 124.5 (SD 44.5) and a mean CFR of 1.1% (SD 0.3).</p>","<p>In Figure ##FIG##1##2##, the malaria incidence rates per season are graphically presented. The test for trend was highly significant (X<sup>2 </sup>= 4,859.2; p < 0.001) indicating that the incidence rate of malaria is decreasing over the seasons.</p>","<p>Malaria transmission in the province mainly occurs from September to May, numbers of cases are very low in June, July and August. The distribution of reported malaria cases over the different months varies somewhat between the different seasons. In general, the number of cases peaked between October and April (most often in either November or January), although in some seasons there were two peaks (one smaller and one bigger).</p>","<p>Out of the total of 58,768 reported cases of malaria, 32,314 were among males (55%) and 26,449 among females (45%) (for five cases no data on sex were available). There were a mean 3,590 cases among males (SD 1,168.7) and 2,939 cases among females (SD 1,074.1) per season. The mean incidence rate per season was 145.8 per 100,000 person-years for males (95% CI 141.0 – 150.6) and 105.6 for females (95% CI 101.8 – 109.4), which yields a statistically significant difference (X<sup>2 </sup>= 170.9; p < 0.001). Of all 628 deaths due to malaria, 336 were among males and 292 among females, with a mean of 37 deaths among males (SD 13.5) and 32 deaths among females (SD 14.8) per season. The mean CFR was similar for both males and females: 1.1% (X<sup>2 </sup>= 0.567; p = 0.451).</p>","<p>The median age of all cases was 21 years (IQR 9.5 to 32.5 years; range 0 to 99 years) (for 310 cases data on age were missing). Table ##TAB##1##2## gives the mean number of reported malaria cases and deaths, the mean incidence rate (95% CI) and CFR for each age category. The CFR increased statistically significantly with increasing age (test for trend, X<sup>2 </sup>= 444.9; p < 0.001).</p>","<p>In Figure ##FIG##2##3##, the mean malaria incidence rates per age category are graphically presented. The Chi squared test was highly significant (X<sup>2 </sup>= 383.5; p < 0.001) indicating that there is an association between the incidence rate of malaria and age.</p>","<p>Table ##TAB##2##3## gives the mean number of reported malaria cases and deaths, the mean incidence rate (95% CI) and CFR for each district council. In Figure ##FIG##0##1## the mean incidence rates for each of the six districts are given.</p>","<p>The majority of all malaria cases reported over the whole period (37,487; 63.8%) were reported to have contracted malaria in Limpopo Province itself, 3.0% contracted malaria in Mozambique, 1.6% in Zimbabwe and 0.5% in either Mpumalanga, KwaZulu-Natal, other African countries or India. However, for many cases data on the location were malaria presumably is contracted were missing (18,297; 31.1%).</p>","<p>When the cases definitely originating from Limpopo are compared to \"the rest\" (those not originating from the province and those with an unknown location of contracting malaria), it is found that in the latter group there are significantly more males (58.8%) than in the first group (52.8%) (X<sup>2 </sup>= 197.3; p < 0.001) and that the median age in the latter group is higher (24.0; IQR 13.5 – 35.5) compared to the first group (20.0; IQR 9.5 – 31.5) (Mann-Whitney U test: p < 0.001). Furthermore, while 65.6% of the first group is diagnosed in Vhembe district and 22.2% in Mopani, from the latter group 38.1% is diagnosed in Vhembe, 35.7% in Mopani and 18.6% in Bohlabela (X<sup>2 </sup>= 4,538; p < 0.001).</p>","<p>When all the analyses above are limited to those cases definitely originating from Limpopo, all incidence rates are lower, but the differences and trends stay the same. The mean incidence rate was 79.8 per 100,000 person-years (SD 29.1). There was a decreasing trend in the incidence rate over time (X<sup>2 </sup>for trend = 3,770.9; p < 0.001), from 122.5 in 1998–1999 to 35.7 in 2006–2007. The mean incidence rate in males was higher than in females (89.3 versus 70.6 per 100,000 person-years; X<sup>2 </sup>= 58.2; p < 0.001). The incidence rate was lowest in 0–4 year olds (50.3), it peaked at the ages of 35–39 years (100.4), and decreased with age from 40 years (to 56.3 for those = 60 years). The incidence rate varied widely between districts; Vhembe (251.2), Mopani (98.0), Bohlabela (80.0), Waterberg (10.6), Sekhukhune (3.9) and Capricorn (3.4)</p>"],"string":"[\n \"<title>Results</title>\",\n \"<p>In total, 58,768 cases of malaria were reported, including 628 deaths, in the seasons 1998 – 1999 to 2006 – 2007. 3,047 (5.2%) of the cases were detected by active surveillance and 55,717 (94.8%) by passive surveillance (for 4 cases no data on surveillance type were available). In Table ##TAB##0##1##, the number of reported malaria cases, the incidence rate per 100,000 person-years (including 95% confidence intervals (CI)), the number of reported malaria deaths and the CFR are given for each of the nine seasons. There were a mean 6,530 cases (standard deviation (SD) 2,236.5) and 70 deaths (SD 27.5) per season, with a mean incidence rate of 124.5 (SD 44.5) and a mean CFR of 1.1% (SD 0.3).</p>\",\n \"<p>In Figure ##FIG##1##2##, the malaria incidence rates per season are graphically presented. The test for trend was highly significant (X<sup>2 </sup>= 4,859.2; p < 0.001) indicating that the incidence rate of malaria is decreasing over the seasons.</p>\",\n \"<p>Malaria transmission in the province mainly occurs from September to May, numbers of cases are very low in June, July and August. The distribution of reported malaria cases over the different months varies somewhat between the different seasons. In general, the number of cases peaked between October and April (most often in either November or January), although in some seasons there were two peaks (one smaller and one bigger).</p>\",\n \"<p>Out of the total of 58,768 reported cases of malaria, 32,314 were among males (55%) and 26,449 among females (45%) (for five cases no data on sex were available). There were a mean 3,590 cases among males (SD 1,168.7) and 2,939 cases among females (SD 1,074.1) per season. The mean incidence rate per season was 145.8 per 100,000 person-years for males (95% CI 141.0 – 150.6) and 105.6 for females (95% CI 101.8 – 109.4), which yields a statistically significant difference (X<sup>2 </sup>= 170.9; p < 0.001). Of all 628 deaths due to malaria, 336 were among males and 292 among females, with a mean of 37 deaths among males (SD 13.5) and 32 deaths among females (SD 14.8) per season. The mean CFR was similar for both males and females: 1.1% (X<sup>2 </sup>= 0.567; p = 0.451).</p>\",\n \"<p>The median age of all cases was 21 years (IQR 9.5 to 32.5 years; range 0 to 99 years) (for 310 cases data on age were missing). Table ##TAB##1##2## gives the mean number of reported malaria cases and deaths, the mean incidence rate (95% CI) and CFR for each age category. The CFR increased statistically significantly with increasing age (test for trend, X<sup>2 </sup>= 444.9; p < 0.001).</p>\",\n \"<p>In Figure ##FIG##2##3##, the mean malaria incidence rates per age category are graphically presented. The Chi squared test was highly significant (X<sup>2 </sup>= 383.5; p < 0.001) indicating that there is an association between the incidence rate of malaria and age.</p>\",\n \"<p>Table ##TAB##2##3## gives the mean number of reported malaria cases and deaths, the mean incidence rate (95% CI) and CFR for each district council. In Figure ##FIG##0##1## the mean incidence rates for each of the six districts are given.</p>\",\n \"<p>The majority of all malaria cases reported over the whole period (37,487; 63.8%) were reported to have contracted malaria in Limpopo Province itself, 3.0% contracted malaria in Mozambique, 1.6% in Zimbabwe and 0.5% in either Mpumalanga, KwaZulu-Natal, other African countries or India. However, for many cases data on the location were malaria presumably is contracted were missing (18,297; 31.1%).</p>\",\n \"<p>When the cases definitely originating from Limpopo are compared to \\\"the rest\\\" (those not originating from the province and those with an unknown location of contracting malaria), it is found that in the latter group there are significantly more males (58.8%) than in the first group (52.8%) (X<sup>2 </sup>= 197.3; p < 0.001) and that the median age in the latter group is higher (24.0; IQR 13.5 – 35.5) compared to the first group (20.0; IQR 9.5 – 31.5) (Mann-Whitney U test: p < 0.001). Furthermore, while 65.6% of the first group is diagnosed in Vhembe district and 22.2% in Mopani, from the latter group 38.1% is diagnosed in Vhembe, 35.7% in Mopani and 18.6% in Bohlabela (X<sup>2 </sup>= 4,538; p < 0.001).</p>\",\n \"<p>When all the analyses above are limited to those cases definitely originating from Limpopo, all incidence rates are lower, but the differences and trends stay the same. The mean incidence rate was 79.8 per 100,000 person-years (SD 29.1). There was a decreasing trend in the incidence rate over time (X<sup>2 </sup>for trend = 3,770.9; p < 0.001), from 122.5 in 1998–1999 to 35.7 in 2006–2007. The mean incidence rate in males was higher than in females (89.3 versus 70.6 per 100,000 person-years; X<sup>2 </sup>= 58.2; p < 0.001). The incidence rate was lowest in 0–4 year olds (50.3), it peaked at the ages of 35–39 years (100.4), and decreased with age from 40 years (to 56.3 for those = 60 years). The incidence rate varied widely between districts; Vhembe (251.2), Mopani (98.0), Bohlabela (80.0), Waterberg (10.6), Sekhukhune (3.9) and Capricorn (3.4)</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>Over the seasons 1998 – 1999 to 2006 – 2007 the incidence rate of malaria showed a statistically significant decreasing trend in Limpopo Province. This is most likely to a considerable extent attributable to the scaling-up of DDT spraying in the region (in order to combat insecticide-resistant <italic>Anopheles funestus</italic>), with RDT-based rapid case detection contributing, as well as the introduction of ACTs for the treatment of uncomplicated malaria in Limpopo Province in December 2004 [##REF##18250936##1##,##REF##8642959##21##]. Malaria incidence could also be altered due to the regional effect the Lubombo Spatial Development Initiative (LSDI) Malaria Control programme is having. This tri-country initiative has managed to dramatically reduce the incidence of malaria in South Africa (Mpumlanaga and KwaZulu-Natal Provinces), Swaziland and Mozambique (Maputo province). As the LSDI programme has not extended fully to Gaza Province, the province neighbouring Limpopo, the effect on malaria transmission in Limpopo will be limited. As there is also very little movement between the malaria risk areas of Mpumalanga and KwaZulu-Natal, the reduction of malaria cases in these two provinces would have very little effect on Limpopo. It is however envisaged that the extension of the LSDI programme into Gaza Province would have a direct effect on the malaria incidence in Limpopo.</p>","<p>The CFR is fairly stable over the whole period (with a peak in the 2003–2004 season). This might be because the regimen for treating complicated malaria has not been changed. At the time of the study intravenous quinine was the only treatment available in South Africa for patients with severe malaria. The WHO now recommends the more effective treatment with intravenous artesunate for severe malaria in adults in low and moderate transmission areas [##UREF##9##22##,##REF##16125588##23##]. Furthermore, some say the relatively high CFRs [national target is 0.5% [##REF##18270632##24##]; estimated CFR for the WHO region sub-Saharan Africa is 0.4% [##UREF##10##25##]] might generally reflect the still thinly distributed health care facilities, and logistical problems, mostly at peripheral clinic level in Limpopo [##REF##18270632##24##]. However, a confidential inquiry conducted in Limpopo a few years ago made clear that PHC at the periphery is actually of a high standard, with excellent management of malaria patients at this level. The main issue was delay in treatment seeking, not because health services were inaccessible, but because of other practices, mainly the use of traditional medicine. Another explanation for the higher observed CFR is that, in contrast to most malaria-endemic areas, malaria in Limpopo is mostly a disease of adults, and the CFRs were high in adult age groups. Among children in Limpopo the CFRs were similar to the CFR of 0.4% mentioned for all of sub-Saharan Africa.</p>","<p>Regarding the distribution of reported malaria cases over the different months of the season; historically the malaria incidence peaks were later in the season in South Africa [##UREF##3##9##]. The shift to November–January might indicate a change in the dynamics of the malaria epidemiology and transmission patterns in Limpopo.</p>","<p>The incidence rate of malaria in males is higher than in females. The CFR is similar for both sexes. The higher incidence in males might be due to the fact that males are moving around more frequently in the region, mostly for work. This movement might also include movement across the country borders between malaria endemic areas and Limpopo. Migrant workers coming from abroad to Limpopo are also predominantly males. The latter is partly reflected by the fact that the percentage of males is higher in the group of cases that are (probably) not originating from the province.</p>","<p>As can be seen from Table ##TAB##1##2## and Figure ##FIG##2##3##, the malaria incidence rate is related to age. Incidence is lowest in the 0 – 4 year olds and then gradually increases and peaks at the age of 30 – 39 years, after which it gradually decreases again. In populations that lack immunity a predominantly flat age profile is expected [##REF##17306624##14##] which is different from high endemicity malaria areas where the distribution of numbers and severity of malaria episodes is distinctly skewed towards the age group of the under-fives [##REF##17040819##26##]. A study conducted in KwaZulu-Natal, using data from the malaria reporting system for the period mid-1990 to mid-1999, reported on the variation in the pattern of age-specific malaria incidence [##REF##11737835##12##]. In areas of high incidence within the province, incidence rose with age until the late teenage years and either remained constant or decreased afterwards in adults. The authors explained this steadily rising incidence with age during childhood by an increase in chance of infections as children become older. Incidence was lowest in the under five age group possibly because children at this age are indoors at night and benefit from the protection offered by indoor house spraying. As they get older, their sleeping patterns may be less regular and they may therefore be more at risk of infective bites by mosquitoes. Movement further increases, with the higher possibility of getting infected, once individuals start looking for work, which might also include cross border movements and migrants looking for employment in Limpopo. The latter is partly reflected by the fact that the age distribution of the group of cases that are (probably) not originating from the province is somewhat shifted to the higher age categories compared to that of the cases originating from Limpopo.</p>","<p>The CFR increases with increasing age, as malaria tends to be more severe in older people and treatment less successful; a finding very much in line with what is encountered in non-immune elderly travellers returning with malaria [##REF##12684911##27##]. The high CFR in the older age group (which is different from high endemicity malaria areas, where pregnant women and children under five are more at risk of severe and complicated malaria) might also indicate poor treatment seeking behaviour in this group that needs further investigation.</p>","<p>Of the six districts of Limpopo, Vhembe has by far the highest incidence rate, followed by Mopani and Bohlabela. Waterberg, and especially Capricorn and Sekhukune have a much lower incidence rate of malaria. This may be explained by e.g. cross-border movements; climatic factors, which are favourable for the malaria vector, in north-eastern Vhembe and Eastern Mopani, and different from those of the other areas. There are no suspected differences in completeness of reporting between districts.</p>","<p>The CFR in Capricorn and to a lesser extent in Sekhukune seems high compared to that of the other districts (although not statistically significant different). Maybe in areas with a low malaria incidence patients present (too) late to health care facilities due to poor recognition of symptoms and/or the health system does not respond adequately (delayed or inaccurate diagnosis and/or treatment).</p>","<p>As spatial variation of malaria incidence may be considerable, which would have implications for planning, implementing and evaluating malaria control measures [##REF##18171290##28##], more details on local epidemiological patterns down to community level would be helpful.</p>","<p>A limitation of this study is that it is based on routine data from the provincial malaria control programme. This system relies mainly on passive reporting; this means that there is an unknown degree of under-diagnosing and -reporting. The system of passive reporting did not change over the time of the study, so this under-ascertainment should not have affected the trends which were detected. There could be some underreporting due to asymptomatic cases, although their number will be small, as in a population with low-level immunity such as the South African one, most infections lead to clinical symptoms. [##REF##15598257##11##] However, there will at least be some asymptomatic malaria, especially in those districts with high malaria incidence.</p>","<p>Another limitation is that the population estimates do not include migrants from e.g. Mozambique and Zimbabwe, so the denominator of the incidence rates is too small. However, these people are included among the malaria cases. This is partly supported by the fact that the group including cases of whom the location of contracting malaria is unknown, are more most often diagnosed in the three districts (Vhembe, Mopani and Bohlabela) bordering Mozambique and Zimbabwe. As a result the incidence rates might be somewhat overestimated.</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>Over the seasons 1998 – 1999 to 2006 – 2007 the incidence rate of malaria showed a statistically significant decreasing trend in Limpopo Province. This is most likely to a considerable extent attributable to the scaling-up of DDT spraying in the region (in order to combat insecticide-resistant <italic>Anopheles funestus</italic>), with RDT-based rapid case detection contributing, as well as the introduction of ACTs for the treatment of uncomplicated malaria in Limpopo Province in December 2004 [##REF##18250936##1##,##REF##8642959##21##]. Malaria incidence could also be altered due to the regional effect the Lubombo Spatial Development Initiative (LSDI) Malaria Control programme is having. This tri-country initiative has managed to dramatically reduce the incidence of malaria in South Africa (Mpumlanaga and KwaZulu-Natal Provinces), Swaziland and Mozambique (Maputo province). As the LSDI programme has not extended fully to Gaza Province, the province neighbouring Limpopo, the effect on malaria transmission in Limpopo will be limited. As there is also very little movement between the malaria risk areas of Mpumalanga and KwaZulu-Natal, the reduction of malaria cases in these two provinces would have very little effect on Limpopo. It is however envisaged that the extension of the LSDI programme into Gaza Province would have a direct effect on the malaria incidence in Limpopo.</p>\",\n \"<p>The CFR is fairly stable over the whole period (with a peak in the 2003–2004 season). This might be because the regimen for treating complicated malaria has not been changed. At the time of the study intravenous quinine was the only treatment available in South Africa for patients with severe malaria. The WHO now recommends the more effective treatment with intravenous artesunate for severe malaria in adults in low and moderate transmission areas [##UREF##9##22##,##REF##16125588##23##]. Furthermore, some say the relatively high CFRs [national target is 0.5% [##REF##18270632##24##]; estimated CFR for the WHO region sub-Saharan Africa is 0.4% [##UREF##10##25##]] might generally reflect the still thinly distributed health care facilities, and logistical problems, mostly at peripheral clinic level in Limpopo [##REF##18270632##24##]. However, a confidential inquiry conducted in Limpopo a few years ago made clear that PHC at the periphery is actually of a high standard, with excellent management of malaria patients at this level. The main issue was delay in treatment seeking, not because health services were inaccessible, but because of other practices, mainly the use of traditional medicine. Another explanation for the higher observed CFR is that, in contrast to most malaria-endemic areas, malaria in Limpopo is mostly a disease of adults, and the CFRs were high in adult age groups. Among children in Limpopo the CFRs were similar to the CFR of 0.4% mentioned for all of sub-Saharan Africa.</p>\",\n \"<p>Regarding the distribution of reported malaria cases over the different months of the season; historically the malaria incidence peaks were later in the season in South Africa [##UREF##3##9##]. The shift to November–January might indicate a change in the dynamics of the malaria epidemiology and transmission patterns in Limpopo.</p>\",\n \"<p>The incidence rate of malaria in males is higher than in females. The CFR is similar for both sexes. The higher incidence in males might be due to the fact that males are moving around more frequently in the region, mostly for work. This movement might also include movement across the country borders between malaria endemic areas and Limpopo. Migrant workers coming from abroad to Limpopo are also predominantly males. The latter is partly reflected by the fact that the percentage of males is higher in the group of cases that are (probably) not originating from the province.</p>\",\n \"<p>As can be seen from Table ##TAB##1##2## and Figure ##FIG##2##3##, the malaria incidence rate is related to age. Incidence is lowest in the 0 – 4 year olds and then gradually increases and peaks at the age of 30 – 39 years, after which it gradually decreases again. In populations that lack immunity a predominantly flat age profile is expected [##REF##17306624##14##] which is different from high endemicity malaria areas where the distribution of numbers and severity of malaria episodes is distinctly skewed towards the age group of the under-fives [##REF##17040819##26##]. A study conducted in KwaZulu-Natal, using data from the malaria reporting system for the period mid-1990 to mid-1999, reported on the variation in the pattern of age-specific malaria incidence [##REF##11737835##12##]. In areas of high incidence within the province, incidence rose with age until the late teenage years and either remained constant or decreased afterwards in adults. The authors explained this steadily rising incidence with age during childhood by an increase in chance of infections as children become older. Incidence was lowest in the under five age group possibly because children at this age are indoors at night and benefit from the protection offered by indoor house spraying. As they get older, their sleeping patterns may be less regular and they may therefore be more at risk of infective bites by mosquitoes. Movement further increases, with the higher possibility of getting infected, once individuals start looking for work, which might also include cross border movements and migrants looking for employment in Limpopo. The latter is partly reflected by the fact that the age distribution of the group of cases that are (probably) not originating from the province is somewhat shifted to the higher age categories compared to that of the cases originating from Limpopo.</p>\",\n \"<p>The CFR increases with increasing age, as malaria tends to be more severe in older people and treatment less successful; a finding very much in line with what is encountered in non-immune elderly travellers returning with malaria [##REF##12684911##27##]. The high CFR in the older age group (which is different from high endemicity malaria areas, where pregnant women and children under five are more at risk of severe and complicated malaria) might also indicate poor treatment seeking behaviour in this group that needs further investigation.</p>\",\n \"<p>Of the six districts of Limpopo, Vhembe has by far the highest incidence rate, followed by Mopani and Bohlabela. Waterberg, and especially Capricorn and Sekhukune have a much lower incidence rate of malaria. This may be explained by e.g. cross-border movements; climatic factors, which are favourable for the malaria vector, in north-eastern Vhembe and Eastern Mopani, and different from those of the other areas. There are no suspected differences in completeness of reporting between districts.</p>\",\n \"<p>The CFR in Capricorn and to a lesser extent in Sekhukune seems high compared to that of the other districts (although not statistically significant different). Maybe in areas with a low malaria incidence patients present (too) late to health care facilities due to poor recognition of symptoms and/or the health system does not respond adequately (delayed or inaccurate diagnosis and/or treatment).</p>\",\n \"<p>As spatial variation of malaria incidence may be considerable, which would have implications for planning, implementing and evaluating malaria control measures [##REF##18171290##28##], more details on local epidemiological patterns down to community level would be helpful.</p>\",\n \"<p>A limitation of this study is that it is based on routine data from the provincial malaria control programme. This system relies mainly on passive reporting; this means that there is an unknown degree of under-diagnosing and -reporting. The system of passive reporting did not change over the time of the study, so this under-ascertainment should not have affected the trends which were detected. There could be some underreporting due to asymptomatic cases, although their number will be small, as in a population with low-level immunity such as the South African one, most infections lead to clinical symptoms. [##REF##15598257##11##] However, there will at least be some asymptomatic malaria, especially in those districts with high malaria incidence.</p>\",\n \"<p>Another limitation is that the population estimates do not include migrants from e.g. Mozambique and Zimbabwe, so the denominator of the incidence rates is too small. However, these people are included among the malaria cases. This is partly supported by the fact that the group including cases of whom the location of contracting malaria is unknown, are more most often diagnosed in the three districts (Vhembe, Mopani and Bohlabela) bordering Mozambique and Zimbabwe. As a result the incidence rates might be somewhat overestimated.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>This study gives an overview of the malaria incidence and mortality in Limpopo Province, South Africa, for the seasons 1998–1999 to 2006–2007. In summary, malaria is highly seasonal in Limpopo Province. The mean incidence rate was 124.5 per 100,000 person-years and the mean CFR 1.1% per season. There is a very significantly decreasing trend in the incidence rate over time (p < 0.001). The CFR is fairly stable over the whole period. The mean incidence rate in males is higher than in females (145.8 versus 105.6; p < 0.001); the CFR (1.1%) is similar for both sexes. The incidence rate peaks at the ages of 35–39 years (172.8). The CFR increases with increasing age (to 3.8% for those ≥ 60 years). There is large variation in malaria incidence (up to 70-fold) between the districts in Limpopo Province.</p>","<p>This study provides baseline data about the distribution of malaria in Limpopo Province over time, which will aid future research to refine and evaluate targeted intervention strategies (prevention, diagnosis, treatment). It also answers the need for better epidemiological data over a range of epidemic settings. Malaria control in these areas represents a different challenge from that in endemic settings [##REF##17306624##14##]. This information can guide the development of an individually tailored malaria elimination strategy for Limpopo and other epidemic-prone malaria areas in Africa, by helping to optimize the application of our malaria control tools at hand.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>This study gives an overview of the malaria incidence and mortality in Limpopo Province, South Africa, for the seasons 1998–1999 to 2006–2007. In summary, malaria is highly seasonal in Limpopo Province. The mean incidence rate was 124.5 per 100,000 person-years and the mean CFR 1.1% per season. There is a very significantly decreasing trend in the incidence rate over time (p < 0.001). The CFR is fairly stable over the whole period. The mean incidence rate in males is higher than in females (145.8 versus 105.6; p < 0.001); the CFR (1.1%) is similar for both sexes. The incidence rate peaks at the ages of 35–39 years (172.8). The CFR increases with increasing age (to 3.8% for those ≥ 60 years). There is large variation in malaria incidence (up to 70-fold) between the districts in Limpopo Province.</p>\",\n \"<p>This study provides baseline data about the distribution of malaria in Limpopo Province over time, which will aid future research to refine and evaluate targeted intervention strategies (prevention, diagnosis, treatment). It also answers the need for better epidemiological data over a range of epidemic settings. Malaria control in these areas represents a different challenge from that in endemic settings [##REF##17306624##14##]. This information can guide the development of an individually tailored malaria elimination strategy for Limpopo and other epidemic-prone malaria areas in Africa, by helping to optimize the application of our malaria control tools at hand.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>Malaria is endemic in the low-altitude areas of the northern and eastern parts of South Africa with seasonal transmission. The aim of this descriptive study is to give an overview of the malaria incidence and mortality in Limpopo Province for the seasons 1998–1999 to 2006–2007 and to detect trends over time and place.</p>","<title>Methods</title>","<p>Routinely collected data on diagnosed malaria cases and deaths were available through the provincial malaria information system. In order to calculate incidence rates, population estimates (by sex, age and district) were obtained from Statistics South Africa. The Chi squared test for trend was used to detect temporal trends in malaria incidence over the seasons, and a trend in case fatality rate (CFR) by age group. The Chi squared test was used to calculate differences in incidence rate and CFR between both sexes and in incidence by age group.</p>","<title>Results</title>","<p>In total, 58,768 cases of malaria were reported, including 628 deaths. The mean incidence rate was 124.5 per 100,000 person-years and the mean CFR 1.1% per season. There was a decreasing trend in the incidence rate over time (p < 0.001), from 173.0 in 1998–1999 to 50.9 in 2006–2007. The CFR was fairly stable over the whole period. The mean incidence rate in males was higher than in females (145.8 versus 105.6; p < 0.001); the CFR (1.1%) was similar for both sexes. The incidence rate was lowest in 0–4 year olds (78.3), it peaked at the ages of 35–39 years (172.8), and decreased with age from 40 years (to 84.4 for those ≥ 60 years). The CFR increased with increasing age (to 3.8% for those ≥ 60 years). The incidence rate varied widely between districts; it was highest in Vhembe (328.2) and lowest in Sekhukhune (5.5).</p>","<title>Conclusion</title>","<p>Information from this study may serve as baseline data to determine the course and distribution of malaria in Limpopo province over time. In the study period there was a decreasing trend in the incidence rate. Furthermore, the study addresses the need for better data over a range of epidemic-prone settings.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>Malaria is endemic in the low-altitude areas of the northern and eastern parts of South Africa with seasonal transmission. The aim of this descriptive study is to give an overview of the malaria incidence and mortality in Limpopo Province for the seasons 1998–1999 to 2006–2007 and to detect trends over time and place.</p>\",\n \"<title>Methods</title>\",\n \"<p>Routinely collected data on diagnosed malaria cases and deaths were available through the provincial malaria information system. In order to calculate incidence rates, population estimates (by sex, age and district) were obtained from Statistics South Africa. The Chi squared test for trend was used to detect temporal trends in malaria incidence over the seasons, and a trend in case fatality rate (CFR) by age group. The Chi squared test was used to calculate differences in incidence rate and CFR between both sexes and in incidence by age group.</p>\",\n \"<title>Results</title>\",\n \"<p>In total, 58,768 cases of malaria were reported, including 628 deaths. The mean incidence rate was 124.5 per 100,000 person-years and the mean CFR 1.1% per season. There was a decreasing trend in the incidence rate over time (p < 0.001), from 173.0 in 1998–1999 to 50.9 in 2006–2007. The CFR was fairly stable over the whole period. The mean incidence rate in males was higher than in females (145.8 versus 105.6; p < 0.001); the CFR (1.1%) was similar for both sexes. The incidence rate was lowest in 0–4 year olds (78.3), it peaked at the ages of 35–39 years (172.8), and decreased with age from 40 years (to 84.4 for those ≥ 60 years). The CFR increased with increasing age (to 3.8% for those ≥ 60 years). The incidence rate varied widely between districts; it was highest in Vhembe (328.2) and lowest in Sekhukhune (5.5).</p>\",\n \"<title>Conclusion</title>\",\n \"<p>Information from this study may serve as baseline data to determine the course and distribution of malaria in Limpopo province over time. In the study period there was a decreasing trend in the incidence rate. Furthermore, the study addresses the need for better data over a range of epidemic-prone settings.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>AAMG designed the study, performed the statistical analysis and drafted the manuscript. PK conceived of the study, participated in the acquisition of data, interpretation of data and revised the manuscript critically. MFSL and MPG both contributed to the analysis and interpretation of data and contributed to the writing of the manuscript. All authors have given final approval of this version to be published.</p>"],"string":"[\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>AAMG designed the study, performed the statistical analysis and drafted the manuscript. PK conceived of the study, participated in the acquisition of data, interpretation of data and revised the manuscript critically. MFSL and MPG both contributed to the analysis and interpretation of data and contributed to the writing of the manuscript. All authors have given final approval of this version to be published.</p>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>No financial support has been received for this study.</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>No financial support has been received for this study.</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Limpopo Province districts, including mean malaria incidence rates, 1998 – 1999 to 2004 – 2005 seasons.</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Malaria incidence rates per season, Limpopo Province, 1998 – 1999 to 2006 – 2007 seasons.</p></caption></fig>","<fig position=\"float\" id=\"F3\"><label>Figure 3</label><caption><p>Mean malaria incidence rates per age category, Limpopo Province, 1998 – 1999 to 2006 – 2007 seasons.</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p>Limpopo Province districts, including mean malaria incidence rates, 1998 – 1999 to 2004 – 2005 seasons.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p>Malaria incidence rates per season, Limpopo Province, 1998 – 1999 to 2006 – 2007 seasons.</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F3\\\"><label>Figure 3</label><caption><p>Mean malaria incidence rates per age category, Limpopo Province, 1998 – 1999 to 2006 – 2007 seasons.</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Incidence of malaria cases and deaths, Limpopo Province, 1998 – 1999 to 2006 – 2007 seasons</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Malaria season</td><td align=\"right\">No. of reported malaria cases</td><td align=\"right\">Total population</td><td align=\"right\">Incidence rate (per 100,000 person-years) (95% CI)</td><td align=\"right\">No. of reported malaria deaths</td><td align=\"right\">CFR (%)</td></tr></thead><tbody><tr><td align=\"left\">1998–1999</td><td align=\"right\">8,833</td><td align=\"right\">5,106,140</td><td align=\"right\">173.0 (169.4 – 176.6)</td><td align=\"right\">105</td><td align=\"right\">1.2</td></tr><tr><td align=\"left\">1999–2000</td><td align=\"right\">8,477</td><td align=\"right\">5,140,225</td><td align=\"right\">164.9 (161.4 – 168.4)</td><td align=\"right\">75</td><td align=\"right\">0.9</td></tr><tr><td align=\"left\">2000–2001</td><td align=\"right\">9,942</td><td align=\"right\">5,174,537</td><td align=\"right\">192.1 (188.4 – 195.9)</td><td align=\"right\">85</td><td align=\"right\">0.9</td></tr><tr><td align=\"left\">2001–2002</td><td align=\"right\">6,140</td><td align=\"right\">5,210,191</td><td align=\"right\">117.8 (114.9 – 120.8)</td><td align=\"right\">53</td><td align=\"right\">0.9</td></tr><tr><td align=\"left\">2002–2003</td><td align=\"right\">5,132</td><td align=\"right\">5,246,690</td><td align=\"right\">97.8 (95.1 – 100.5)</td><td align=\"right\">62</td><td align=\"right\">1.2</td></tr><tr><td align=\"left\">2003–2004</td><td align=\"right\">6,384</td><td align=\"right\">5,282,444</td><td align=\"right\">120.9 (117.9 – 123.8)</td><td align=\"right\">115</td><td align=\"right\">1.8</td></tr><tr><td align=\"left\">2004–2005</td><td align=\"right\">4,893</td><td align=\"right\">5,318,050</td><td align=\"right\">92.0 (89.4 – 94.6)</td><td align=\"right\">48</td><td align=\"right\">1.0</td></tr><tr><td align=\"left\">2005–2006</td><td align=\"right\">6,229</td><td align=\"right\">5,350,748</td><td align=\"right\">116.4 (113.5 – 119.3)</td><td align=\"right\">52</td><td align=\"right\">0.8</td></tr><tr><td align=\"left\">2006–2007</td><td align=\"right\">2,738</td><td align=\"right\">5,384,363</td><td align=\"right\">50.9 (48.9 – 52.8)</td><td align=\"right\">33</td><td align=\"right\">1.2</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T2\"><label>Table 2</label><caption><p>Mean incidence of malaria per age category, Limpopo Province, 1998 – 1999 to 2006 – 2007 seasons</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Age category (years)</td><td align=\"right\">Mean no. of reported malaria cases per season</td><td align=\"right\">Mean incidence rate (per 100,000 person-years) (95% CI)</td><td align=\"right\">Mean no. of reported malaria deaths per season</td><td align=\"right\">Mean CFR (%)</td></tr></thead><tbody><tr><td align=\"left\">0 – 4</td><td align=\"right\">524</td><td align=\"right\">78.3 (71.6 – 85.0)</td><td align=\"right\">2.6</td><td align=\"right\">0.5</td></tr><tr><td align=\"left\">5 – 9</td><td align=\"right\">713</td><td align=\"right\">99.4 (92.2 – 106.7)</td><td align=\"right\">1.3</td><td align=\"right\">0.2</td></tr><tr><td align=\"left\">10 – 14</td><td align=\"right\">834</td><td align=\"right\">116.7 (108.8 – 124.6)</td><td align=\"right\">2.6</td><td align=\"right\">0.3</td></tr><tr><td align=\"left\">15 – 19</td><td align=\"right\">873</td><td align=\"right\">133.2 (124.4 – 142.0)</td><td align=\"right\">4.0</td><td align=\"right\">0.5</td></tr><tr><td align=\"left\">20 – 24</td><td align=\"right\">758</td><td align=\"right\">150.8 (139.5 – 160.9)</td><td align=\"right\">4.9</td><td align=\"right\">0.6</td></tr><tr><td align=\"left\">25 – 29</td><td align=\"right\">588</td><td align=\"right\">148.2 (136.2 – 160.2)</td><td align=\"right\">6.6</td><td align=\"right\">1.1</td></tr><tr><td align=\"left\">30 – 34</td><td align=\"right\">513</td><td align=\"right\">171.5 (156.7 – 186.3)</td><td align=\"right\">7.7</td><td align=\"right\">1.5</td></tr><tr><td align=\"left\">35 – 39</td><td align=\"right\">424</td><td align=\"right\">172.8 (156.3 – 189.2)</td><td align=\"right\">5.9</td><td align=\"right\">1.4</td></tr><tr><td align=\"left\">40 – 44</td><td align=\"right\">337</td><td align=\"right\">160.3 (143.2 – 177.4)</td><td align=\"right\">5.3</td><td align=\"right\">1.6</td></tr><tr><td align=\"left\">45 – 49</td><td align=\"right\">261</td><td align=\"right\">141.6 (124.5 – 158.8)</td><td align=\"right\">7.9</td><td align=\"right\">3.0</td></tr><tr><td align=\"left\">50 – 54</td><td align=\"right\">212</td><td align=\"right\">136.7 (118.3 – 155.1)</td><td align=\"right\">4.8</td><td align=\"right\">2.2</td></tr><tr><td align=\"left\">55 – 59</td><td align=\"right\">137</td><td align=\"right\">111.0 (92.4 – 129.6)</td><td align=\"right\">3.9</td><td align=\"right\">2.8</td></tr><tr><td align=\"left\">≥ 60</td><td align=\"right\">320</td><td align=\"right\">84.4 (75.1 – 93.6)</td><td align=\"right\">12.1</td><td align=\"right\">3.8</td></tr></tbody></table></table-wrap>","<table-wrap position=\"float\" id=\"T3\"><label>Table 3</label><caption><p>Mean incidence of malaria per district, Limpopo Province, 1998 – 1999 to 2006 – 2005 seasons</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">District council</td><td align=\"right\">Mean no. of reported malaria cases per season</td><td align=\"right\">Mean incidence rate (per 100,000 person-years) (95% CI)</td><td align=\"right\">Mean no. of reported malaria deaths per season</td><td align=\"right\">Mean CFR (%)</td></tr></thead><tbody><tr><td align=\"left\">Bohlabela</td><td align=\"right\">966</td><td align=\"right\">161.6 (151.4 – 171.8)</td><td align=\"right\">11.6</td><td align=\"right\">1.2</td></tr><tr><td align=\"left\">Capricorn</td><td align=\"right\">67</td><td align=\"right\">5.8 (4.4 – 7.2)</td><td align=\"right\">2.3</td><td align=\"right\">3.4</td></tr><tr><td align=\"left\">Mopani</td><td align=\"right\">1901</td><td align=\"right\">197.1 (188.3 – 206.0)</td><td align=\"right\">19.1</td><td align=\"right\">1.0</td></tr><tr><td align=\"left\">Sekhukune</td><td align=\"right\">53</td><td align=\"right\">5.5 (4.0 – 7.0)</td><td align=\"right\">1.0</td><td align=\"right\">1.9</td></tr><tr><td align=\"left\">Vhembe</td><td align=\"right\">3938</td><td align=\"right\">328.2 (318.0 – 338.4)</td><td align=\"right\">42.2</td><td align=\"right\">1.1</td></tr><tr><td align=\"left\">Waterberg</td><td align=\"right\">190</td><td align=\"right\">30.9 (26.5 – 35.3)</td><td align=\"right\">1.1</td><td align=\"right\">0.6</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Incidence of malaria cases and deaths, Limpopo Province, 1998 – 1999 to 2006 – 2007 seasons</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\">Malaria season</td><td align=\\\"right\\\">No. of reported malaria cases</td><td align=\\\"right\\\">Total population</td><td align=\\\"right\\\">Incidence rate (per 100,000 person-years) (95% CI)</td><td align=\\\"right\\\">No. of reported malaria deaths</td><td align=\\\"right\\\">CFR (%)</td></tr></thead><tbody><tr><td align=\\\"left\\\">1998–1999</td><td align=\\\"right\\\">8,833</td><td align=\\\"right\\\">5,106,140</td><td align=\\\"right\\\">173.0 (169.4 – 176.6)</td><td align=\\\"right\\\">105</td><td align=\\\"right\\\">1.2</td></tr><tr><td align=\\\"left\\\">1999–2000</td><td align=\\\"right\\\">8,477</td><td align=\\\"right\\\">5,140,225</td><td align=\\\"right\\\">164.9 (161.4 – 168.4)</td><td align=\\\"right\\\">75</td><td align=\\\"right\\\">0.9</td></tr><tr><td align=\\\"left\\\">2000–2001</td><td align=\\\"right\\\">9,942</td><td align=\\\"right\\\">5,174,537</td><td align=\\\"right\\\">192.1 (188.4 – 195.9)</td><td align=\\\"right\\\">85</td><td align=\\\"right\\\">0.9</td></tr><tr><td align=\\\"left\\\">2001–2002</td><td align=\\\"right\\\">6,140</td><td align=\\\"right\\\">5,210,191</td><td align=\\\"right\\\">117.8 (114.9 – 120.8)</td><td align=\\\"right\\\">53</td><td align=\\\"right\\\">0.9</td></tr><tr><td align=\\\"left\\\">2002–2003</td><td align=\\\"right\\\">5,132</td><td align=\\\"right\\\">5,246,690</td><td align=\\\"right\\\">97.8 (95.1 – 100.5)</td><td align=\\\"right\\\">62</td><td align=\\\"right\\\">1.2</td></tr><tr><td align=\\\"left\\\">2003–2004</td><td align=\\\"right\\\">6,384</td><td align=\\\"right\\\">5,282,444</td><td align=\\\"right\\\">120.9 (117.9 – 123.8)</td><td align=\\\"right\\\">115</td><td align=\\\"right\\\">1.8</td></tr><tr><td align=\\\"left\\\">2004–2005</td><td align=\\\"right\\\">4,893</td><td align=\\\"right\\\">5,318,050</td><td align=\\\"right\\\">92.0 (89.4 – 94.6)</td><td align=\\\"right\\\">48</td><td align=\\\"right\\\">1.0</td></tr><tr><td align=\\\"left\\\">2005–2006</td><td align=\\\"right\\\">6,229</td><td align=\\\"right\\\">5,350,748</td><td align=\\\"right\\\">116.4 (113.5 – 119.3)</td><td align=\\\"right\\\">52</td><td align=\\\"right\\\">0.8</td></tr><tr><td align=\\\"left\\\">2006–2007</td><td align=\\\"right\\\">2,738</td><td align=\\\"right\\\">5,384,363</td><td align=\\\"right\\\">50.9 (48.9 – 52.8)</td><td align=\\\"right\\\">33</td><td align=\\\"right\\\">1.2</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T2\\\"><label>Table 2</label><caption><p>Mean incidence of malaria per age category, Limpopo Province, 1998 – 1999 to 2006 – 2007 seasons</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\">Age category (years)</td><td align=\\\"right\\\">Mean no. of reported malaria cases per season</td><td align=\\\"right\\\">Mean incidence rate (per 100,000 person-years) (95% CI)</td><td align=\\\"right\\\">Mean no. of reported malaria deaths per season</td><td align=\\\"right\\\">Mean CFR (%)</td></tr></thead><tbody><tr><td align=\\\"left\\\">0 – 4</td><td align=\\\"right\\\">524</td><td align=\\\"right\\\">78.3 (71.6 – 85.0)</td><td align=\\\"right\\\">2.6</td><td align=\\\"right\\\">0.5</td></tr><tr><td align=\\\"left\\\">5 – 9</td><td align=\\\"right\\\">713</td><td align=\\\"right\\\">99.4 (92.2 – 106.7)</td><td align=\\\"right\\\">1.3</td><td align=\\\"right\\\">0.2</td></tr><tr><td align=\\\"left\\\">10 – 14</td><td align=\\\"right\\\">834</td><td align=\\\"right\\\">116.7 (108.8 – 124.6)</td><td align=\\\"right\\\">2.6</td><td align=\\\"right\\\">0.3</td></tr><tr><td align=\\\"left\\\">15 – 19</td><td align=\\\"right\\\">873</td><td align=\\\"right\\\">133.2 (124.4 – 142.0)</td><td align=\\\"right\\\">4.0</td><td align=\\\"right\\\">0.5</td></tr><tr><td align=\\\"left\\\">20 – 24</td><td align=\\\"right\\\">758</td><td align=\\\"right\\\">150.8 (139.5 – 160.9)</td><td align=\\\"right\\\">4.9</td><td align=\\\"right\\\">0.6</td></tr><tr><td align=\\\"left\\\">25 – 29</td><td align=\\\"right\\\">588</td><td align=\\\"right\\\">148.2 (136.2 – 160.2)</td><td align=\\\"right\\\">6.6</td><td align=\\\"right\\\">1.1</td></tr><tr><td align=\\\"left\\\">30 – 34</td><td align=\\\"right\\\">513</td><td align=\\\"right\\\">171.5 (156.7 – 186.3)</td><td align=\\\"right\\\">7.7</td><td align=\\\"right\\\">1.5</td></tr><tr><td align=\\\"left\\\">35 – 39</td><td align=\\\"right\\\">424</td><td align=\\\"right\\\">172.8 (156.3 – 189.2)</td><td align=\\\"right\\\">5.9</td><td align=\\\"right\\\">1.4</td></tr><tr><td align=\\\"left\\\">40 – 44</td><td align=\\\"right\\\">337</td><td align=\\\"right\\\">160.3 (143.2 – 177.4)</td><td align=\\\"right\\\">5.3</td><td align=\\\"right\\\">1.6</td></tr><tr><td align=\\\"left\\\">45 – 49</td><td align=\\\"right\\\">261</td><td align=\\\"right\\\">141.6 (124.5 – 158.8)</td><td align=\\\"right\\\">7.9</td><td align=\\\"right\\\">3.0</td></tr><tr><td align=\\\"left\\\">50 – 54</td><td align=\\\"right\\\">212</td><td align=\\\"right\\\">136.7 (118.3 – 155.1)</td><td align=\\\"right\\\">4.8</td><td align=\\\"right\\\">2.2</td></tr><tr><td align=\\\"left\\\">55 – 59</td><td align=\\\"right\\\">137</td><td align=\\\"right\\\">111.0 (92.4 – 129.6)</td><td align=\\\"right\\\">3.9</td><td align=\\\"right\\\">2.8</td></tr><tr><td align=\\\"left\\\">≥ 60</td><td align=\\\"right\\\">320</td><td align=\\\"right\\\">84.4 (75.1 – 93.6)</td><td align=\\\"right\\\">12.1</td><td align=\\\"right\\\">3.8</td></tr></tbody></table></table-wrap>\",\n \"<table-wrap position=\\\"float\\\" id=\\\"T3\\\"><label>Table 3</label><caption><p>Mean incidence of malaria per district, Limpopo Province, 1998 – 1999 to 2006 – 2005 seasons</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\">District council</td><td align=\\\"right\\\">Mean no. of reported malaria cases per season</td><td align=\\\"right\\\">Mean incidence rate (per 100,000 person-years) (95% CI)</td><td align=\\\"right\\\">Mean no. of reported malaria deaths per season</td><td align=\\\"right\\\">Mean CFR (%)</td></tr></thead><tbody><tr><td align=\\\"left\\\">Bohlabela</td><td align=\\\"right\\\">966</td><td align=\\\"right\\\">161.6 (151.4 – 171.8)</td><td align=\\\"right\\\">11.6</td><td align=\\\"right\\\">1.2</td></tr><tr><td align=\\\"left\\\">Capricorn</td><td align=\\\"right\\\">67</td><td align=\\\"right\\\">5.8 (4.4 – 7.2)</td><td align=\\\"right\\\">2.3</td><td align=\\\"right\\\">3.4</td></tr><tr><td align=\\\"left\\\">Mopani</td><td align=\\\"right\\\">1901</td><td align=\\\"right\\\">197.1 (188.3 – 206.0)</td><td align=\\\"right\\\">19.1</td><td align=\\\"right\\\">1.0</td></tr><tr><td align=\\\"left\\\">Sekhukune</td><td align=\\\"right\\\">53</td><td align=\\\"right\\\">5.5 (4.0 – 7.0)</td><td align=\\\"right\\\">1.0</td><td align=\\\"right\\\">1.9</td></tr><tr><td align=\\\"left\\\">Vhembe</td><td align=\\\"right\\\">3938</td><td align=\\\"right\\\">328.2 (318.0 – 338.4)</td><td align=\\\"right\\\">42.2</td><td align=\\\"right\\\">1.1</td></tr><tr><td align=\\\"left\\\">Waterberg</td><td align=\\\"right\\\">190</td><td align=\\\"right\\\">30.9 (26.5 – 35.3)</td><td align=\\\"right\\\">1.1</td><td align=\\\"right\\\">0.6</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1475-2875-7-162-1\"/>","<graphic xlink:href=\"1475-2875-7-162-2\"/>","<graphic xlink:href=\"1475-2875-7-162-3\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1475-2875-7-162-1\\\"/>\",\n \"<graphic xlink:href=\\\"1475-2875-7-162-2\\\"/>\",\n \"<graphic xlink:href=\\\"1475-2875-7-162-3\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"article-title\": [\"Malaria cases per year.\"], \"year\": [\"2008\"]}, {\"article-title\": [\"Health Statistics.\"], \"year\": [\"2008\"]}, {\"article-title\": [\"Malaria treatment guidelines [final draft 05 December 2007].\"], \"year\": [\"2008\"]}, {\"surname\": [\"Sharp\", \"Ngxongo\", \"Botha\", \"Ridl\", \"Le Sueur\"], \"given-names\": [\"BL\", \"S\", \"MJ\", \"FC\", \"D\"], \"article-title\": [\"An analysis of 10 years of retrospective malaria data from the KwaZulu areas of Natal\"], \"source\": [\"S Afri J Sci\"], \"year\": [\"1988\"], \"volume\": [\"84\"], \"fpage\": [\"102\"], \"lpage\": [\"106\"]}, {\"article-title\": [\"Malaria research lead programme - Current projects.\"], \"year\": [\"2008\"]}, {\"surname\": [\"Govere\", \"Durrheim\", \"Kunene\"], \"given-names\": [\"JM\", \"DN\", \"S\"], \"article-title\": [\"Malaria trends in South Africa and Swaziland and the introduction of synthetic pyrethroids to replace DDT for malaria vector control\"], \"source\": [\"S Afri J Sci\"], \"year\": [\"2002\"], \"volume\": [\"98\"], \"fpage\": [\"19\"], \"lpage\": [\"21\"]}, {\"article-title\": [\"Cross-boundary municipalities laws repeal and related matters act.\"], \"source\": [\"Government Gazette (No 28363)\"], \"year\": [\"2005\"]}, {\"article-title\": [\"Mid-year populations estimates by province, gender, age group and sex.\"], \"year\": [\"2008\"]}, {\"article-title\": [\"Table: Census 2001 by district council, sex, age and population group.\"], \"year\": [\"2008\"]}, {\"source\": [\"Guidelines for the treatment of malaria\"], \"year\": [\"2006\"], \"publisher-name\": [\"Geneva, World Health Organization\"]}, {\"surname\": [\"Korenromp\"], \"given-names\": [\"E\"], \"article-title\": [\"Malaria incidence estimates at country level for the year 2004 - proposed estimates and draft report.\"], \"year\": [\"2008\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":28,"string":"28"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:38"},"citation":{"kind":"string","value":"Malar J. 2008 Aug 25; 7:162"},"package_file":{"kind":"string","value":"oa_package/6c/85/PMC2538535.tar.gz"}}},{"rowIdx":119698,"cells":{"accession_id":{"kind":"string","value":"PMC2538536"},"pmid":{"kind":"string","value":"18761741"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>The study of the health consequences of heavy alcohol consumption has a long research tradition: the first investigations of risk were undertaken in the early 19<sup>th </sup>century by life assurance companies who calibrated their premiums according to the alcohol consumption of policy holders [##UREF##0##1##]. Subsequently, more detailed studies have reported \"U\"- or \"J\"-shaped associations between alcohol intake and both all-cause and coronary heart disease mortality [##REF##8286995##2##]. That is, while abstainers and heavy consumers experience elevated risk, moderate drinkers do not.</p>","<p>Based on these data, and in keeping with other health behaviours such as dietary intake [##REF##10186666##3##] and physical activity [##REF##17671237##4##], guidance on appropriate alcohol intake has been widely disseminated. Present recommendations for 'sensible' weekly consumption (up to 21 units in men and 14 units in women) were first advanced by the <italic>Royal College of Physicians </italic>[##UREF##1##5##] over two decades ago and subsequently endorsed by other health agencies leading to official adoption by the UK government [##UREF##2##6##] and those of many other nations. There is growing empirical evidence that drinking above and beyond these weekly limits has a detrimental impact on health and that, more specifically, exceeding a recently proposed daily benchmark of 4 units (men) and 3 units (women) carries \"....an increasingly significant risk of illness and death from a number of conditions.....\" [##UREF##3##7##]. A negative impact on non-health outcomes, such as family breakdown and financial hardship, has also been suggested [##UREF##4##8##], and has received some support in the few population-based studies conducted [##REF##7773113##9##].</p>","<p>With over half of the adult population of England reporting alcohol consumption in excess of the new daily guidelines [##UREF##5##10##], the health and social impact of modifying intake on a population level is potentially considerable. However, if public health interventions are to be successfully implemented it is crucial to identify the predictors of such behaviours. A recent review proposed a series of risk factors for heavy drinking, including a lack of awareness about the potential harms, use of other substances, drinking as a coping strategy, and poor family relations [##REF##15087148##11##]. Some of these risk indices correlate with socioeconomic position, which, with few exceptions [##REF##16167504##12##], reveals strong relationships with binge drinking, although the magnitude and direction of this gradient tends to vary by gender [##REF##10665075##13##] and particularly country [##REF##17030500##14##, ####REF##17850645##15##, ##REF##17854484##16####17854484##16##].</p>","<p>While understanding of the socioeconomic variations in binge drinking is growing and informative, there remain important gaps. First, there are relatively few general population-based studies: many investigators utilise occupational cohorts [##REF##17935583##17##, ####REF##9351149##18##, ##REF##11968516##19##, ##REF##8461854##20####8461854##20##] which have narrow socioeconomic variation which may lead to associations with alcohol intake being underestimated. Second, there has been a recent revitalisation of interest in life course predictors of chronic disease such as ischaemic heart disease, cancer, and psychiatric illness. While the role of behavioural processes underlying these relationships – particularly smoking – has also been well examined [##UREF##6##21##,##REF##15760279##22##], with the exception of two studies [##REF##17074968##23##,##REF##16973534##24##], little is known about life course predictors of heavy drinking, in particular exceeding the afore-described guidelines for 'sensible' alcohol consumption. Evidence for a strong influence of pre-adult social factors on later heavy drinking would point to the need for intervention earlier in life than is currently the case. In a study of Finnish middle-aged men, unfavourable levels of a range of life course markers of socioeconomic position, particularly those from adult life, were predictive of binge drinking [##REF##17074968##23##]. Similar results were apparent in a Scottish cohort which used self-reported hangovers as a proxy for heavy alcohol use [##REF##16973534##24##]. However, both studies were characterised by crude indicators of alcohol intake and complex data interpretation, such that a direct comparison between early and later life influences on binge drinking was problematic given the differing coding structure for each predictor variable.</p>","<p>Using data from the West of Scotland Twenty-07 study, we are able to address several of these shortcomings: participants completed a detailed seven day recall of alcohol intake; we utilised the relative index of inequality which facilitates a direct comparison of the relative strength of the association of different markers of socioeconomic disadvantage at different stages of the life course with the risk of exceeding existing guidelines for sensible weekly and daily alcohol intake; and a wider range of socioeconomic indices was collected than has previously been the case. Additionally, for the first time, we report on life course socioeconomic inequalities in drinking problems, as ascertained by validated questionnaire, which in itself is associated with elevated mortality risk [##REF##11964106##25##].</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>The study of the health consequences of heavy alcohol consumption has a long research tradition: the first investigations of risk were undertaken in the early 19<sup>th </sup>century by life assurance companies who calibrated their premiums according to the alcohol consumption of policy holders [##UREF##0##1##]. Subsequently, more detailed studies have reported \\\"U\\\"- or \\\"J\\\"-shaped associations between alcohol intake and both all-cause and coronary heart disease mortality [##REF##8286995##2##]. That is, while abstainers and heavy consumers experience elevated risk, moderate drinkers do not.</p>\",\n \"<p>Based on these data, and in keeping with other health behaviours such as dietary intake [##REF##10186666##3##] and physical activity [##REF##17671237##4##], guidance on appropriate alcohol intake has been widely disseminated. Present recommendations for 'sensible' weekly consumption (up to 21 units in men and 14 units in women) were first advanced by the <italic>Royal College of Physicians </italic>[##UREF##1##5##] over two decades ago and subsequently endorsed by other health agencies leading to official adoption by the UK government [##UREF##2##6##] and those of many other nations. There is growing empirical evidence that drinking above and beyond these weekly limits has a detrimental impact on health and that, more specifically, exceeding a recently proposed daily benchmark of 4 units (men) and 3 units (women) carries \\\"....an increasingly significant risk of illness and death from a number of conditions.....\\\" [##UREF##3##7##]. A negative impact on non-health outcomes, such as family breakdown and financial hardship, has also been suggested [##UREF##4##8##], and has received some support in the few population-based studies conducted [##REF##7773113##9##].</p>\",\n \"<p>With over half of the adult population of England reporting alcohol consumption in excess of the new daily guidelines [##UREF##5##10##], the health and social impact of modifying intake on a population level is potentially considerable. However, if public health interventions are to be successfully implemented it is crucial to identify the predictors of such behaviours. A recent review proposed a series of risk factors for heavy drinking, including a lack of awareness about the potential harms, use of other substances, drinking as a coping strategy, and poor family relations [##REF##15087148##11##]. Some of these risk indices correlate with socioeconomic position, which, with few exceptions [##REF##16167504##12##], reveals strong relationships with binge drinking, although the magnitude and direction of this gradient tends to vary by gender [##REF##10665075##13##] and particularly country [##REF##17030500##14##, ####REF##17850645##15##, ##REF##17854484##16####17854484##16##].</p>\",\n \"<p>While understanding of the socioeconomic variations in binge drinking is growing and informative, there remain important gaps. First, there are relatively few general population-based studies: many investigators utilise occupational cohorts [##REF##17935583##17##, ####REF##9351149##18##, ##REF##11968516##19##, ##REF##8461854##20####8461854##20##] which have narrow socioeconomic variation which may lead to associations with alcohol intake being underestimated. Second, there has been a recent revitalisation of interest in life course predictors of chronic disease such as ischaemic heart disease, cancer, and psychiatric illness. While the role of behavioural processes underlying these relationships – particularly smoking – has also been well examined [##UREF##6##21##,##REF##15760279##22##], with the exception of two studies [##REF##17074968##23##,##REF##16973534##24##], little is known about life course predictors of heavy drinking, in particular exceeding the afore-described guidelines for 'sensible' alcohol consumption. Evidence for a strong influence of pre-adult social factors on later heavy drinking would point to the need for intervention earlier in life than is currently the case. In a study of Finnish middle-aged men, unfavourable levels of a range of life course markers of socioeconomic position, particularly those from adult life, were predictive of binge drinking [##REF##17074968##23##]. Similar results were apparent in a Scottish cohort which used self-reported hangovers as a proxy for heavy alcohol use [##REF##16973534##24##]. However, both studies were characterised by crude indicators of alcohol intake and complex data interpretation, such that a direct comparison between early and later life influences on binge drinking was problematic given the differing coding structure for each predictor variable.</p>\",\n \"<p>Using data from the West of Scotland Twenty-07 study, we are able to address several of these shortcomings: participants completed a detailed seven day recall of alcohol intake; we utilised the relative index of inequality which facilitates a direct comparison of the relative strength of the association of different markers of socioeconomic disadvantage at different stages of the life course with the risk of exceeding existing guidelines for sensible weekly and daily alcohol intake; and a wider range of socioeconomic indices was collected than has previously been the case. Additionally, for the first time, we report on life course socioeconomic inequalities in drinking problems, as ascertained by validated questionnaire, which in itself is associated with elevated mortality risk [##REF##11964106##25##].</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<p>Study participants are from the <italic>West of Scotland Twenty-07 Study</italic>, a population-sampled cohort designed to investigate the influence of social factors on health. Ethics committee approval for the Twenty-07 study was granted by the General Practice Subcommittee of the Greater Glasgow Health Board Area Medical Committee, and the West of Scotland General Practice Ethical Committee.</p>","<p>The design and sampling have been described in detail elsewhere [##REF##7809657##26##,##UREF##7##27##]. In brief, the Twenty-07 study comprises three cohorts recruited at around age 15, 35, and 55 years in 1987/8. Our analyses are based on the oldest age group who, in wave one, took part in two interviews in the study participant's home, one enquiring about social circumstances, and another with a nurse about health-related factors (N [proportion of target sample]: 851 [88%] in women; 700 [88%] in men). In wave 2 (1990/2; age around 59 years), attempts were made to re-interview these men and women about their alcohol drinking habits and any related problems. Again, response was high (681 [83%] in women; 578 [87%] in men).</p>","<title>Assessment of life course socioeconomic position</title>","<p>Early socioeconomic circumstances were based on four indices. Paternal occupational social class was coded into one of six categories according to the Registrar General's schema [##UREF##8##28##]. Family structure was denoted by the presence of both biological parents at age 15 years. Respondents also reported their number of siblings, and age at leaving school (range: 12–19 years). Assessment of adult socioeconomic circumstances is based on seven indices. Occupational social class was coded as above. To categorise their employment status, study participants identified themselves as: retired, disabled/invalid, caring for the home/housewife, in education, unemployed (no paid work) or employed/worker/self employed. Income was based on total household earnings after tax, including any benefits; respondents were asked to specify an actual amount in pounds sterling per week, month or year, or, if they were unwilling to do so, to identify an appropriate income band on a preprinted card. Housing tenure was categorised as privately owned or other (council, privately rented [unfurnished], privately rented [furnished], tied to job). Household crowding was calculated by dividing the number of people in the household by the number of rooms; respondents were then assigned to a quartile of the distribution, with the highest quartile representing most overcrowding. Study participants also indicated whether or not they owned a car or van. Finally, for marital status, subjects responded to a series of enquiries which allowed them to be categorised into one of three groups: married, no longer married (separated, widowed, divorced), or never married (single).</p>","<title>Assessment of alcohol consumption and problem drinking</title>","<p>Study participants provided a recall of their alcohol consumption over each of the seven days preceding the interview, reporting separately for five categories of alcohol type: beer (including lager and cider), wine, fortified wine, spirits, and 'other' (e.g., 'alcopops'). Responses were expressed in units which represent 8 grams of pure alcohol, equivalent to half a pint of ordinary beer, lager, or cider, a small glass of wine, or a single measure of spirits. For weekly alcohol intake, data were totalled and respondents were dichotomised on the basis of whether or not they exceeded the recommendations for sensible weekly intake (21 units for men, 14 units for women) [##UREF##1##5##]. For daily intake, the number of days in the preceding seven on which a study participant exceeded 4 units (men) and 3 units (women) [##UREF##3##7##] was computed; respondents who had exceeded these guidelines on at least one day in the previous week were classed as 'heavy daily' drinkers. Both alcohol outcomes were categorised into whether or not they surpassed these limits (referred to here as \"heavy weekly\" or \"heavy daily\" drinkers).</p>","<p>All participants, with the exception of those who indicated they were lifelong non-drinkers, were asked to complete the CAGE questionnaire [##REF##6471323##29##,##REF##4416585##30##]. CAGE is an acronym based on the four questions that comprise the inventory: Have you ever felt you ought to <italic>cut down </italic>on drinking? Have people <italic>annoyed </italic>you by criticizing your drinking? Have you ever felt bad or <italic>guilty </italic>about your drinking? Have you ever had a drink first thing in the morning (<italic>eye-opener</italic>) to steady your hands? These items were used to create a simple drinking problem scale, with each positive response given a score of one; a higher score indicates the presence of an alcohol problem. A total CAGE score of 2 or more is considered clinically significant and this was used in the present analyses. While the CAGE does not provide standard Diagnostic and Statistical Manual diagnosis of alcohol dependence, a positive response on two or more questions indicates a high likelihood of the presence of problematic drinking [##REF##4416585##30##].</p>","<title>Statistical analyses</title>","<p>Based on these definitions of alcohol intake and problem drinking, preliminary analyses indicated there were too few women who could be classified as cases in order to facilitate analyses; we therefore focused on data from men only. We examined the relation of both early and later life socioeconomic position with these drinking outcomes using logistic regression modelling. Initially, our analyses were unadjusted, producing bivariate odds ratios. To explore linearity – an assumption inherent in the uses of the relative index of inequality (RII; see below) – we added a quadratic term to the model for each of the socioeconomic exposures variables when examining their relation with the three alcohol outcomes. As it was only possible to test for linearity for those predictor variables with three or more categories, we did not run the analyses for the dichotomously coded family structure, employment status, housing tenure and car ownership. The six remaining variables and three alcohol outcomes therefore resulted in 18 exposure-outcome permutations. Of these, in only one (housing crowding) did the quadratic term attain statistical significance at conventional levels. As this exceptional result is likely to be a chance finding, the linearity assumption can be regarded as not having been violated. Next, as we have done before [##REF##16452104##31##], we calculated a RII to quantify the association of early and adult life exposures with drinking outcomes. Using the RII facilitates a comparison of effect estimates across a diverse range of indices of socio-economic position. Markers of socioeconomic position were recoded where necessary so that high values reflected disadvantage. The RII was then derived by ranking the participants on each of the socioeconomic measures. For the discrete measures, and in the case of ties for continuous measures, we assigned the mean rank. We then divided these rank scores by the sample size to yield a value between 0 and 1. For the purposes of interpretation, the RII should be regarded as the relative risk of exceeding the stated guidelines or problem drinking in the most disadvantaged group relative to the most advantaged. Its interpretation is the same as a relative risk ratio. Again, logistic regression was used to calculate a RII (odds ratio). The RII is known to elevate effect estimates, especially in variables with only two categories. However, because we used the RII solely as a comparison of the relation of the alcohol outcomes with socioeconomic variables which had different coding structures, our interest did not lie in the absolute size of these relationships.</p>","<p>We then calculated a lifetime composite score for socioeconomic adversity. To do so, we dichotomised all the explanatory variables (0, 1) so that experience of disadvantage on any measure contributed a single point to the score. Explanatory variables were dichotomised at the following demarcation points (for the categories implicitly classified as '0', see Additional file ##SUPPL##0##1##): father's and own social class (1 = partly skilled manual, unskilled manual); family structure (1 = circumstance other than having two biological parents in the family at age 15 years); education (1 = left school age 12–14 years); employment status (1 = all other categories but employed [i.e., retired, disabled/ill, caring for the home, in education, unemployed]); income (1 = lowest quartile); housing tenure (1 = all other categories except privately owned house [i.e., council, rent, job-related, other]); household crowding (1 = most overcrowded quartile); car ownership (1 = no); and marital status (1 = single).</p>","<p>Three indices were then created (early life socioeconomic position, range: 0–3; adult socioeconomic position, range: 0–7; life course socioeconomic position, range: 0–10). Again, a higher score indicated greater adversity. Each index was then assigned a RII using the procedure described above. Throughout all these analyses, the analytical sample varies slightly (range: 521–576) depending on missing data for the socioeconomic predictor of interest.</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<p>Study participants are from the <italic>West of Scotland Twenty-07 Study</italic>, a population-sampled cohort designed to investigate the influence of social factors on health. Ethics committee approval for the Twenty-07 study was granted by the General Practice Subcommittee of the Greater Glasgow Health Board Area Medical Committee, and the West of Scotland General Practice Ethical Committee.</p>\",\n \"<p>The design and sampling have been described in detail elsewhere [##REF##7809657##26##,##UREF##7##27##]. In brief, the Twenty-07 study comprises three cohorts recruited at around age 15, 35, and 55 years in 1987/8. Our analyses are based on the oldest age group who, in wave one, took part in two interviews in the study participant's home, one enquiring about social circumstances, and another with a nurse about health-related factors (N [proportion of target sample]: 851 [88%] in women; 700 [88%] in men). In wave 2 (1990/2; age around 59 years), attempts were made to re-interview these men and women about their alcohol drinking habits and any related problems. Again, response was high (681 [83%] in women; 578 [87%] in men).</p>\",\n \"<title>Assessment of life course socioeconomic position</title>\",\n \"<p>Early socioeconomic circumstances were based on four indices. Paternal occupational social class was coded into one of six categories according to the Registrar General's schema [##UREF##8##28##]. Family structure was denoted by the presence of both biological parents at age 15 years. Respondents also reported their number of siblings, and age at leaving school (range: 12–19 years). Assessment of adult socioeconomic circumstances is based on seven indices. Occupational social class was coded as above. To categorise their employment status, study participants identified themselves as: retired, disabled/invalid, caring for the home/housewife, in education, unemployed (no paid work) or employed/worker/self employed. Income was based on total household earnings after tax, including any benefits; respondents were asked to specify an actual amount in pounds sterling per week, month or year, or, if they were unwilling to do so, to identify an appropriate income band on a preprinted card. Housing tenure was categorised as privately owned or other (council, privately rented [unfurnished], privately rented [furnished], tied to job). Household crowding was calculated by dividing the number of people in the household by the number of rooms; respondents were then assigned to a quartile of the distribution, with the highest quartile representing most overcrowding. Study participants also indicated whether or not they owned a car or van. Finally, for marital status, subjects responded to a series of enquiries which allowed them to be categorised into one of three groups: married, no longer married (separated, widowed, divorced), or never married (single).</p>\",\n \"<title>Assessment of alcohol consumption and problem drinking</title>\",\n \"<p>Study participants provided a recall of their alcohol consumption over each of the seven days preceding the interview, reporting separately for five categories of alcohol type: beer (including lager and cider), wine, fortified wine, spirits, and 'other' (e.g., 'alcopops'). Responses were expressed in units which represent 8 grams of pure alcohol, equivalent to half a pint of ordinary beer, lager, or cider, a small glass of wine, or a single measure of spirits. For weekly alcohol intake, data were totalled and respondents were dichotomised on the basis of whether or not they exceeded the recommendations for sensible weekly intake (21 units for men, 14 units for women) [##UREF##1##5##]. For daily intake, the number of days in the preceding seven on which a study participant exceeded 4 units (men) and 3 units (women) [##UREF##3##7##] was computed; respondents who had exceeded these guidelines on at least one day in the previous week were classed as 'heavy daily' drinkers. Both alcohol outcomes were categorised into whether or not they surpassed these limits (referred to here as \\\"heavy weekly\\\" or \\\"heavy daily\\\" drinkers).</p>\",\n \"<p>All participants, with the exception of those who indicated they were lifelong non-drinkers, were asked to complete the CAGE questionnaire [##REF##6471323##29##,##REF##4416585##30##]. CAGE is an acronym based on the four questions that comprise the inventory: Have you ever felt you ought to <italic>cut down </italic>on drinking? Have people <italic>annoyed </italic>you by criticizing your drinking? Have you ever felt bad or <italic>guilty </italic>about your drinking? Have you ever had a drink first thing in the morning (<italic>eye-opener</italic>) to steady your hands? These items were used to create a simple drinking problem scale, with each positive response given a score of one; a higher score indicates the presence of an alcohol problem. A total CAGE score of 2 or more is considered clinically significant and this was used in the present analyses. While the CAGE does not provide standard Diagnostic and Statistical Manual diagnosis of alcohol dependence, a positive response on two or more questions indicates a high likelihood of the presence of problematic drinking [##REF##4416585##30##].</p>\",\n \"<title>Statistical analyses</title>\",\n \"<p>Based on these definitions of alcohol intake and problem drinking, preliminary analyses indicated there were too few women who could be classified as cases in order to facilitate analyses; we therefore focused on data from men only. We examined the relation of both early and later life socioeconomic position with these drinking outcomes using logistic regression modelling. Initially, our analyses were unadjusted, producing bivariate odds ratios. To explore linearity – an assumption inherent in the uses of the relative index of inequality (RII; see below) – we added a quadratic term to the model for each of the socioeconomic exposures variables when examining their relation with the three alcohol outcomes. As it was only possible to test for linearity for those predictor variables with three or more categories, we did not run the analyses for the dichotomously coded family structure, employment status, housing tenure and car ownership. The six remaining variables and three alcohol outcomes therefore resulted in 18 exposure-outcome permutations. Of these, in only one (housing crowding) did the quadratic term attain statistical significance at conventional levels. As this exceptional result is likely to be a chance finding, the linearity assumption can be regarded as not having been violated. Next, as we have done before [##REF##16452104##31##], we calculated a RII to quantify the association of early and adult life exposures with drinking outcomes. Using the RII facilitates a comparison of effect estimates across a diverse range of indices of socio-economic position. Markers of socioeconomic position were recoded where necessary so that high values reflected disadvantage. The RII was then derived by ranking the participants on each of the socioeconomic measures. For the discrete measures, and in the case of ties for continuous measures, we assigned the mean rank. We then divided these rank scores by the sample size to yield a value between 0 and 1. For the purposes of interpretation, the RII should be regarded as the relative risk of exceeding the stated guidelines or problem drinking in the most disadvantaged group relative to the most advantaged. Its interpretation is the same as a relative risk ratio. Again, logistic regression was used to calculate a RII (odds ratio). The RII is known to elevate effect estimates, especially in variables with only two categories. However, because we used the RII solely as a comparison of the relation of the alcohol outcomes with socioeconomic variables which had different coding structures, our interest did not lie in the absolute size of these relationships.</p>\",\n \"<p>We then calculated a lifetime composite score for socioeconomic adversity. To do so, we dichotomised all the explanatory variables (0, 1) so that experience of disadvantage on any measure contributed a single point to the score. Explanatory variables were dichotomised at the following demarcation points (for the categories implicitly classified as '0', see Additional file ##SUPPL##0##1##): father's and own social class (1 = partly skilled manual, unskilled manual); family structure (1 = circumstance other than having two biological parents in the family at age 15 years); education (1 = left school age 12–14 years); employment status (1 = all other categories but employed [i.e., retired, disabled/ill, caring for the home, in education, unemployed]); income (1 = lowest quartile); housing tenure (1 = all other categories except privately owned house [i.e., council, rent, job-related, other]); household crowding (1 = most overcrowded quartile); car ownership (1 = no); and marital status (1 = single).</p>\",\n \"<p>Three indices were then created (early life socioeconomic position, range: 0–3; adult socioeconomic position, range: 0–7; life course socioeconomic position, range: 0–10). Again, a higher score indicated greater adversity. Each index was then assigned a RII using the procedure described above. Throughout all these analyses, the analytical sample varies slightly (range: 521–576) depending on missing data for the socioeconomic predictor of interest.</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<p>Of men with complete data on alcohol consumption (N = 576) and a response to enquiries about problem drinking (N = 578), 20.8% (N = 120) exceeded weekly and 44.6% (N = 258) daily guidelines for sensible consumption; 14.9% (N = 86) were categorised as having alcohol-related drinking problems. There was some overlap of cases according to each of the three alcohol outcomes. Thus, based on men with complete data on all alcohol outcomes (N = 576), of those who reported exceeding 'sensible' weekly intake of 21 units, 45% of these indicated that they consumed 4 units on one or more days per week. For the 'problem' drinking men in this cohort, 52% exceeded the weekly limit, while a predictably higher proportion (78%) surpassed the daily guidelines.</p>","<p>In Additional file ##SUPPL##0##1## we present the relation of early life indicators of socioeconomic position with the three alcohol outcomes. There was a suggestion that study participants whose fathers were in more manual social classes reported an increased prevalence of heavy weekly drinking with an incremental effect seen across the occupational categories (p[trend] = 0.057). However, parental occupational social class was unrelated to either heavy daily or problem drinking at conventional levels of statistical significance. Conversely, both heavy daily alcohol consumption and problem drinking – but not heavy weekly intake – were positively related to number of siblings. While the confidence intervals for these effects contained unity, there was again some evidence of dose-response relations across the socioeconomic categories, particularly for problem drinking (p[trend] = 0.043). Education was related to all three alcohol outcomes, such that leaving school at 14 years of age or earlier conferred an elevated risk. Family structure was not related to any of the drinking outcomes in these analyses.</p>","<p>Additional file ##SUPPL##1##2## shows the association between adult indices of socioeconomic position and the alcohol outcomes. Lower occupational social class in adulthood was related to an increased prevalence of heavy weekly (p[trend] = 0.045) and heavy daily alcohol intake (p[trend] = 0.003), and also to problem drinking (p[trend] = 0.004). Similarly, income revealed an inverse association with the alcohol outcomes. Men not living in privately owned accommodation, and men who reported not owning a car, were also more likely to surpass both weekly and daily drinking guidelines and to be categorised as having drinking problems. Although no substantial or consistent relationships were seen with employment status or marital status, there was a suggestion that single men and those not in employment exhibited less favourable drinking patterns than married and employed men, respectively. The relationship between household crowding and alcohol consumption was inconsistent.</p>","<p>Next, in order to compare the relative strengths of each index of socioeconomic position with the alcohol outcomes, we computed a RII. Additional file ##SUPPL##2##3## presents early and later life socioeconomic predictors of heavy weekly drinking in ascending order of magnitude. Comparing disadvantaged men with advantaged, the strongest early life risk factor for heavy weekly drinking was a younger age at leaving school, while the weakest was family structure. In adult life, the strongest predictors were car ownership, housing tenure and current occupational social class; while the weakest were housing crowding and marital status. Confidence intervals were wide in some of these analyses. Similar patterns of association were apparent when heavy daily intake and problem drinking were the outcomes of interest.</p>","<p>Finally, again using the RII, we computed accumulative indices of socioeconomic adversity for early life, adult life and the life course and related these to each of the three alcohol outcomes (Additional file ##SUPPL##3##4##). Both early and adult life socioeconomic deprivation were associated with an increased risk of exceeding weekly and daily guidelines for sensible alcohol intake and for problem drinking. Total adult disadvantage was also related to each of the three alcohol outcomes. In comparison to childhood markers of deprivation, the gradients for adult deprivation were markedly stronger for heavy daily intake and problem drinking, and similar for heavy weekly intake. In order to examine if the early life index of disadvantage exerted an influence on the alcohol outcomes that was mediated via adult disadvantage, we controlled for the latter and noted a marked attenuation for each of the point estimates. Unsurprisingly, life course socioeconomic adversity was more strongly related to the alcohol outcomes than each of its components.</p>"],"string":"[\n \"<title>Results</title>\",\n \"<p>Of men with complete data on alcohol consumption (N = 576) and a response to enquiries about problem drinking (N = 578), 20.8% (N = 120) exceeded weekly and 44.6% (N = 258) daily guidelines for sensible consumption; 14.9% (N = 86) were categorised as having alcohol-related drinking problems. There was some overlap of cases according to each of the three alcohol outcomes. Thus, based on men with complete data on all alcohol outcomes (N = 576), of those who reported exceeding 'sensible' weekly intake of 21 units, 45% of these indicated that they consumed 4 units on one or more days per week. For the 'problem' drinking men in this cohort, 52% exceeded the weekly limit, while a predictably higher proportion (78%) surpassed the daily guidelines.</p>\",\n \"<p>In Additional file ##SUPPL##0##1## we present the relation of early life indicators of socioeconomic position with the three alcohol outcomes. There was a suggestion that study participants whose fathers were in more manual social classes reported an increased prevalence of heavy weekly drinking with an incremental effect seen across the occupational categories (p[trend] = 0.057). However, parental occupational social class was unrelated to either heavy daily or problem drinking at conventional levels of statistical significance. Conversely, both heavy daily alcohol consumption and problem drinking – but not heavy weekly intake – were positively related to number of siblings. While the confidence intervals for these effects contained unity, there was again some evidence of dose-response relations across the socioeconomic categories, particularly for problem drinking (p[trend] = 0.043). Education was related to all three alcohol outcomes, such that leaving school at 14 years of age or earlier conferred an elevated risk. Family structure was not related to any of the drinking outcomes in these analyses.</p>\",\n \"<p>Additional file ##SUPPL##1##2## shows the association between adult indices of socioeconomic position and the alcohol outcomes. Lower occupational social class in adulthood was related to an increased prevalence of heavy weekly (p[trend] = 0.045) and heavy daily alcohol intake (p[trend] = 0.003), and also to problem drinking (p[trend] = 0.004). Similarly, income revealed an inverse association with the alcohol outcomes. Men not living in privately owned accommodation, and men who reported not owning a car, were also more likely to surpass both weekly and daily drinking guidelines and to be categorised as having drinking problems. Although no substantial or consistent relationships were seen with employment status or marital status, there was a suggestion that single men and those not in employment exhibited less favourable drinking patterns than married and employed men, respectively. The relationship between household crowding and alcohol consumption was inconsistent.</p>\",\n \"<p>Next, in order to compare the relative strengths of each index of socioeconomic position with the alcohol outcomes, we computed a RII. Additional file ##SUPPL##2##3## presents early and later life socioeconomic predictors of heavy weekly drinking in ascending order of magnitude. Comparing disadvantaged men with advantaged, the strongest early life risk factor for heavy weekly drinking was a younger age at leaving school, while the weakest was family structure. In adult life, the strongest predictors were car ownership, housing tenure and current occupational social class; while the weakest were housing crowding and marital status. Confidence intervals were wide in some of these analyses. Similar patterns of association were apparent when heavy daily intake and problem drinking were the outcomes of interest.</p>\",\n \"<p>Finally, again using the RII, we computed accumulative indices of socioeconomic adversity for early life, adult life and the life course and related these to each of the three alcohol outcomes (Additional file ##SUPPL##3##4##). Both early and adult life socioeconomic deprivation were associated with an increased risk of exceeding weekly and daily guidelines for sensible alcohol intake and for problem drinking. Total adult disadvantage was also related to each of the three alcohol outcomes. In comparison to childhood markers of deprivation, the gradients for adult deprivation were markedly stronger for heavy daily intake and problem drinking, and similar for heavy weekly intake. In order to examine if the early life index of disadvantage exerted an influence on the alcohol outcomes that was mediated via adult disadvantage, we controlled for the latter and noted a marked attenuation for each of the point estimates. Unsurprisingly, life course socioeconomic adversity was more strongly related to the alcohol outcomes than each of its components.</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>The aim of this study was to examine the association of socioeconomic disadvantage across the life course with the risk of exceeding existing guidelines for 'sensible' alcohol consumption and problem drinking. As indicated, only two studies [##REF##17074968##23##,##REF##16973534##24##] have, to our knowledge, examined the link between life course indicators of socioeconomic position and adult reports of heavy drinking that offer a lower level of detail than our own. A number of our results accord with these. First, we found that adult deprivation was more strongly related to our alcohol outcomes than early life deprivation [##REF##17074968##23##,##REF##16973534##24##]; second, material socioeconomic indicators in adulthood (car ownership, housing tenure) generally revealed a steeper gradient with heavy alcohol intake and problem drinking than other factors, such as education, income and occupational social class [##REF##16973534##24##]; third, a substantial proportion of the influence of early life deprivation on alcohol intake was mediated via adult socioeconomic position [##REF##17074968##23##]. We were also able, for the first time to our knowledge, to explore the link between life course social circumstances and a measure of self-reported alcohol problems which, like heavy drinking, is also associated with elevated mortality [##REF##11964106##25##]. The pattern of association in these analyses was similar for our two indicators of alcohol intake.</p>","<title>Study strengths and limitations</title>","<p>The present study has a number of strengths. First, the social class distribution of the study sample was very similar to a comparable group of the local population drawn from the UK's 1991 census samples of anonymised records, suggesting that our results are generalisable to the UK population [##UREF##9##32##]. Second, for an epidemiological investigation, the data on alcohol intake were unusually detailed. Third, participation in the surveys was high (≥85%), so minimising concerns about selection bias. Fourth, we were able to examine the link between alcohol outcomes and a wider range of socioeconomic markers than has previously been possible. Finally, our use of the relative index of inequality allowed us to compare the relative strength of different socioeconomic measures across different periods of the life course.</p>","<p>This study is not of course without its limitations. First, like most large scale studies, we relied on self-reported alcohol intake (crucial given the nature of our research question). However, agreement between self-report and biochemical markers of alcohol intake is sufficiently high for use in population-based studies [##REF##2859002##33##]. Second, for data on early life socioeconomic circumstances, we relied on distant recall by middle-aged adults. In a systematic review, there was a suggestion that studies with prospectively collected data on childhood socioeconomic position tended to reveal somewhat stronger inverse associations with later mortality than studies with retrospective data [##REF##16257232##34##]. However, over a similar period to that in the present study, adult recall of parental occupational social class shows moderate agreement with data collected (and archived) in early life [##REF##16166367##35##]. Third, reverse causality is a plausible explanation for some of the relationships between socioeconomic position-alcohol intake/problems reported here. For instance, high alcohol intake and its attendant problems could lead to unemployment, reduced income, and loss of car ownership. This issue could be addressed by using alcohol outcomes based on incidence rather than prevalence, but we do not know when the study members became 'cases'. The problem of reverse causality is unlikely to be germane to the relation between alcohol consumption/problems and early life socioeconomic position when intake is likely to have been non-existent for most, if not all, study members. Finally, owing to a limited number of heavy/problem drinking women in the present study, we were unable to offer insights into the aetiological role, if any, of life course socioeconomic adversity in this group. Given the suggestion that other health-related outcomes, such as self-perceived health, reveal gender-specific relations with socioeconomic position in childhood and adulthood in analyses [##REF##16973536##36##], it may be unwise to extrapolate these results to women. This therefore remains an understudied group.</p>","<title>Public health context</title>","<p>Our results suggest that a range of socioeconomic indices are associated with heavy drinking and related alcohol problems in late middle age. Taking education as one of the more modifiable of these, the cognitive and socio-cultural characteristics of people with higher educational levels, for example the ability to obtain and synthesise health promotional materials, may be important. Educational experiences may also have a role in determining one's peers during sensitive periods across life course (late adolescence and early adulthood) when health behaviours, including pattern of alcohol intake, tend to be adopted [##REF##15983276##37##]. Efforts to increase educational achievement are likely to be most profitable by targeting younger people. As has been highlighted [##REF##9080564##38##], an adverse socioeconomic trajectory does not make decisions regarding more favourable health behaviours impossible, however, it may be associated with its own social constructions of which behaviours are perceived as being linked with optimal health or, as qualitative research of smoking has suggested, a means of coping with unfavourable social circumstances [##UREF##10##39##].</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>The aim of this study was to examine the association of socioeconomic disadvantage across the life course with the risk of exceeding existing guidelines for 'sensible' alcohol consumption and problem drinking. As indicated, only two studies [##REF##17074968##23##,##REF##16973534##24##] have, to our knowledge, examined the link between life course indicators of socioeconomic position and adult reports of heavy drinking that offer a lower level of detail than our own. A number of our results accord with these. First, we found that adult deprivation was more strongly related to our alcohol outcomes than early life deprivation [##REF##17074968##23##,##REF##16973534##24##]; second, material socioeconomic indicators in adulthood (car ownership, housing tenure) generally revealed a steeper gradient with heavy alcohol intake and problem drinking than other factors, such as education, income and occupational social class [##REF##16973534##24##]; third, a substantial proportion of the influence of early life deprivation on alcohol intake was mediated via adult socioeconomic position [##REF##17074968##23##]. We were also able, for the first time to our knowledge, to explore the link between life course social circumstances and a measure of self-reported alcohol problems which, like heavy drinking, is also associated with elevated mortality [##REF##11964106##25##]. The pattern of association in these analyses was similar for our two indicators of alcohol intake.</p>\",\n \"<title>Study strengths and limitations</title>\",\n \"<p>The present study has a number of strengths. First, the social class distribution of the study sample was very similar to a comparable group of the local population drawn from the UK's 1991 census samples of anonymised records, suggesting that our results are generalisable to the UK population [##UREF##9##32##]. Second, for an epidemiological investigation, the data on alcohol intake were unusually detailed. Third, participation in the surveys was high (≥85%), so minimising concerns about selection bias. Fourth, we were able to examine the link between alcohol outcomes and a wider range of socioeconomic markers than has previously been possible. Finally, our use of the relative index of inequality allowed us to compare the relative strength of different socioeconomic measures across different periods of the life course.</p>\",\n \"<p>This study is not of course without its limitations. First, like most large scale studies, we relied on self-reported alcohol intake (crucial given the nature of our research question). However, agreement between self-report and biochemical markers of alcohol intake is sufficiently high for use in population-based studies [##REF##2859002##33##]. Second, for data on early life socioeconomic circumstances, we relied on distant recall by middle-aged adults. In a systematic review, there was a suggestion that studies with prospectively collected data on childhood socioeconomic position tended to reveal somewhat stronger inverse associations with later mortality than studies with retrospective data [##REF##16257232##34##]. However, over a similar period to that in the present study, adult recall of parental occupational social class shows moderate agreement with data collected (and archived) in early life [##REF##16166367##35##]. Third, reverse causality is a plausible explanation for some of the relationships between socioeconomic position-alcohol intake/problems reported here. For instance, high alcohol intake and its attendant problems could lead to unemployment, reduced income, and loss of car ownership. This issue could be addressed by using alcohol outcomes based on incidence rather than prevalence, but we do not know when the study members became 'cases'. The problem of reverse causality is unlikely to be germane to the relation between alcohol consumption/problems and early life socioeconomic position when intake is likely to have been non-existent for most, if not all, study members. Finally, owing to a limited number of heavy/problem drinking women in the present study, we were unable to offer insights into the aetiological role, if any, of life course socioeconomic adversity in this group. Given the suggestion that other health-related outcomes, such as self-perceived health, reveal gender-specific relations with socioeconomic position in childhood and adulthood in analyses [##REF##16973536##36##], it may be unwise to extrapolate these results to women. This therefore remains an understudied group.</p>\",\n \"<title>Public health context</title>\",\n \"<p>Our results suggest that a range of socioeconomic indices are associated with heavy drinking and related alcohol problems in late middle age. Taking education as one of the more modifiable of these, the cognitive and socio-cultural characteristics of people with higher educational levels, for example the ability to obtain and synthesise health promotional materials, may be important. Educational experiences may also have a role in determining one's peers during sensitive periods across life course (late adolescence and early adulthood) when health behaviours, including pattern of alcohol intake, tend to be adopted [##REF##15983276##37##]. Efforts to increase educational achievement are likely to be most profitable by targeting younger people. As has been highlighted [##REF##9080564##38##], an adverse socioeconomic trajectory does not make decisions regarding more favourable health behaviours impossible, however, it may be associated with its own social constructions of which behaviours are perceived as being linked with optimal health or, as qualitative research of smoking has suggested, a means of coping with unfavourable social circumstances [##UREF##10##39##].</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>Exposure to disadvantaged circumstances throughout the lifecourse, but particularly in adulthood, is associated with detrimental patterns of alcohol consumption and problem drinking in men in late middle age. Further research is needed to establish whether similar associations are seen in younger people and women, particularly given the increasing prevalence of alcohol consumption in these groups.</p>","<title>What this paper adds</title>","<p>• This is one of the first studies to examine life course socioeconomic position as a predictor of problem drinking and heavy alcohol intake.</p>","<p>• Exposure to more disadvantaged circumstances throughout the life course, but particularly in adulthood, is associated with detrimental patterns of alcohol consumption and problem drinking in men in late middle age</p>","<title>Policy implications</title>","<p>• Although a range of socioeconomic indices were linked with later detrimental alcohol intake and problem drinking, education may represent one of the most modifiable.</p>","<p>• Educational experiences may have a role in determining one's peers during sensitive periods across the life course (late adolescence and early adulthood) when health behaviours, including patterns of alcohol intake, tend to be adopted.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>Exposure to disadvantaged circumstances throughout the lifecourse, but particularly in adulthood, is associated with detrimental patterns of alcohol consumption and problem drinking in men in late middle age. Further research is needed to establish whether similar associations are seen in younger people and women, particularly given the increasing prevalence of alcohol consumption in these groups.</p>\",\n \"<title>What this paper adds</title>\",\n \"<p>• This is one of the first studies to examine life course socioeconomic position as a predictor of problem drinking and heavy alcohol intake.</p>\",\n \"<p>• Exposure to more disadvantaged circumstances throughout the life course, but particularly in adulthood, is associated with detrimental patterns of alcohol consumption and problem drinking in men in late middle age</p>\",\n \"<title>Policy implications</title>\",\n \"<p>• Although a range of socioeconomic indices were linked with later detrimental alcohol intake and problem drinking, education may represent one of the most modifiable.</p>\",\n \"<p>• Educational experiences may have a role in determining one's peers during sensitive periods across the life course (late adolescence and early adulthood) when health behaviours, including patterns of alcohol intake, tend to be adopted.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>With surveys suggesting that exceeding guidelines for 'sensible' alcohol intake is commonplace, the health and social impact of modifying intake on a population level is potentially considerable. If public health interventions are to be successfully implemented, it is first important to identify correlates of such behaviours, including socioeconomic disadvantage. This was the aim of the present study.</p>","<title>Methods</title>","<p>Population-representative cohort study of 576 men from the West of Scotland. Data on life course socioeconomic position were collected in 1988 (at around 55 years of age). Alcohol consumption patterns (detailed seven day recall) and problem drinking (CAGE questionnaire) were ascertained in 1990/2 (at around 59 years of age). A relative index of inequality was computed to explore the comparative strength of different indicators of social circumstances from different periods of the life course.</p>","<title>Results</title>","<p>Socioeconomic adversity in both early life and in adulthood was related to an increased risk of exceeding the weekly and daily alcohol guidelines, with adult indicators of socioeconomic position revealing the strongest associations. Of these, material indicators of socioeconomic deprivation in adulthood – car ownership, housing tenure – were marginally more strongly related to heavy alcohol intake and problem drinking than education, income and occupational social class. A substantial proportion of the influence of early life deprivation on alcohol intake was mediated via adult socioeconomic position. Similar results were apparent when problem drinking was the outcome of interest.</p>","<title>Conclusion</title>","<p>In men in this cohort, exposure to disadvantaged social circumstances across the lifecourse, but particularly in adulthood, is associated with detrimental patterns of alcohol consumption and problem drinking in late middle age.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>With surveys suggesting that exceeding guidelines for 'sensible' alcohol intake is commonplace, the health and social impact of modifying intake on a population level is potentially considerable. If public health interventions are to be successfully implemented, it is first important to identify correlates of such behaviours, including socioeconomic disadvantage. This was the aim of the present study.</p>\",\n \"<title>Methods</title>\",\n \"<p>Population-representative cohort study of 576 men from the West of Scotland. Data on life course socioeconomic position were collected in 1988 (at around 55 years of age). Alcohol consumption patterns (detailed seven day recall) and problem drinking (CAGE questionnaire) were ascertained in 1990/2 (at around 59 years of age). A relative index of inequality was computed to explore the comparative strength of different indicators of social circumstances from different periods of the life course.</p>\",\n \"<title>Results</title>\",\n \"<p>Socioeconomic adversity in both early life and in adulthood was related to an increased risk of exceeding the weekly and daily alcohol guidelines, with adult indicators of socioeconomic position revealing the strongest associations. Of these, material indicators of socioeconomic deprivation in adulthood – car ownership, housing tenure – were marginally more strongly related to heavy alcohol intake and problem drinking than education, income and occupational social class. A substantial proportion of the influence of early life deprivation on alcohol intake was mediated via adult socioeconomic position. Similar results were apparent when problem drinking was the outcome of interest.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>In men in this cohort, exposure to disadvantaged social circumstances across the lifecourse, but particularly in adulthood, is associated with detrimental patterns of alcohol consumption and problem drinking in late middle age.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>The idea for the present manuscript was generated during discussions amongst the co-authors. GDB wrote the first draft of the manuscript based on data analyses conducted by HL. All authors commented extensively on subsequent revisions, and have read and approved the final manuscript.</p>","<title>Pre-publication history</title>","<p>The pre-publication history for this paper can be accessed here:</p>","<p><ext-link ext-link-type=\"uri\" xlink:href=\"http://www.biomedcentral.com/1471-2458/8/302/prepub\"/></p>","<title>Supplementary Material</title>"],"string":"[\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>The idea for the present manuscript was generated during discussions amongst the co-authors. GDB wrote the first draft of the manuscript based on data analyses conducted by HL. All authors commented extensively on subsequent revisions, and have read and approved the final manuscript.</p>\",\n \"<title>Pre-publication history</title>\",\n \"<p>The pre-publication history for this paper can be accessed here:</p>\",\n \"<p><ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www.biomedcentral.com/1471-2458/8/302/prepub\\\"/></p>\",\n \"<title>Supplementary Material</title>\"\n]","isConversational":false},"back":{"kind":"list like","value":["<title>Acknowledgements</title>","<p>The West of Scotland Twenty-07 Study is funded by the UK Medical Research Council and the data were collected by the MRC Social and Public Health Sciences Unit. We are grateful to all of the participants in the Study, and to the survey staff and research nurses involved. At the time of manuscript preparation, HL, CE, KH (WBS U.1300.00.004 and MB (WBS U.1300.80.001.00005.01) were employed by the Medical Research Council. GDB is a Wellcome Trust Fellow (WBS U.1300.00.006.00012.01).</p>"],"string":"[\n \"<title>Acknowledgements</title>\",\n \"<p>The West of Scotland Twenty-07 Study is funded by the UK Medical Research Council and the data were collected by the MRC Social and Public Health Sciences Unit. We are grateful to all of the participants in the Study, and to the survey staff and research nurses involved. At the time of manuscript preparation, HL, CE, KH (WBS U.1300.00.004 and MB (WBS U.1300.80.001.00005.01) were employed by the Medical Research Council. GDB is a Wellcome Trust Fellow (WBS U.1300.00.006.00012.01).</p>\"\n]","isConversational":false},"figure":{"kind":"list like","value":[],"string":"[]","isConversational":false},"table":{"kind":"list like","value":[],"string":"[]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":["<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Table 1. Odds ratios (95% CI) for the association of indices of early life socioeconomic position with heavy weekly, heavy daily and problem drinking in men.</p></caption></supplementary-material>","<supplementary-material content-type=\"local-data\" id=\"S2\"><caption><title>Additional file 2</title><p>Table 2. Odds ratios (95% CI) for the association of indices of adult socioeconomic position with heavy weekly, heavy daily and problem drinking in men.</p></caption></supplementary-material>","<supplementary-material content-type=\"local-data\" id=\"S3\"><caption><title>Additional file 3</title><p>Table 3. Relative index of inequality (95% CI) for the association of indices of life course socioeconomic position with heavy weekly, heavy daily and problem drinking in men.</p></caption></supplementary-material>","<supplementary-material content-type=\"local-data\" id=\"S4\"><caption><title>Additional file 4</title><p>Table 4. Relative index of inequality (95% CI) for the association of accumulative indices of life course socioeconomic position with heavy weekly, heavy daily and problem drinking in men.</p></caption></supplementary-material>"],"string":"[\n \"<supplementary-material content-type=\\\"local-data\\\" id=\\\"S1\\\"><caption><title>Additional file 1</title><p>Table 1. Odds ratios (95% CI) for the association of indices of early life socioeconomic position with heavy weekly, heavy daily and problem drinking in men.</p></caption></supplementary-material>\",\n \"<supplementary-material content-type=\\\"local-data\\\" id=\\\"S2\\\"><caption><title>Additional file 2</title><p>Table 2. Odds ratios (95% CI) for the association of indices of adult socioeconomic position with heavy weekly, heavy daily and problem drinking in men.</p></caption></supplementary-material>\",\n \"<supplementary-material content-type=\\\"local-data\\\" id=\\\"S3\\\"><caption><title>Additional file 3</title><p>Table 3. Relative index of inequality (95% CI) for the association of indices of life course socioeconomic position with heavy weekly, heavy daily and problem drinking in men.</p></caption></supplementary-material>\",\n \"<supplementary-material content-type=\\\"local-data\\\" id=\\\"S4\\\"><caption><title>Additional file 4</title><p>Table 4. Relative index of inequality (95% CI) for the association of accumulative indices of life course socioeconomic position with heavy weekly, heavy daily and problem drinking in men.</p></caption></supplementary-material>\"\n]","isConversational":false},"footnote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"graphic":{"kind":"list like","value":[],"string":"[]","isConversational":false},"media":{"kind":"list like","value":["<media xlink:href=\"1471-2458-8-302-S1.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>","<media xlink:href=\"1471-2458-8-302-S2.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>","<media xlink:href=\"1471-2458-8-302-S3.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>","<media xlink:href=\"1471-2458-8-302-S4.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>"],"string":"[\n \"<media xlink:href=\\\"1471-2458-8-302-S1.doc\\\" mimetype=\\\"application\\\" mime-subtype=\\\"msword\\\"><caption><p>Click here for file</p></caption></media>\",\n \"<media xlink:href=\\\"1471-2458-8-302-S2.doc\\\" mimetype=\\\"application\\\" mime-subtype=\\\"msword\\\"><caption><p>Click here for file</p></caption></media>\",\n \"<media xlink:href=\\\"1471-2458-8-302-S3.doc\\\" mimetype=\\\"application\\\" mime-subtype=\\\"msword\\\"><caption><p>Click here for file</p></caption></media>\",\n \"<media xlink:href=\\\"1471-2458-8-302-S4.doc\\\" mimetype=\\\"application\\\" mime-subtype=\\\"msword\\\"><caption><p>Click here for file</p></caption></media>\"\n]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Moore\"], \"given-names\": [\"RM\"], \"article-title\": [\"On the comparative mortality among lives of abstainers and non-abstainers from alcoholic beverages\"], \"source\": [\"Journal of Institute of Actuaries\"], \"year\": [\"1904\"], \"volume\": [\"38\"], \"fpage\": [\"213\"], \"lpage\": [\"76\"]}, {\"collab\": [\"Royal College of Physicians\"], \"source\": [\"A great and growing evil: the medical consequences of alcohol abuse\"], \"year\": [\"1987\"], \"publisher-name\": [\"London: Royal College of Physicians\"]}, {\"collab\": [\"Anon\"], \"source\": [\"The Lord President's report on action against alcohol misuse\"], \"year\": [\"1991\"], \"publisher-name\": [\"London: HMSO\"]}, {\"collab\": [\"Department of Health\"], \"source\": [\"Sensible Drinking \\u2013 The Report of an Inter-Departmental Working Group\"], \"year\": [\"1995\"], \"publisher-name\": [\"London: Department of Health\"]}, {\"collab\": [\"The Academy of Medical Sciences\"], \"source\": [\"Calling Time. The Nation's drinking as a major health issue\"], \"year\": [\"2004\"], \"publisher-name\": [\"London: The Academy of Medical Sciences\"]}, {\"surname\": [\"Sproston\", \"Primatesta\"], \"given-names\": [\"K\", \"PE\"], \"article-title\": [\"Health Survey for England, 2003\"], \"source\": [\"Risk factors for cardiovascular disease\"], \"year\": [\"2004\"], \"volume\": [\"2\"], \"publisher-name\": [\"London: The Stationery Office\"]}, {\"surname\": [\"Kuh\", \"Ben Shlomo\"], \"given-names\": [\"D\", \"Y\"], \"source\": [\"A lifecourse approach to chronic disease epidemiology\"], \"year\": [\"2004\"], \"publisher-name\": [\"Oxford: Oxford Medical Publications\"]}, {\"surname\": [\"Macintyre\", \"Annandale\", \"Ecob\", \"Ford\", \"Jamieson\", \"Maciver\", \"West\", \"Wyke\", \"Martin C, MacQueen D\"], \"given-names\": [\"S\", \"E\", \"R\", \"G\", \"B\", \"S\", \"P\", \"S\"], \"article-title\": [\"The West of Scotland Twenty-07 Study: health in the community\"], \"source\": [\"Readings for a New Public Health\"], \"year\": [\"1989\"], \"publisher-name\": [\"Edinburgh: Edinburgh University Press\"]}, {\"collab\": [\"OPCS\"], \"source\": [\"Classification of occupations 1980\"], \"year\": [\"1980\"], \"publisher-name\": [\"London: HMSO\"]}, {\"surname\": [\"Der\"], \"given-names\": [\"G\"], \"source\": [\"A comparison of the west of Scotland Twenty-07 study sample and the 1991 census SARs\"], \"year\": [\"1998\"], \"publisher-name\": [\"Glasgow: MRC Medical Sociology Unit\"]}, {\"surname\": [\"Graham\", \"Wilkinson S, Kitzinger C\"], \"given-names\": [\"H\"], \"article-title\": [\"Surviving by smoking\"], \"source\": [\"Women and Health: Feminist Perspectives\"], \"year\": [\"1994\"], \"publisher-name\": [\"London: Taylor and Francis\"], \"fpage\": [\"102\"], \"lpage\": [\"23\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":39,"string":"39"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:38"},"citation":{"kind":"string","value":"BMC Public Health. 2008 Sep 1; 8:302"},"package_file":{"kind":"string","value":"oa_package/e3/58/PMC2538536.tar.gz"}}},{"rowIdx":119699,"cells":{"accession_id":{"kind":"string","value":"PMC2538537"},"pmid":{"kind":"string","value":"18721482"},"introduction":{"kind":"list like","value":["<title>Background</title>","<p>Variations and differences in terms of mortality are widely recognized both at national and international level [##REF##14985525##1##]. In particular, mortality inequalities across geographical localities are well documented in various developed countries [##UREF##0##2##]. These differences could be attributed to a variety of factors including genetic, lifestyle and environmental [##UREF##1##3##]. Better understanding of regional mortality variations is important because it sheds light on the how well the aims of public health are being achieved, in addition it could provides hypotheses for further testing with the goal of better understanding disease aetiology, and thus improving preventative efforts.</p>","<p>Previous studies conducted in Greece referred to geographical variations of maternal mortality, and variations of some types of cancer [##REF##3209337##4##, ####REF##10580674##5##, ##REF##10726626##6##, ##REF##10949400##7####10949400##7##]. To our knowledge there is no published study related to comparative assessment of regional crude mortality rates, and their determinants. Therefore, the aim of the present study is to compare different regions of Greece in terms of crude mortality and also to explore possible risk factors like: the low gross domestic product (GDP) per capita, low ratio of physicians and dentists per 100 000 population, the ratio of hospital beds/100 000 population and the percentage of Muslim population.</p>"],"string":"[\n \"<title>Background</title>\",\n \"<p>Variations and differences in terms of mortality are widely recognized both at national and international level [##REF##14985525##1##]. In particular, mortality inequalities across geographical localities are well documented in various developed countries [##UREF##0##2##]. These differences could be attributed to a variety of factors including genetic, lifestyle and environmental [##UREF##1##3##]. Better understanding of regional mortality variations is important because it sheds light on the how well the aims of public health are being achieved, in addition it could provides hypotheses for further testing with the goal of better understanding disease aetiology, and thus improving preventative efforts.</p>\",\n \"<p>Previous studies conducted in Greece referred to geographical variations of maternal mortality, and variations of some types of cancer [##REF##3209337##4##, ####REF##10580674##5##, ##REF##10726626##6##, ##REF##10949400##7####10949400##7##]. To our knowledge there is no published study related to comparative assessment of regional crude mortality rates, and their determinants. Therefore, the aim of the present study is to compare different regions of Greece in terms of crude mortality and also to explore possible risk factors like: the low gross domestic product (GDP) per capita, low ratio of physicians and dentists per 100 000 population, the ratio of hospital beds/100 000 population and the percentage of Muslim population.</p>\"\n]","isConversational":false},"methods":{"kind":"list like","value":["<title>Methods</title>","<p>Crude death rates (CDR) were calculated by gender in each of the 10 regional areas in Greece. Data regarding deaths were obtained from the annual series of the vital statistics of Greece – Deaths of the population (\"Natural movement of population\") during the period 1984–2004 (21 years). The total population in each region was derived from the 1981, 1991, 2001 Census of the national statistical service of Greece.</p>","<p>For both gender we used five-year intervals for the population age and the outcome was 18 age-categories. For each age-category for both genders we calculated the average of the yearly standardized mortality rates (SMR) for each region for the under study 21 year period (1984–2004). We used the method of direct standardization with respect to population census of the years 1981, 1991, 2001.</p>","<p>Data regarding hospital beds, doctors per 100 000 inhabitants, GDP per capita per region, specific mortality rates, and vaccination coverage were obtained from national statistical service of Greece. Quantitative data were presented by using median and interquartile range (IQR).</p>","<title>Statistical analysis</title>","<p>All data were entered in a specially designed a database, and statistical analysis was performed using SPSS 11.0 software. Mann Whitney test was used to compare mortality rates of Thrace to these of other Greek regions, while chi-square test was used to compare vaccination coverage between Thrace and other regions. Multivariate regression models were used in order to assess factors independently associated with mortality rate. In these models mortality rate was the dependent variable, while possible risk factors like GDP, hospital beds, and doctors/100000 population were the independent variables. The level of statistical significance was set at 0.05.</p>"],"string":"[\n \"<title>Methods</title>\",\n \"<p>Crude death rates (CDR) were calculated by gender in each of the 10 regional areas in Greece. Data regarding deaths were obtained from the annual series of the vital statistics of Greece – Deaths of the population (\\\"Natural movement of population\\\") during the period 1984–2004 (21 years). The total population in each region was derived from the 1981, 1991, 2001 Census of the national statistical service of Greece.</p>\",\n \"<p>For both gender we used five-year intervals for the population age and the outcome was 18 age-categories. For each age-category for both genders we calculated the average of the yearly standardized mortality rates (SMR) for each region for the under study 21 year period (1984–2004). We used the method of direct standardization with respect to population census of the years 1981, 1991, 2001.</p>\",\n \"<p>Data regarding hospital beds, doctors per 100 000 inhabitants, GDP per capita per region, specific mortality rates, and vaccination coverage were obtained from national statistical service of Greece. Quantitative data were presented by using median and interquartile range (IQR).</p>\",\n \"<title>Statistical analysis</title>\",\n \"<p>All data were entered in a specially designed a database, and statistical analysis was performed using SPSS 11.0 software. Mann Whitney test was used to compare mortality rates of Thrace to these of other Greek regions, while chi-square test was used to compare vaccination coverage between Thrace and other regions. Multivariate regression models were used in order to assess factors independently associated with mortality rate. In these models mortality rate was the dependent variable, while possible risk factors like GDP, hospital beds, and doctors/100000 population were the independent variables. The level of statistical significance was set at 0.05.</p>\"\n]","isConversational":false},"results":{"kind":"list like","value":["<title>Results</title>","<p>Among males and females at almost all age categories the region of Thrace recorded the highest age-specific crude mortality and standardised mortality rate (Figures ##FIG##0##1##, ##FIG##1##2##). The previously described trend of increased mortality of Thrace did not change during the twenty one years studied.</p>","<p>The most notable differences in terms of mortality rates between Thrace and national mean mortality rate were found at the age categories 0–4, 5–9, and 10–14 years.</p>","<title>Age group 0–4 years</title>","<p>Among males at age category 0–4 years the regional mortality in Thrace was the highest in Greece with 345 deaths/100 000 inhabitants in comparison to the national mortality rate (mean) of 200/100 000 inhabitants. The region with the lowest mortality rate was Ionian islands (149/100 000) followed by Aegean islands (155/100 000) and Crete (161/100 000). Among females at that age group Thrace recorded the highest CDR in Greece (268/100 000) while the national CDR (mean) was 166/100 000. The region with the lowest CDR was Aegean islands (119/100 000) followed by Crete (127/100 000) and Sterea (133/100 000). At age group 0–1 Thrace recorded the highest CDR in comparison to the rest of Greece (median: 978, IQR: 828–1311) versus 651, IQR: 500–784, Mann-Whitney test, p < 0.001).</p>","<title>Age group 5–9 years</title>","<p>The CDR in Thrace among males at the age category 5–9 years was well above the national CDR (33 deaths/100 000 vs 18/100 000, respectively). The lowest mortality rate was found in Ionian islands (13.1/100 000) followed by Athens (13. 5/100 000) and Epirus (15.8/100 000). Regarding females Thrace found again to have the highest CDR (23/100 000; national mean CDR: 14/100 000). Athens had the lowest regional mortality (9.8/100 000) followed by Aegean Islands (12.4/100 000).</p>","<title>Age group 10–14 years</title>","<p>Mortality in Thrace among males was the highest regional in Greece with 36 deaths per 100 000 in comparison to national mortality rate (mean) of 20/100 000. Peloponnesus recorded the lowest regional mortality rate (11.5/100 000) followed by Athens (11.9/100 000). A similar pattern of regional mortality was revealed with respect to female population (CDR in Thrace: 26/100 000; national mean CDR: 14/100 000; Peloponnesus found to have the lowest CDR followed by Athens (11.5/100 000, and 11.9/100 000, respectively).</p>","<title>Age groups 15–19, and 20–24 years</title>","<p>Among males at the age category 15–19 years Thessaly recorded the highest mortality rate followed by Ionian islands, and Thrace which recorded a CDR of 85 deaths/100 000 inhabitants (national mean CDR: 72/100 000). A similar pattern of regional mortality was emerged with respect to age category 20–24 years. In addition, it should be noted that Thrace recorded significantly higher mortality rates compared to the rest of the Greek regions in terms of some age groups.</p>","<p>This was the case (apart from 0–1 age group which has been already mentioned) for age group 1–4 years (median of Thrace: 62.95; IQR: 34.97–83.94 vs 26.28; IQR: 23.09–37.8 for the other regions (IQR: 18.54–42.36; p < 0.001), and 5–14 years (median of Thrace: 23.21; IQR: 17.02–33.77) vs 16.51 (IQR: 12.53–20.93; p = 0.018).</p>","<title>Possible risk factors: GDP per capita, ratio of doctors, and hospital beds per 100 000 inhabitants</title>","<p>The lowest mortality rate both in male and female has been recorded in the regions of Peloponnesus, Epirus and the island of Crete, followed by the regions of Ionian and Aegean islands. The regions of greater Athens and Macedonia – the regions with the highest population count in Greece- and the regions of Thessaly and Sterea have not demonstrated differences with respect to the mortality rate in comparison to the national SMR (Figures ##FIG##0##1##, ##FIG##1##2## and Table ##TAB##0##1##).</p>","<p>Thrace had the lowest gross domestic product (GDP) per capita in Greece recorded in the year 2001 (11 123 million Euros). Furthermore the region of Thrace recorded low ratio of doctors (284/100 000), per population in comparison to the national ratio of 422 doctors and 111 dentists, respectively. In 1999 the ratio of hospital beds per 100 000 population was very low (268/100 000) in Thrace, the second lowest in country in comparison to national ratio of 470 hospital beds/100 000 population (Table ##TAB##0##1##) [##UREF##2##8##].</p>","<title>Specific mortality rates</title>","<p>Specific mortality rates were higher in Thrace in comparison to the national rate of Greece. In particular, the ratio of specific mortality in Thrace/specific national mortality of Greece was 1.6 for Tuberculosis; 1.9 for hypertension; 1.7 for psychiatric mortality; 1.4 for congenital malformation; 1.1 for accidents, and 1.5 for suicide.</p>","<title>Vaccination coverage</title>","<p>Thrace recorded the lowest vaccination coverage in comparison to other Greek regions. In particular, Thrace recorded vaccination coverage for Hib 71.1% (95% CI: 64.6–76.8) vs 85.4% (95% CI: 84–86.7%) for Greece (chi-square test; p < 0.01).</p>","<p>Regarding vaccination coverage for the fourth dose of DTP vaccine, Thrace recorded a significantly lower vaccination coverage in comparison to the national coverage of Greece (94%; 95% CI: 90.2–96.3 vs 98.3%; 95% CI: 97.7–98.8; chi-square test; p < 0.01).</p>","<title>Multivariate analysis</title>","<p>Multiple regression analysis has shown that GDP was significantly associated (inverse association) with CDR in Thrace at age group 5–14 (β-coefficient = -0.001; p = 0.02; r = 0.59).</p>","<p>At age group 0–14 analysis has revealed that ratio of doctors/100000 population were significantly associated (inverse association) with CDR (β-coefficient = -0.359; p = 0.03; r = 0.413).</p>"],"string":"[\n \"<title>Results</title>\",\n \"<p>Among males and females at almost all age categories the region of Thrace recorded the highest age-specific crude mortality and standardised mortality rate (Figures ##FIG##0##1##, ##FIG##1##2##). The previously described trend of increased mortality of Thrace did not change during the twenty one years studied.</p>\",\n \"<p>The most notable differences in terms of mortality rates between Thrace and national mean mortality rate were found at the age categories 0–4, 5–9, and 10–14 years.</p>\",\n \"<title>Age group 0–4 years</title>\",\n \"<p>Among males at age category 0–4 years the regional mortality in Thrace was the highest in Greece with 345 deaths/100 000 inhabitants in comparison to the national mortality rate (mean) of 200/100 000 inhabitants. The region with the lowest mortality rate was Ionian islands (149/100 000) followed by Aegean islands (155/100 000) and Crete (161/100 000). Among females at that age group Thrace recorded the highest CDR in Greece (268/100 000) while the national CDR (mean) was 166/100 000. The region with the lowest CDR was Aegean islands (119/100 000) followed by Crete (127/100 000) and Sterea (133/100 000). At age group 0–1 Thrace recorded the highest CDR in comparison to the rest of Greece (median: 978, IQR: 828–1311) versus 651, IQR: 500–784, Mann-Whitney test, p < 0.001).</p>\",\n \"<title>Age group 5–9 years</title>\",\n \"<p>The CDR in Thrace among males at the age category 5–9 years was well above the national CDR (33 deaths/100 000 vs 18/100 000, respectively). The lowest mortality rate was found in Ionian islands (13.1/100 000) followed by Athens (13. 5/100 000) and Epirus (15.8/100 000). Regarding females Thrace found again to have the highest CDR (23/100 000; national mean CDR: 14/100 000). Athens had the lowest regional mortality (9.8/100 000) followed by Aegean Islands (12.4/100 000).</p>\",\n \"<title>Age group 10–14 years</title>\",\n \"<p>Mortality in Thrace among males was the highest regional in Greece with 36 deaths per 100 000 in comparison to national mortality rate (mean) of 20/100 000. Peloponnesus recorded the lowest regional mortality rate (11.5/100 000) followed by Athens (11.9/100 000). A similar pattern of regional mortality was revealed with respect to female population (CDR in Thrace: 26/100 000; national mean CDR: 14/100 000; Peloponnesus found to have the lowest CDR followed by Athens (11.5/100 000, and 11.9/100 000, respectively).</p>\",\n \"<title>Age groups 15–19, and 20–24 years</title>\",\n \"<p>Among males at the age category 15–19 years Thessaly recorded the highest mortality rate followed by Ionian islands, and Thrace which recorded a CDR of 85 deaths/100 000 inhabitants (national mean CDR: 72/100 000). A similar pattern of regional mortality was emerged with respect to age category 20–24 years. In addition, it should be noted that Thrace recorded significantly higher mortality rates compared to the rest of the Greek regions in terms of some age groups.</p>\",\n \"<p>This was the case (apart from 0–1 age group which has been already mentioned) for age group 1–4 years (median of Thrace: 62.95; IQR: 34.97–83.94 vs 26.28; IQR: 23.09–37.8 for the other regions (IQR: 18.54–42.36; p < 0.001), and 5–14 years (median of Thrace: 23.21; IQR: 17.02–33.77) vs 16.51 (IQR: 12.53–20.93; p = 0.018).</p>\",\n \"<title>Possible risk factors: GDP per capita, ratio of doctors, and hospital beds per 100 000 inhabitants</title>\",\n \"<p>The lowest mortality rate both in male and female has been recorded in the regions of Peloponnesus, Epirus and the island of Crete, followed by the regions of Ionian and Aegean islands. The regions of greater Athens and Macedonia – the regions with the highest population count in Greece- and the regions of Thessaly and Sterea have not demonstrated differences with respect to the mortality rate in comparison to the national SMR (Figures ##FIG##0##1##, ##FIG##1##2## and Table ##TAB##0##1##).</p>\",\n \"<p>Thrace had the lowest gross domestic product (GDP) per capita in Greece recorded in the year 2001 (11 123 million Euros). Furthermore the region of Thrace recorded low ratio of doctors (284/100 000), per population in comparison to the national ratio of 422 doctors and 111 dentists, respectively. In 1999 the ratio of hospital beds per 100 000 population was very low (268/100 000) in Thrace, the second lowest in country in comparison to national ratio of 470 hospital beds/100 000 population (Table ##TAB##0##1##) [##UREF##2##8##].</p>\",\n \"<title>Specific mortality rates</title>\",\n \"<p>Specific mortality rates were higher in Thrace in comparison to the national rate of Greece. In particular, the ratio of specific mortality in Thrace/specific national mortality of Greece was 1.6 for Tuberculosis; 1.9 for hypertension; 1.7 for psychiatric mortality; 1.4 for congenital malformation; 1.1 for accidents, and 1.5 for suicide.</p>\",\n \"<title>Vaccination coverage</title>\",\n \"<p>Thrace recorded the lowest vaccination coverage in comparison to other Greek regions. In particular, Thrace recorded vaccination coverage for Hib 71.1% (95% CI: 64.6–76.8) vs 85.4% (95% CI: 84–86.7%) for Greece (chi-square test; p < 0.01).</p>\",\n \"<p>Regarding vaccination coverage for the fourth dose of DTP vaccine, Thrace recorded a significantly lower vaccination coverage in comparison to the national coverage of Greece (94%; 95% CI: 90.2–96.3 vs 98.3%; 95% CI: 97.7–98.8; chi-square test; p < 0.01).</p>\",\n \"<title>Multivariate analysis</title>\",\n \"<p>Multiple regression analysis has shown that GDP was significantly associated (inverse association) with CDR in Thrace at age group 5–14 (β-coefficient = -0.001; p = 0.02; r = 0.59).</p>\",\n \"<p>At age group 0–14 analysis has revealed that ratio of doctors/100000 population were significantly associated (inverse association) with CDR (β-coefficient = -0.359; p = 0.03; r = 0.413).</p>\"\n]","isConversational":false},"discussion":{"kind":"list like","value":["<title>Discussion</title>","<p>Descriptive analysis has indicated that Thrace was the region with the highest mortality in Greece for both men and women at almost all age categories. Furthermore, Thrace demonstrated mortality rates well above the EU average. There is a question about the aetiology of this increased mortality risk in Thrace. Our results indicate some possible risk factors: Thrace recorded the lowest regional GDP in Greece, and limited access to healthcare services. Multivariate analysis (age group 5–14) documented that GDP was a significant determinant of mortality rate in Thrace, in addition a significant association regarding ratio of doctors/100000 population was detected at age group 0–14. These notable findings could be taken into account in future planning in health care strategy, and in allocation of resources. In particular, the finding that the mean GDP of Thrace is very low compared to other Greek regions could have important implications in terms of policy making. However, the low GDP, and the low hospital bed per population ratio in Thrace deserve further attention and research.</p>","<p>In addition, the findings related to vaccination coverage, and specific disease rate could assist in understanding/explaining the regional mortality differences noted. In particular, the lower vaccination coverage observed in Thrace could be associated with increased mortality due to meningitis, and epiglottiditis.</p>","<p>However, other risk factors should be explored (genetic, lifestyle, occupational and environmental exposures) [##REF##12826634##9##,##REF##15851646##10##]. In addition, the high percentage of a Muslim minority in Thrace could represent a possible factor associated with increased mortality risk, but this hypothesis is not being supported by several studies which reported that at least for some types of cancer (breast, endometrial, ovarian) Muslims recorded significantly lower mortality rate in comparison to Christians Orthodox [##REF##10580674##5##, ####REF##10726626##6##, ##REF##10949400##7####10949400##7##]. In addition, a study conducted in the prefecture of Xanthi (Thrace) revealed that Muslims present lower incidence rate of ischemic stroke than Christians. Also the outcome of hospitalization due to stroke did not differ significantly by religion [##REF##16623617##11##].</p>","<p>It should be stressed that Thrace was partly except from the population exchange following the end of the Greek-Turkish war in 1922. Furthermore, there has been a significant amount of migration within Greece during the recent decades. It is possible that some of this will have been selective with healthier folk moving to healthier areas. However, if net migration patterns play a role regarding increased mortality in this region has to be confirmed by further research.</p>","<p>There appears to be a south to north trend in increasing mortality risk, but this trend was not reflected in the putative risk factor data.</p>","<p>Our study has some limitations by being descriptive, thus we can not provide information on causal associations between mortality and several possible risk factors. An additional limitation was the absence of regional data (e.g. on smoking habit, and diet). However, we performed multivariate statistical analysis, and – in part-some speculations have been statistically tested.</p>"],"string":"[\n \"<title>Discussion</title>\",\n \"<p>Descriptive analysis has indicated that Thrace was the region with the highest mortality in Greece for both men and women at almost all age categories. Furthermore, Thrace demonstrated mortality rates well above the EU average. There is a question about the aetiology of this increased mortality risk in Thrace. Our results indicate some possible risk factors: Thrace recorded the lowest regional GDP in Greece, and limited access to healthcare services. Multivariate analysis (age group 5–14) documented that GDP was a significant determinant of mortality rate in Thrace, in addition a significant association regarding ratio of doctors/100000 population was detected at age group 0–14. These notable findings could be taken into account in future planning in health care strategy, and in allocation of resources. In particular, the finding that the mean GDP of Thrace is very low compared to other Greek regions could have important implications in terms of policy making. However, the low GDP, and the low hospital bed per population ratio in Thrace deserve further attention and research.</p>\",\n \"<p>In addition, the findings related to vaccination coverage, and specific disease rate could assist in understanding/explaining the regional mortality differences noted. In particular, the lower vaccination coverage observed in Thrace could be associated with increased mortality due to meningitis, and epiglottiditis.</p>\",\n \"<p>However, other risk factors should be explored (genetic, lifestyle, occupational and environmental exposures) [##REF##12826634##9##,##REF##15851646##10##]. In addition, the high percentage of a Muslim minority in Thrace could represent a possible factor associated with increased mortality risk, but this hypothesis is not being supported by several studies which reported that at least for some types of cancer (breast, endometrial, ovarian) Muslims recorded significantly lower mortality rate in comparison to Christians Orthodox [##REF##10580674##5##, ####REF##10726626##6##, ##REF##10949400##7####10949400##7##]. In addition, a study conducted in the prefecture of Xanthi (Thrace) revealed that Muslims present lower incidence rate of ischemic stroke than Christians. Also the outcome of hospitalization due to stroke did not differ significantly by religion [##REF##16623617##11##].</p>\",\n \"<p>It should be stressed that Thrace was partly except from the population exchange following the end of the Greek-Turkish war in 1922. Furthermore, there has been a significant amount of migration within Greece during the recent decades. It is possible that some of this will have been selective with healthier folk moving to healthier areas. However, if net migration patterns play a role regarding increased mortality in this region has to be confirmed by further research.</p>\",\n \"<p>There appears to be a south to north trend in increasing mortality risk, but this trend was not reflected in the putative risk factor data.</p>\",\n \"<p>Our study has some limitations by being descriptive, thus we can not provide information on causal associations between mortality and several possible risk factors. An additional limitation was the absence of regional data (e.g. on smoking habit, and diet). However, we performed multivariate statistical analysis, and – in part-some speculations have been statistically tested.</p>\"\n]","isConversational":false},"conclusion":{"kind":"list like","value":["<title>Conclusion</title>","<p>Thrace presented the highest mortality risk among 10 regions in Greece, and in particular at age groups < 1 year; 1–4, and 5–14 years.</p>","<p>Further statistical analysis revealed that the low GDP and low ratio of doctors per population were significantly associated with the increase mortality in this region which could have important public health implications. The findings observed deserve further attention and research given that Thrace has a special geographic characteristic: it represents a \"bridge-link\" between two continents since it stands between Europe and Asia.</p>"],"string":"[\n \"<title>Conclusion</title>\",\n \"<p>Thrace presented the highest mortality risk among 10 regions in Greece, and in particular at age groups < 1 year; 1–4, and 5–14 years.</p>\",\n \"<p>Further statistical analysis revealed that the low GDP and low ratio of doctors per population were significantly associated with the increase mortality in this region which could have important public health implications. The findings observed deserve further attention and research given that Thrace has a special geographic characteristic: it represents a \\\"bridge-link\\\" between two continents since it stands between Europe and Asia.</p>\"\n]","isConversational":false},"front":{"kind":"list like","value":["<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>","<title>Background</title>","<p>Mortality differences at national level can generate hypothesis on possible causal association that could be further investigated. The aim of the present study was to identify regions with high mortality rates in Greece.</p>","<title>Methods</title>","<p>Age adjusted specific mortality rates by gender were calculated in each of the 10 regions of Greece during the period 1984–2004. Moreover standardized mortality rates (SMR) were also calculated by using population census data of years 1981, 1991, 2001. The mortality rates were examined in relation to GDP per capita, the ratio of hospital beds, and doctors per population for each region.</p>","<title>Results</title>","<p>During the study period, the region of Thrace recorded the highest mortality rate at almost all age groups in both sexes among the ten Greek regions. Thrace had one of the lowest GDP per capita (11 123 Euro) and recorded low ratios of Physicians (284) per 100 000 inhabitants in comparison to the national ratios. Moreover the ratio of hospital beds per population was in Thrace very low (268/100 000) in comparison to the national ratio (470/100 000). Thrace is the Greek region with the highest percentage of Muslim population (33%). Multivariate analysis revealed that GDP and doctors/100000 inhabitants were associated with increased mortality in Thrace.</p>","<title>Conclusion</title>","<p>Thrace is the region with the highest mortality rate in Greece. Further research is needed to assess the contribution of each possible risk factor to the increased mortality rate of Thrace which could have important public health implications.</p>"],"string":"[\n \"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://creativecommons.org/licenses/by/2.0\\\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>\",\n \"<title>Background</title>\",\n \"<p>Mortality differences at national level can generate hypothesis on possible causal association that could be further investigated. The aim of the present study was to identify regions with high mortality rates in Greece.</p>\",\n \"<title>Methods</title>\",\n \"<p>Age adjusted specific mortality rates by gender were calculated in each of the 10 regions of Greece during the period 1984–2004. Moreover standardized mortality rates (SMR) were also calculated by using population census data of years 1981, 1991, 2001. The mortality rates were examined in relation to GDP per capita, the ratio of hospital beds, and doctors per population for each region.</p>\",\n \"<title>Results</title>\",\n \"<p>During the study period, the region of Thrace recorded the highest mortality rate at almost all age groups in both sexes among the ten Greek regions. Thrace had one of the lowest GDP per capita (11 123 Euro) and recorded low ratios of Physicians (284) per 100 000 inhabitants in comparison to the national ratios. Moreover the ratio of hospital beds per population was in Thrace very low (268/100 000) in comparison to the national ratio (470/100 000). Thrace is the Greek region with the highest percentage of Muslim population (33%). Multivariate analysis revealed that GDP and doctors/100000 inhabitants were associated with increased mortality in Thrace.</p>\",\n \"<title>Conclusion</title>\",\n \"<p>Thrace is the region with the highest mortality rate in Greece. Further research is needed to assess the contribution of each possible risk factor to the increased mortality rate of Thrace which could have important public health implications.</p>\"\n]","isConversational":false},"body":{"kind":"list like","value":["<title>Competing interests</title>","<p>The authors declare that they have no competing interests.</p>","<title>Authors' contributions</title>","<p>PP participated to study design, data collection, statistical analysis, and manuscript preparation. GR participated to statistical analysis, preparation, and revision of the manuscript. KP participated to data collection, and preparation of the manuscript. CZ participated to study design, statistical analysis, and preparation of the manuscript. CH participated to and supervised study design, collection of data, statistical analysis, preparation, and revision of the manuscript. All authors read and approved the final form of the manuscript.</p>","<title>Pre-publication history</title>","<p>The pre-publication history for this paper can be accessed here:</p>","<p><ext-link ext-link-type=\"uri\" xlink:href=\"http://www.biomedcentral.com/1471-2458/8/297/prepub\"/></p>"],"string":"[\n \"<title>Competing interests</title>\",\n \"<p>The authors declare that they have no competing interests.</p>\",\n \"<title>Authors' contributions</title>\",\n \"<p>PP participated to study design, data collection, statistical analysis, and manuscript preparation. GR participated to statistical analysis, preparation, and revision of the manuscript. KP participated to data collection, and preparation of the manuscript. CZ participated to study design, statistical analysis, and preparation of the manuscript. CH participated to and supervised study design, collection of data, statistical analysis, preparation, and revision of the manuscript. All authors read and approved the final form of the manuscript.</p>\",\n \"<title>Pre-publication history</title>\",\n \"<p>The pre-publication history for this paper can be accessed here:</p>\",\n \"<p><ext-link ext-link-type=\\\"uri\\\" xlink:href=\\\"http://www.biomedcentral.com/1471-2458/8/297/prepub\\\"/></p>\"\n]","isConversational":false},"back":{"kind":"list like","value":[],"string":"[]","isConversational":false},"figure":{"kind":"list like","value":["<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Regional distribution of mortality risk in males, Greece (1984–2004).</p></caption></fig>","<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Regional distribution of mortality risk in females, Greece (1984–2004).</p></caption></fig>"],"string":"[\n \"<fig position=\\\"float\\\" id=\\\"F1\\\"><label>Figure 1</label><caption><p>Regional distribution of mortality risk in males, Greece (1984–2004).</p></caption></fig>\",\n \"<fig position=\\\"float\\\" id=\\\"F2\\\"><label>Figure 2</label><caption><p>Regional distribution of mortality risk in females, Greece (1984–2004).</p></caption></fig>\"\n]","isConversational":false},"table":{"kind":"list like","value":["<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Comparison of CDR (age categories: 0–14) with GDP, hospital beds and physicians for both sexes and in all regions (1984–2004).</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Regions</bold></td><td align=\"center\">CDR age < 1 per 100 000 population (median/IQR)</td><td align=\"center\">CDR ages 1–4 per 100 000 population (median/IQR)</td><td align=\"center\">CDR ages 5–14 per 100 000 population (median/IQR)</td><td align=\"center\">Mean GDP per capita in years 2000–2002*</td><td align=\"center\">mean hospital beds/100 000 population years 2001–2002</td><td align=\"center\">mean physicians per 100 000 population years 2001–2002</td></tr></thead><tbody><tr><td align=\"left\"><bold>Greece</bold></td><td align=\"center\"><bold>651 </bold>(500–784)</td><td align=\"center\"><bold>26.28 </bold>(23.09–37.80)</td><td align=\"center\"><bold>16.5 </bold>(15.02–20.06)</td><td align=\"center\"><bold>15411</bold></td><td align=\"center\"><bold>476</bold></td><td align=\"center\"><bold>449</bold></td></tr><tr><td align=\"left\">Hepirus</td><td align=\"center\">570 (308–896)</td><td align=\"center\">36.98 (8.92–51.78)</td><td align=\"center\">17.5 (12.52–20.94)</td><td align=\"center\">11994</td><td align=\"center\">435</td><td align=\"center\">463</td></tr><tr><td align=\"left\">Thessaly</td><td align=\"center\">526 (384–676)</td><td align=\"center\">32.36 (25.17–47.15)</td><td align=\"center\">19.29 (15.99–21.63)</td><td align=\"center\">11754</td><td align=\"center\">410</td><td align=\"center\">332</td></tr><tr><td align=\"left\"><bold>Thrace</bold></td><td align=\"center\"><bold>978 </bold>(828–1311)</td><td align=\"center\"><bold>62.95 </bold>(34.97–83.94)</td><td align=\"center\"><bold>23.21 </bold>(17.09–33.77)</td><td align=\"center\"><bold>10913</bold></td><td align=\"center\"><bold>279</bold></td><td align=\"center\"><bold>328</bold></td></tr><tr><td align=\"left\">Ionian</td><td align=\"center\">454 (317–675)</td><td align=\"center\">37.37 (13.06–52.24)</td><td align=\"center\">17.64 (11.76–19.78)</td><td align=\"center\">16478</td><td align=\"center\">466</td><td align=\"center\">320</td></tr><tr><td align=\"left\">Creta</td><td align=\"center\">567 (391–632)</td><td align=\"center\">23.46 (19.11–34.40)</td><td align=\"center\">19.7 (11.76–20.93)</td><td align=\"center\">14657</td><td align=\"center\">508</td><td align=\"center\">461</td></tr><tr><td align=\"left\">Sterea**</td><td align=\"center\">528 (489–602)</td><td align=\"center\">31.95 (25.21–37.81)</td><td align=\"center\">14.44 (12.49–21.18)</td><td align=\"center\">----</td><td align=\"center\">167</td><td align=\"center\">239</td></tr><tr><td align=\"left\">Macedonian</td><td align=\"center\">648 (445–783)</td><td align=\"center\">29.57 (24.29–33.89)</td><td align=\"center\">17.65 (16.34–20.810</td><td align=\"center\">12512</td><td align=\"center\">496</td><td align=\"center\">427</td></tr><tr><td align=\"left\">Aegean</td><td align=\"center\">422 (383–601)</td><td align=\"center\">24.38 (14.63–39.9)</td><td align=\"center\">15.83 (12.63–22.29)</td><td align=\"center\">15470</td><td align=\"center\">393</td><td align=\"center\">290</td></tr><tr><td align=\"left\">Pelloponess</td><td align=\"center\">635 (259–823)</td><td align=\"center\">29.7 (22.87–38.11)</td><td align=\"center\">15.69 (11.62–21.58)</td><td align=\"center\">12051</td><td align=\"center\">311</td><td align=\"center\">348</td></tr><tr><td align=\"left\">Athens**</td><td align=\"center\">753 (575–983)</td><td align=\"center\">18.54 (14.73–25.28)</td><td align=\"center\">13.62 (11.10–15.10)</td><td align=\"center\">19876<sup>+</sup></td><td align=\"center\">684</td><td align=\"center\">649</td></tr></tbody></table></table-wrap>"],"string":"[\n \"<table-wrap position=\\\"float\\\" id=\\\"T1\\\"><label>Table 1</label><caption><p>Comparison of CDR (age categories: 0–14) with GDP, hospital beds and physicians for both sexes and in all regions (1984–2004).</p></caption><table frame=\\\"hsides\\\" rules=\\\"groups\\\"><thead><tr><td align=\\\"left\\\"><bold>Regions</bold></td><td align=\\\"center\\\">CDR age < 1 per 100 000 population (median/IQR)</td><td align=\\\"center\\\">CDR ages 1–4 per 100 000 population (median/IQR)</td><td align=\\\"center\\\">CDR ages 5–14 per 100 000 population (median/IQR)</td><td align=\\\"center\\\">Mean GDP per capita in years 2000–2002*</td><td align=\\\"center\\\">mean hospital beds/100 000 population years 2001–2002</td><td align=\\\"center\\\">mean physicians per 100 000 population years 2001–2002</td></tr></thead><tbody><tr><td align=\\\"left\\\"><bold>Greece</bold></td><td align=\\\"center\\\"><bold>651 </bold>(500–784)</td><td align=\\\"center\\\"><bold>26.28 </bold>(23.09–37.80)</td><td align=\\\"center\\\"><bold>16.5 </bold>(15.02–20.06)</td><td align=\\\"center\\\"><bold>15411</bold></td><td align=\\\"center\\\"><bold>476</bold></td><td align=\\\"center\\\"><bold>449</bold></td></tr><tr><td align=\\\"left\\\">Hepirus</td><td align=\\\"center\\\">570 (308–896)</td><td align=\\\"center\\\">36.98 (8.92–51.78)</td><td align=\\\"center\\\">17.5 (12.52–20.94)</td><td align=\\\"center\\\">11994</td><td align=\\\"center\\\">435</td><td align=\\\"center\\\">463</td></tr><tr><td align=\\\"left\\\">Thessaly</td><td align=\\\"center\\\">526 (384–676)</td><td align=\\\"center\\\">32.36 (25.17–47.15)</td><td align=\\\"center\\\">19.29 (15.99–21.63)</td><td align=\\\"center\\\">11754</td><td align=\\\"center\\\">410</td><td align=\\\"center\\\">332</td></tr><tr><td align=\\\"left\\\"><bold>Thrace</bold></td><td align=\\\"center\\\"><bold>978 </bold>(828–1311)</td><td align=\\\"center\\\"><bold>62.95 </bold>(34.97–83.94)</td><td align=\\\"center\\\"><bold>23.21 </bold>(17.09–33.77)</td><td align=\\\"center\\\"><bold>10913</bold></td><td align=\\\"center\\\"><bold>279</bold></td><td align=\\\"center\\\"><bold>328</bold></td></tr><tr><td align=\\\"left\\\">Ionian</td><td align=\\\"center\\\">454 (317–675)</td><td align=\\\"center\\\">37.37 (13.06–52.24)</td><td align=\\\"center\\\">17.64 (11.76–19.78)</td><td align=\\\"center\\\">16478</td><td align=\\\"center\\\">466</td><td align=\\\"center\\\">320</td></tr><tr><td align=\\\"left\\\">Creta</td><td align=\\\"center\\\">567 (391–632)</td><td align=\\\"center\\\">23.46 (19.11–34.40)</td><td align=\\\"center\\\">19.7 (11.76–20.93)</td><td align=\\\"center\\\">14657</td><td align=\\\"center\\\">508</td><td align=\\\"center\\\">461</td></tr><tr><td align=\\\"left\\\">Sterea**</td><td align=\\\"center\\\">528 (489–602)</td><td align=\\\"center\\\">31.95 (25.21–37.81)</td><td align=\\\"center\\\">14.44 (12.49–21.18)</td><td align=\\\"center\\\">----</td><td align=\\\"center\\\">167</td><td align=\\\"center\\\">239</td></tr><tr><td align=\\\"left\\\">Macedonian</td><td align=\\\"center\\\">648 (445–783)</td><td align=\\\"center\\\">29.57 (24.29–33.89)</td><td align=\\\"center\\\">17.65 (16.34–20.810</td><td align=\\\"center\\\">12512</td><td align=\\\"center\\\">496</td><td align=\\\"center\\\">427</td></tr><tr><td align=\\\"left\\\">Aegean</td><td align=\\\"center\\\">422 (383–601)</td><td align=\\\"center\\\">24.38 (14.63–39.9)</td><td align=\\\"center\\\">15.83 (12.63–22.29)</td><td align=\\\"center\\\">15470</td><td align=\\\"center\\\">393</td><td align=\\\"center\\\">290</td></tr><tr><td align=\\\"left\\\">Pelloponess</td><td align=\\\"center\\\">635 (259–823)</td><td align=\\\"center\\\">29.7 (22.87–38.11)</td><td align=\\\"center\\\">15.69 (11.62–21.58)</td><td align=\\\"center\\\">12051</td><td align=\\\"center\\\">311</td><td align=\\\"center\\\">348</td></tr><tr><td align=\\\"left\\\">Athens**</td><td align=\\\"center\\\">753 (575–983)</td><td align=\\\"center\\\">18.54 (14.73–25.28)</td><td align=\\\"center\\\">13.62 (11.10–15.10)</td><td align=\\\"center\\\">19876<sup>+</sup></td><td align=\\\"center\\\">684</td><td align=\\\"center\\\">649</td></tr></tbody></table></table-wrap>\"\n]","isConversational":false},"formula":{"kind":"list like","value":[],"string":"[]","isConversational":false},"box":{"kind":"list like","value":[],"string":"[]","isConversational":false},"code":{"kind":"list like","value":[],"string":"[]","isConversational":false},"quote":{"kind":"list like","value":[],"string":"[]","isConversational":false},"chemical":{"kind":"list like","value":[],"string":"[]","isConversational":false},"supplementary":{"kind":"list like","value":[],"string":"[]","isConversational":false},"footnote":{"kind":"list like","value":["<table-wrap-foot><p>*Gross domestic product, in euro (€).</p><p>**in some regions data were not available</p><p>+Data for the region of Attica in which Athens is included</p></table-wrap-foot>"],"string":"[\n \"<table-wrap-foot><p>*Gross domestic product, in euro (€).</p><p>**in some regions data were not available</p><p>+Data for the region of Attica in which Athens is included</p></table-wrap-foot>\"\n]","isConversational":false},"graphic":{"kind":"list like","value":["<graphic xlink:href=\"1471-2458-8-297-1\"/>","<graphic xlink:href=\"1471-2458-8-297-2\"/>"],"string":"[\n \"<graphic xlink:href=\\\"1471-2458-8-297-1\\\"/>\",\n \"<graphic xlink:href=\\\"1471-2458-8-297-2\\\"/>\"\n]","isConversational":false},"media":{"kind":"list like","value":[],"string":"[]","isConversational":false},"unknown_pub":{"kind":"string","value":"[{\"surname\": [\"Carstairs\", \"Elliott P, Wakefield JC, Best NG, Brigss DJ\"], \"given-names\": [\"V\"], \"article-title\": [\"Socioeconomic factors at area level and their relationship with health\"], \"source\": [\"Spatial epidemiology Methods and applications\"], \"year\": [\"2000\"], \"publisher-name\": [\"Oxford: Oxford University Press\"]}, {\"collab\": [\"US census bureau\"], \"source\": [\"Variations in State Mortality from 1960 to 1990\"], \"comment\": [\"Access 3/2/2007\"]}, {\"article-title\": [\"General secretariat of national statistical service of Greece\"], \"comment\": [\"Access 10/1/2007\"]}]"},"glossary":{"kind":"string","value":"{\n \"acronym\": [],\n \"definition\": []\n}"},"n_references":{"kind":"number","value":11,"string":"11"},"license":{"kind":"string","value":"CC BY"},"retracted":{"kind":"string","value":"no"},"last_updated":{"kind":"string","value":"2022-01-12 14:47:38"},"citation":{"kind":"string","value":"BMC Public Health. 2008 Aug 23; 8:297"},"package_file":{"kind":"string","value":"oa_package/5d/7e/PMC2538537.tar.gz"}}}],"truncated":false,"partial":true},"paginationData":{"pageIndex":1196,"numItemsPerPage":100,"numTotalItems":120000,"offset":119600,"length":100}},"jwt":"eyJhbGciOiJFZERTQSJ9.eyJyZWFkIjp0cnVlLCJwZXJtaXNzaW9ucyI6eyJyZXBvLmNvbnRlbnQucmVhZCI6dHJ1ZX0sImlhdCI6MTc3NjMzNDQzMywic3ViIjoiL2RhdGFzZXRzL1RvbVRCVC9wbWNfb3Blbl9hY2Nlc3NfeG1sIiwiZXhwIjoxNzc2MzM4MDMzLCJpc3MiOiJodHRwczovL2h1Z2dpbmdmYWNlLmNvIn0.IgBzeT7_3W8mQfhiKeL5G5PlzJziwSX6t63OPElNyP1Eql5wG7n5Ov57OYlp8UWrm1-nXy8FOC6wrXsLZ6aSAQ","displayUrls":true,"splitSizeSummaries":[{"config":"commercial","split":"train","numRows":120000,"numBytesParquet":2058504704},{"config":"non_commercial","split":"train","numRows":167000,"numBytesParquet":2229724384},{"config":"other","split":"train","numRows":166000,"numBytesParquet":2181079699}]},"discussionsStats":{"closed":1,"open":1,"total":2},"fullWidth":true,"hasGatedAccess":true,"hasFullAccess":true,"isEmbedded":false,"savedQueries":{"community":[],"user":[]}}">
accession_id stringlengths 9 11 | pmid stringlengths 1 8 | introduction listlengths 0 213 | methods listlengths 0 389 | results listlengths 0 2.61k | discussion listlengths 0 371 | conclusion listlengths 0 229 | front listlengths 0 66 | body listlengths 0 2.64k | back listlengths 0 550 | figure listlengths 0 370 | table listlengths 0 999 | formula listlengths 0 2.66k | box listlengths 0 58 | code listlengths 0 10 | quote listlengths 0 105 | chemical listlengths 0 0 | supplementary listlengths 0 74 | footnote listlengths 0 37 | graphic listlengths 0 2.41k | media listlengths 0 74 | unknown_pub stringlengths 2 363k | glossary dict | n_references int32 0 1.35k | license stringclasses 4
values | retracted stringclasses 2
values | last_updated stringlengths 19 19 | citation stringlengths 14 89 | package_file stringlengths 0 35 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
PMC2535827 | 18815617 | [
"<title>1. PHOTODYNAMIC THERAPY: BACKGROUND</title>",
"<p>The use of light in the treatment of disease has been known for many centuries and can be traced\nback over 4000 years to the ancient Egyptians [##REF##3064295##1##]. The Egyptian people used a \ncombination of the orally ingested Amni Majus plant and sunl... | [] | [] | [] | [] | [
"<p>Recommended by Michael J. Cook</p>",
"<p>Photodynamic therapy (PDT) is a treatment modality that has been used in the successful treatment of a number of diseases and disorders, including age-related macular degeneration (AMD), psoriasis, and certain cancers. PDT uses a combination of a selectively localised ... | [
"<title>2. HISTORY OF PHOTODYNAMIC THERAPY</title>",
"<p>Reports of contemporary photodynamic therapy came first in the investigations led by\nFinsen in the late nineteenth century [##UREF##3##8##]. \nFinsen successfully demonstrated phototherapy by employing heat-filtered light from a carbon-arc lamp (the “Finse... | [
"<title>GLOSSARY</title>",
"<p>\nAMD is the leading cause of blindness in humans over the age of 50. AMD is characterised by a rapid growth of abnormal blood vessels under the central retina causing scarring, and an accelerated loss of visual acuity [##UREF##30##58##].</p>",
"<p>Chemosensitisers are drugs or ch... | [
"<fig id=\"fig1\" position=\"float\"><label>Figure 1</label><caption><p>Structure of psoralen.</p></caption></fig>",
"<fig id=\"fig2\" position=\"float\"><label>Figure 2</label><caption><p>Photosensitiser administration.</p></caption></fig>",
"<fig id=\"fig3\" position=\"float\"><label>Figure 3</label><caption>... | [
"<table-wrap id=\"tab1\" position=\"float\"><label>Table 1</label><caption><p>Quantum triplet yields\nof texaphyrin metallated with paramagnetic and diamagnetic lanthanides (data reproduced from [##UREF##53##97##]).</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><th align=\"left\" rowspan=\"1\" co... | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"MBD2008-276109.001\"/>",
"<graphic xlink:href=\"MBD2008-276109.002\"/>",
"<graphic xlink:href=\"MBD2008-276109.003\"/>",
"<graphic xlink:href=\"MBD2008-276109.004\"/>",
"<graphic xlink:href=\"MBD2008-276109.boxx1\"/>",
"<graphic xlink:href=\"MBD2008-276109.005\"/>",
"<graphic xlin... | [] | [{"label": ["2"], "surname": ["Sternberg", "Dolphin", "Br\u00fcckner"], "given-names": ["ED", "D", "C"], "article-title": ["Porphyrin-based photosensitizers for use in photodynamic therapy"], "italic": ["Tetrahedron"], "year": ["1998"], "volume": ["54"], "issue": ["17"], "fpage": ["4151"], "lpage": ["4202"]}, {"label":... | {
"acronym": [],
"definition": []
} | 135 | CC BY | no | 2022-01-13 02:58:25 | Met Based Drugs. 2008 Sep 11; 2008:276109 | oa_package/59/be/PMC2535827.tar.gz |
PMC2535831 | 18810273 | [] | [] | [] | [] | [] | [] | [
"<p>Treatment of diseases with natural and synthetic\nmaterials has been an aspiration of mankind since the dawn of human\ndevelopment. From the use of willow-bark to the marketing\nof aspirin, a steady move from folk remedies to the use of chemistry and biology\nto develop new therapies has been observed.\nIn term... | [] | [] | [] | [] | [] | [] | [] | [] | [] | [] | [] | [] | [] | {
"acronym": [],
"definition": []
} | 0 | CC BY | no | 2022-01-13 02:58:25 | Met Based Drugs. 2008 Sep 11; 2008:286363 | oa_package/82/2f/PMC2535831.tar.gz |
PMC2535837 | 18978999 | [] | [] | [] | [
"<title>Discussion</title>",
"<p>The protocol presented here provides researchers with a concise, easy-to-follow outline of how to obtain thin cryostat sections of small, difficult-to-manage, tissue pieces, such as biopsies and brain slices for further studies to be performed, such as various staining methods, in... | [] | [
"<p>Correspondence to: Miles G. Cunningham at <email>mcunningham@mclean.harvard.edu</email></p>",
"<p>Many investigations in neuroscience, as well as other disciplines, involve studying small, yet macroscopic pieces or sections of tissue that have been preserved, freshly removed, or excised but kept viable, as in... | [
"<title>Protocol</title>",
"<p>Prepare mold from tape for OCT platform.</p>",
"<p>Fill mold with OCT. Freeze within cryostat or by using crushed dry ice.</p>",
"<p>Remove tape from around frozen OCT platform.</p>",
"<p>Align marks on freezing chuck and cryostat mounting stage and lock in chuck.</p>",
"<p>... | [] | [
"<fig id=\"Fig_194\" position=\"anchor\"><alternatives></alternatives></fig>"
] | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"jove-3-194-thumb\"/>"
] | [
"<media id=\"Video_194\" xlink:href=\"jove-3-194.flv\" xlink:type=\"simple\" position=\"anchor\" mimetype=\"text\" mime-subtype=\"plain\"/>"
] | [{"surname": ["Scoutern", "O'Connor", "Cunningham"], "given-names": ["CW", "R", "M"], "article-title": ["Perfusion fixation of research animals"], "source": ["Microsc. Today"], "year": ["2006"], "volume": ["14"], "fpage": ["26"], "lpage": ["33"]}, {"surname": ["Cunningham", "Connor", "Zhang", "Benes"], "given-names": [... | {
"acronym": [],
"definition": []
} | 2 | CC BY | no | 2022-01-12 15:11:34 | J Vis Exp. 2007 Apr 28;(3):194 | oa_package/76/46/PMC2535837.tar.gz |
PMC2535898 | 18795143 | [
"<title>Introduction</title>",
"<p>Mutations causing gene fusions, loss of function or misregulation of transcriptional corepressor proteins have been implicated both in genetically inherited diseases and cancer ##REF##17609497##[1]##, ##REF##16390317##[2]##. BCOR (BCL6 corepressor) is a transcriptional corepress... | [
"<title>Materials and Methods</title>",
"<title>Animals</title>",
"<p>All experimental protocols involving mice described in this publication have been approved by the University of Minnesota Institutional Animal Care and Use Committee. The mice were not kept in specific pathogen free (SPF) rodent housing, thus... | [
"<title>Results</title>",
"<title>Generation and analysis of a conditional <italic>Bcor</italic> allele</title>",
"<p>To investigate the role of the X-linked <italic>Bcor</italic> gene in development, we generated a conditional <italic>Bcor</italic> allele, <italic>Bcor<sup>Fl</sup></italic>, in which exon 3 is... | [
"<title>Discussion</title>",
"<p>In this study we have used a combination of mouse molecular genetics and ES cell differentiation to identify roles of <italic>Bcor</italic> in early development. These studies provide insights into the possible causes of male embryonic lethality in OFCD, the hematopoietic phenotyp... | [] | [
"<p>Conceived and designed the experiments: JAW CMC AMK VJB. Performed the experiments: JAW CMC AMK. Analyzed the data: JAW CMC VJB. Wrote the paper: JAW AMK VJB.</p>",
"<p>\n<italic>Bcor</italic> (BCL6 corepressor) is a widely expressed gene that is mutated in patients with X-linked Oculofaciocardiodental (OFCD)... | [
"<title>Supporting Information</title>"
] | [
"<p>We thank members of the Zarkower and Bardwell labs for many helpful discussions; Anna Petryk and Lisa Schimmenti for help in initially characterizing our chimeric mice; Erick Mendenhall and Meri Firpo for insights into differentiating mouse embryonic stem cells; Laura Bursch, Troy Baldwin and Keli Hippen for he... | [
"<fig id=\"pone-0002814-g001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pone.0002814.g001</object-id><label>Figure 1</label><caption><title>Generating <italic>Bcor</italic>\n<sup>Δ</sup>\n<sup><italic>3</italic>/+</sup> and <italic>Bcor</italic>\n<sup>Δ</sup>\n<sup><italic>3/Y</italic></sup... | [] | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"pone.0002814.s001\"><label>Figure S1</label><caption><p>Analysis of splicing pattern in <italic>BcorNeo/Y</italic> and <italic>BcorGt/Y</italic> ES cells. (A) Clone 2B1 ES cells, containing the <italic>BcorNeo/Y</italic> allele, aberrantly splice two portion... | [
"<fn-group><fn fn-type=\"COI-statement\"><p><bold>Competing Interests: </bold>The authors have declared that no competing interests exist.</p></fn><fn fn-type=\"financial-disclosure\"><p><bold>Funding: </bold>Funding for this work was provided by NCI (R01 CA071540), NIH (T32DE07288) and the University of Minnesota ... | [
"<graphic xlink:href=\"pone.0002814.g001\"/>",
"<graphic xlink:href=\"pone.0002814.g002\"/>",
"<graphic xlink:href=\"pone.0002814.g003\"/>",
"<graphic xlink:href=\"pone.0002814.g004\"/>",
"<graphic xlink:href=\"pone.0002814.g005\"/>"
] | [
"<media xlink:href=\"pone.0002814.s001.tif\"><caption><p>Click here for additional data file.</p></caption></media>"
] | [{"label": ["19"], "element-citation": ["\n"], "surname": ["Hilton", "Black", "Bardwell", "Epstein"], "given-names": ["E", "GC", "VJ", "C"], "year": ["2008"], "article-title": ["The BCL-6 corepressor (BCOR) and Oculofaciocardiodental syndrome."], "publisher-name": ["Inborn Errors of Development: Oxford University Press... | {
"acronym": [],
"definition": []
} | 66 | CC BY | no | 2022-01-13 07:13:51 | PLoS One. 2008 Jul 30; 3(7):e2814 | oa_package/dd/15/PMC2535898.tar.gz |
PMC2535941 | 18554333 | [
"<title>Introduction</title>",
"<p><italic>Myxococcus xanthus</italic> is a Gram-negative bacterium that has a complex life cycle that involves vegetative swarming, predation and fruiting body formation (##REF##11207714##Reichenbach, 1999##; ##REF##10547700##Shimkets, 1999##; ##REF##15040179##Kaiser, 2003##; ##RE... | [] | [
"<title>Results</title>",
"<title>Methylation of FrzCD <italic>in vitro</italic> using purified FrzF and FrzF<sup>CheR</sup></title>",
"<p>Previous work showed that methylation of FrzCD is required for swarming and fruiting body formation in <italic>M. xanthus</italic> and that methylation is mediated by FrzF (... | [
"<title>Discussion</title>",
"<p>FrzCD, the principal MCP for the Frz chemosensory pathway, plays a central role in regulating cellular motility and behaviour in <italic>M. xanthus</italic>. Previous studies showed that methylation of FrzCD by FrzF is critical to function of FrzCD, as cells lacking FrzF, the unus... | [] | [
"<p>Re-use of this article is permitted in accordance with the Creative Commons Deed, Attribution 2.5, which does not permit commercial exploitation.</p>",
"<p><italic>Myxococcus xanthus</italic> is a gliding bacterium with a complex life cycle that includes swarming, predation and fruiting body formation. Direct... | [
"<title>Experimental procedures</title>",
"<title>Bacterial strains and culture conditions</title>",
"<p>The strains used in this study are listed in ##TAB##4##Table 5##. <italic>M. xanthus</italic> was grown in CYE medium, which contains 10 mM morpholinepropanesulphonic acid (MOPs, pH 7.6), 1% (w/v) Bacto Casi... | [
"<p>We would like to acknowledge the contributions of Vivian Trang who isolated several point mutant strains. We would like to thank Lori Kohlstaedt (UC Berkeley Mass Spectrometry Facility) for mass spectrometry help and advice. We would like to thank Zusman lab and the Andrews lab past and present specifically Yuk... | [
"<fig id=\"fig01\" position=\"float\"><label>Fig. 1</label><caption><p>Methylation of FrzCD by FrzF and FrzF<sup>CheR</sup><italic>in vitro</italic>.</p><p>A. Cartoons show the domain organization of the wild-type FrzF protein and the FrzF<sup>CheR</sup> protein, which lacks FrzF amino acids 450–580. TPR indicates ... | [
"<table-wrap id=\"tbl1\" position=\"float\"><label>Table 1</label><caption><p>Ions from MS/MS spectrum of a chymotryptic fragment<xref ref-type=\"table-fn\" rid=\"tf1-1\">a</xref> of FrzCD show FrzF methylates site E182.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><th align=\"left\" rowspan=\"1... | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"SD1\"></supplementary-material>"
] | [
"<table-wrap-foot><fn id=\"tf1-1\"><label>a</label><p>No ions were observed for residues <sub>157</sub>AASTQHETSSTEQAAA172 of the chymotryptic peptide <sub>157</sub>AASTQHETSSTEQAAAIHETTATMEEL<sub>183</sub> (##SUPPL##0##Fig. S2##), so these residues were removed from the left column for simplicity.</p></fn><fn id=\... | [
"<graphic xlink:href=\"mmi0069-0724-f1\"/>",
"<graphic xlink:href=\"mmi0069-0724-f2\"/>",
"<graphic xlink:href=\"mmi0069-0724-f3\"/>",
"<graphic xlink:href=\"mmi0069-0724-f4\"/>",
"<graphic xlink:href=\"mmi0069-0724-f5\"/>"
] | [
"<media xlink:href=\"mmi0069-0724-SD1.pdf\" xlink:type=\"simple\" id=\"N0x1c937e0N0x3579e70\" position=\"anchor\" mimetype=\"application\" mime-subtype=\"pdf\"/>"
] | [{"surname": ["Astling"], "given-names": ["DP"], "source": ["Novel regulatory mechanisms of a chemotaxis pathway in the gliding bacterium "], "italic": ["Myxococcus xanthus"], "year": ["2003"], "publisher-loc": ["Berkeley, CA"], "publisher-name": ["University of California"], "fpage": ["60"], "lpage": ["93"], "comment"... | {
"acronym": [],
"definition": []
} | 42 | CC BY | no | 2022-01-12 15:46:15 | Mol Microbiol. 2008 Aug 19; 69(3):724-735 | oa_package/90/6b/PMC2535941.tar.gz |
PMC2536507 | 18815618 | [
"<title>1. INTRODUCTION</title>",
"<p>Organ\ntransplantation in the clinic became a reality in 1954 when Merrill, Murray,\nand Harrison performed the first successful human vascular organ graft, a\nkidney transplant [##REF##13278189##1##, ##REF##6371266##2##]. However, the donor\nand recipient were monozygotic tw... | [] | [] | [] | [] | [
"<p>Recommended by Eiji Matsuura</p>",
"<p>Transplantation of allogeneic organs has proven to be an effective therapeutic for a large variety of disease states, but the chronic immunosuppression that is required for organ allograft survival increases the risk for infection and neoplasia and has direct organ toxic... | [
"<title>2. CENTRAL TRANSPLANTATION TOLERANCE</title>",
"<p>In\n1953, Peter Medawar et al. obtained the first experimental evidence that the\nestablishment of allogeneic hematopoietic chimerism leads to the induction of central\ntolerance and permits permanent acceptance of skin allografts [##REF##13099277##13##].... | [
"<title>ACKNOWLEDGMENTS</title>",
"<p>This \nwork is supported in part by the National Institutes of Health Research Grant\nno. AI42669, the American Diabetes Association Grant no. 7-05-PST-02, the\nJuvenile Diabetes Research Foundation, and a Diabetes Endocrinology Center\nResearch Grant\nDK32520 from the Nation... | [
"<fig id=\"fig1\" position=\"float\"><label>Figure 1</label><caption><p>\n<italic>Costimulation blockade</italic>. Activation of a T cell involves a series of interactive steps with an APC. The first signal imparts antigen specificity and commences when the TCR engages the antigen/MHC complex presented by the APC. ... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"CDI2008-742810.001\"/>",
"<graphic xlink:href=\"CDI2008-742810.002\"/>",
"<graphic xlink:href=\"CDI2008-742810.003\"/>",
"<graphic xlink:href=\"CDI2008-742810.004\"/>",
"<graphic xlink:href=\"CDI2008-742810.005\"/>"
] | [] | [{"label": ["3"], "surname": ["Merrill"], "given-names": ["JP"], "article-title": ["Transplantation immunology 1957\u20131975"], "italic": ["Annales d'Immunologie"], "year": ["1978"], "volume": ["129"], "issue": ["2-3"], "fpage": ["347"], "lpage": ["352"]}, {"label": ["15"], "surname": ["Burnet", "Fenner"], "given-name... | {
"acronym": [
"APC:",
"BMT:",
"CARD:",
"CARDIF:",
"cDC:",
"CTL:",
"DC:",
"DAI:",
"dsRNA:",
"DST:",
"GP:",
"GVHD:",
"IFN:",
"IKK:",
"IKK-I:",
"IPS-1:",
"IRAK:",
"IRF:",
"ISRE:",
"LCMV:",
"mAb:",
"MAVS:",
"MDA5:",
"MCMV:",
... | 130 | CC BY | no | 2022-01-13 01:53:32 | Clin Dev Immunol. 2008 Sep 14; 2008:742810 | oa_package/7a/aa/PMC2536507.tar.gz |
PMC2536508 | 18795145 | [] | [] | [] | [] | [] | [] | [
"<p>Each year, the International Society for Computational Biology (ISCB; <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.iscb.org\">http://www.iscb.org</ext-link>) gives two major awards to leaders and innovators in the field of bioinformatics. The awards committee, composed of current and past directors o... | [] | [
"<fig id=\"pcbi-1000101-g001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pcbi.1000101.g001</object-id><label>Image 1</label><caption><p>David Haussler</p></caption></fig>",
"<fig id=\"pcbi-1000101-g002\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pcbi.1000101.g002</o... | [] | [] | [] | [] | [] | [] | [] | [
"<fn-group><fn fn-type=\"COI-statement\"><p>The authors have declared that no competing interests exist.</p></fn><fn fn-type=\"financial-disclosure\"><p>CS was paid by ISCB to write this article.</p></fn></fn-group>"
] | [
"<graphic xlink:href=\"pcbi.1000101.g001\"/>",
"<graphic xlink:href=\"pcbi.1000101.g002\"/>"
] | [] | [] | {
"acronym": [],
"definition": []
} | 0 | CC BY | no | 2022-01-13 00:55:03 | PLoS Comput Biol. 2008 Jul 18; 4(7):e1000101 | oa_package/44/01/PMC2536508.tar.gz |
PMC2536509 | 18795146 | [
"<title>Introduction</title>",
"<p>Control theoretic tools have been used to model mRNA transcriptional/translational regulatory feedback mechanisms ##UREF##0##[1]##, to analyze nonlinear phenomena ##REF##17158515##[2]##,##REF##15340155##[3]##, and to control complex biological behavior ##UREF##1##[4]##,##UREF##2... | [
"<title>Methods</title>",
"<p>A 10-state <italic>Drosophila melanogaster</italic> circadian limit cycle oscillator serves as the model system. This model consists of two coupled auto-regulatory transcription/translation negative feedback loops that characterize <italic>period</italic> and <italic>timeless</italic... | [
"<title>Results</title>",
"<p>A 10-state, 38-parameter <italic>Drosophila melanogaster</italic> (fruit fly) circadian model serves as the example system. This stable nonlinear limit cycle oscillator consists of two coupled negative feedback loops that characterize the transcriptional regulation of <italic>period<... | [
"<title>Discussion</title>",
"<title>Circadian Phase Response</title>",
"<p>As implied by the PRC (##FIG##0##Figure 1##), a 3 hour phase difference may be recovered immediately through admission of light at CT15. Hence, for open-loop control action to be most effective, environmental daylight should occur durin... | [] | [
"<p>Conceived and designed the experiments: NB JS FD. Performed the experiments: NB. Analyzed the data: NB JS FD. Wrote the paper: NB JS FD. Principal Investigator: FD.</p>",
"<p>Circadian entrainment is necessary for rhythmic physiological functions to be appropriately timed over the 24-hour day. Disruption of c... | [
"<title>Supporting Information</title>"
] | [] | [
"<fig id=\"pcbi-1000104-g001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pcbi.1000104.g001</object-id><label>Figure 1</label><caption><title>Circadian phase response behavior.</title><p>Phase response curves traditionally characterize the light pulse to induced phase mapping of the input adm... | [] | [
"<disp-formula></disp-formula>",
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>",
"<disp-formula></disp-formula>",
"<inline-for... | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"pcbi.1000104.s001\"><label>Figure S1</label><caption><p>Open loop phase resetting response at IC9. Phase resetting dynamics for an initial phase difference of 18 hours (or −6 hours) is shown in the blue dotted trajectory; those pertaining to IP6 are reflecte... | [
"<fn-group><fn fn-type=\"COI-statement\"><p>The authors have declared that no competing interests exist.</p></fn><fn fn-type=\"financial-disclosure\"><p>This project was supported in part by the ICB, DAAD19-03-D-0004; NIH, GM078993; The Research Participation Program between the US DOE and AFRL/HEP.</p></fn></fn-gr... | [
"<graphic xlink:href=\"pcbi.1000104.g001\"/>",
"<graphic xlink:href=\"pcbi.1000104.g002\"/>",
"<graphic xlink:href=\"pcbi.1000104.g003\"/>",
"<graphic xlink:href=\"pcbi.1000104.g004\"/>",
"<graphic xlink:href=\"pcbi.1000104.g005\"/>",
"<graphic xlink:href=\"pcbi.1000104.g006\"/>",
"<graphic xlink:href=\... | [
"<media xlink:href=\"pcbi.1000104.s001.eps\"><caption><p>Click here for additional data file.</p></caption></media>",
"<media xlink:href=\"pcbi.1000104.s002.eps\"><caption><p>Click here for additional data file.</p></caption></media>",
"<media xlink:href=\"pcbi.1000104.s003.eps\"><caption><p>Click here for addi... | [{"label": ["1"], "element-citation": ["\n"], "surname": ["Zeilinger", "Farre", "Taylor", "Kay", "Doyle"], "given-names": ["M", "E", "S", "S", "F"], "suffix": ["III"], "year": ["2006"], "article-title": ["A novel computational model of the circadian clock in Arabidopsis that incorporates prr7 and prr9."], "source": ["M... | {
"acronym": [],
"definition": []
} | 43 | CC BY | no | 2022-01-13 00:55:03 | PLoS Comput Biol. 2008 Jul 4; 4(7):e1000104 | oa_package/c8/5f/PMC2536509.tar.gz |
PMC2536510 | 18795147 | [
"<title>Introduction</title>",
"<p>The primary olfactory center of insects, the antennal lobe (AL), is a network of excitatory projection neurons (PNs) interconnected via inhibitory local neurons (LNs). Such excitatory-inhibitory architectures are known to produce network oscillations ##UREF##0##[1]##,##REF##1262... | [
"<title>Methods</title>",
"<title>Neuron Model</title>",
"<p>PNs are modelled as quadratic integrate-and-fire (QIF) neurons ##REF##8697231##[58]##. The evolution of the membrane potential <italic>V</italic> is described by:where <italic>I</italic>\n<sub>syn</sub>(<italic>t</italic>) is the received synaptic cur... | [
"<title>Results</title>",
"<title>Enhancement of Spike Timing Precision with Somatic Injection of Hyperpolarizing Current</title>",
"<p>First, we consider a population of uncoupled PNs modelled as integrate-and-fire neurons with nonlinear spike generating current (Equation 10 with <italic>I</italic>\n<sub>syn</... | [
"<title>Discussion</title>",
"<p>PN synchrony has been observed in the AL of the locust ##REF##17797226##[4]##,##REF##12415296##[5]##, of the bee ##UREF##1##[6]## and the moth ##UREF##2##[7]##,##REF##12006983##[8]##. In <italic>Drosophila</italic>, PNs are inhibited via at least two distinct conductances, GABA<su... | [] | [
"<p>Conceived and designed the experiments: DM. Performed the experiments: DM NM. Analyzed the data: DM NM. Contributed reagents/materials/analysis tools: DM. Wrote the paper: DM.</p>",
"<p>It has been proposed that synchronized neural assemblies in the antennal lobe of insects encode the identity of olfactory st... | [
"<title>Supporting Information</title>"
] | [
"<p>We would like to thank the three anonymous reviewers whose comments improved the paper.</p>"
] | [
"<fig id=\"pcbi-1000139-g001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pcbi.1000139.g001</object-id><label>Figure 1</label><caption><title>Spike timing precision with somatic injection of hyperpolarizing current.</title><p>(A) is for our type 1 model of Projection Neuron (see <xref ref-typ... | [] | [
"<disp-formula><label>(1)</label></disp-formula>",
"<disp-formula><label>(2)</label></disp-formula>",
"<disp-formula><label>(3)</label></disp-formula>",
"<disp-formula><label>(4)</label></disp-formula>",
"<disp-formula><label>(5)</label></disp-formula>",
"<disp-formula><label>(6)</label></disp-formula>",
... | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"pcbi.1000139.s001\"><label>Text S1</label><caption><p>Spike time jitter of the PN population.</p><p>(0.04 MB PDF)</p></caption></supplementary-material>",
"<supplementary-material content-type=\"local-data\" id=\"pcbi.1000139.s002\"><label>Figure S1</label... | [
"<fn-group><fn fn-type=\"COI-statement\"><p>The authors have declared that no competing interests exist.</p></fn><fn fn-type=\"financial-disclosure\"><p>This research was supported by the European network of excellence “General Olfaction and Sensing Projects on a European Level” (<ext-link ext-link-type=\"uri\" xli... | [
"<graphic xlink:href=\"pcbi.1000139.g001\"/>",
"<graphic xlink:href=\"pcbi.1000139.e001.jpg\" mimetype=\"image\" position=\"float\"/>",
"<graphic xlink:href=\"pcbi.1000139.e002.jpg\" mimetype=\"image\" position=\"float\"/>",
"<graphic xlink:href=\"pcbi.1000139.g002\"/>",
"<graphic xlink:href=\"pcbi.1000139.... | [
"<media xlink:href=\"pcbi.1000139.s001.pdf\"><caption><p>Click here for additional data file.</p></caption></media>",
"<media xlink:href=\"pcbi.1000139.s002.pdf\"><caption><p>Click here for additional data file.</p></caption></media>",
"<media xlink:href=\"pcbi.1000139.s003.pdf\"><caption><p>Click here for addi... | [{"label": ["1"], "element-citation": ["\n"], "surname": ["Kopell"], "given-names": ["N"], "year": ["2003"], "article-title": ["We got rhythm: dynamical systems of the nervous system."], "source": ["Not AMS"], "volume": ["47"], "fpage": ["6"], "lpage": ["16"]}, {"label": ["6"], "element-citation": ["\n"], "surname": ["... | {
"acronym": [],
"definition": []
} | 61 | CC BY | no | 2022-01-13 00:55:04 | PLoS Comput Biol. 2008 Aug 1; 4(8):e1000139 | oa_package/2a/00/PMC2536510.tar.gz |
PMC2536511 | 18795148 | [
"<title>Introduction</title>",
"<p>Dementia takes years, if not decades, to develop. It is becoming increasingly clear that effective prevention will require early intervention – that is, prior to the onset of significant neurodegeneration or detectable clinical symptoms. Thus, discovering biomarkers that predict... | [
"<title>Methods</title>",
"<title>Nurses' Health Study</title>",
"<p>The Nurses' Health Study began in 1976, when 121,700 registered female nurses, aged 30 to 55 years, from eleven US states, responded to a mailed questionnaire. To date, 90% follow-up of the cohort has been maintained. For this pilot study, we ... | [
"<title>Results</title>",
"<p>As expected, women with MCI or dementia were slightly older than controls, although the age distribution in this cohort was relatively narrow, and had less education than controls (##TAB##0##Table 1##). Blood pressure was somewhat lower in the cases than controls. On average, mean te... | [
"<title>Discussion</title>",
"<p>These preliminary data are the first to suggest that shorter PBL telomere length is related to combined dementia/MCI diagnosis, as well as to pre-clinical dementia risk, including both MCI and decreased hippocampal volume. Observed relations were independent of age, educational at... | [] | [
"<p>Conceived and designed the experiments: FG MI HR JG ID. Performed the experiments: BH FG MI HR JG ID. Analyzed the data: FG Mv ID. Contributed reagents/materials/analysis tools: HR ID. Wrote the paper: BH FG Mv MI HR JG ID.</p>",
"<title>Background</title>",
"<p>Dementia takes decades to develop, and effect... | [] | [] | [] | [
"<table-wrap id=\"pone-0001590-t001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pone.0001590.t001</object-id><label>Table 1</label><caption><title>Characteristics of Controls, Cases of Mild Cognitive Impairment (MCI), and Cases of Dementia</title></caption><alternatives><table frame=\"hsides... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><fn id=\"nt101\"><label>*</label><p>Odds ratios are adjusted for age and educational attainment.</p></fn><fn id=\"nt102\"><label>†</label><p>Telomere length measured as relative telomere to single gene ratio in peripheral blood leukocytes. Shorter telomere length was defined as below the median in... | [
"<graphic id=\"pone-0001590-t001-1\" xlink:href=\"pone.0001590.t001\"/>",
"<graphic id=\"pone-0001590-t002-2\" xlink:href=\"pone.0001590.t002\"/>"
] | [] | [] | {
"acronym": [],
"definition": []
} | 12 | CC BY | no | 2022-01-13 07:12:45 | PLoS One. 2008 Feb 13; 3(2):e1590 | oa_package/7c/d5/PMC2536511.tar.gz |
PMC2536512 | 18813346 | [
"<title>Introduction</title>",
"<p>Bacterial surface colonisation is a process of critical ecological and economical importance in the marine environment. Initial attachment of the cells and subsequent biofilm formation are the first, important steps in a cascade of recruitment or inhibition events of secondary s... | [
"<title>Materials and Methods</title>",
"<title>Genome sequencing, annotation and analysis</title>",
"<p>The genome of <italic>P. tunicata</italic> strain D2 was sequenced and assembled using a hybrid sequencing strategy and further details are given in Goldberg et al. ##REF##16840556##[16]## . Annotation was p... | [
"<title>Results and Discussion</title>",
"<title>Overall comparison of <italic>Pseudoalteromonas</italic> or <italic>Alteromononas</italic> genomes</title>",
"<p>Hierarchical clustering and principle component analysis of cluster of orthologous groups (COG) with other sequenced members of the <italic>Alteromona... | [
"<title>Results and Discussion</title>",
"<title>Overall comparison of <italic>Pseudoalteromonas</italic> or <italic>Alteromononas</italic> genomes</title>",
"<p>Hierarchical clustering and principle component analysis of cluster of orthologous groups (COG) with other sequenced members of the <italic>Alteromona... | [
"<title>Conclusion</title>",
"<p>The <italic>P. tunicata</italic> genome reflects an adaptation to successful persistence and competition on marine surfaces. The potential for <italic>P. tunicata</italic> to benefit from the decay of host tissue without causing direct harm, together with the production of inhibit... | [
"<p>Conceived and designed the experiments: TT FFE SE. Performed the experiments: TT FFE DSD SE. Analyzed the data: TT FFE DS AMP CB AP SSB SE. Contributed reagents/materials/analysis tools: NFS JJ SF. Wrote the paper: TT FFE DS SK SE.</p>",
"<title>Background</title>",
"<p>Colonisation of sessile eukaryotic ho... | [
"<title>Supporting Information</title>"
] | [
"<p>We thank Granger Sutton and his team for the ongoing development and maintenance of the Celera Assembler. We thank Robert Friedman and acknowledge the J. Craig Venter Institute (JCVI) Joint Technology Center, under the leadership of Yu-Hui Rogers, for producing the genomic libraries and the sequence data.</p>"
... | [
"<fig id=\"pone-0003252-g001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pone.0003252.g001</object-id><label>Figure 1</label><caption><title>Phylogenetic tree based on 16S rRNA gene sequence of <italic>Pseudoalteromonas</italic> and <italic>Alteromonas</italic> species compared in the study.... | [
"<table-wrap id=\"pone-0003252-t001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pone.0003252.t001</object-id><label>Table 1</label><caption><title>General feature of <italic>Pseudoalteromonas</italic> and <italic>Alteromonas</italic> genomes compared in this study.</title></caption><alternat... | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"pone.0003252.s001\"><label>Figure S1</label><caption><p>Phage particle of P. tunicata. Transmission electron micrograph of phage-like structures observed in the spent medium of Pseudoalteromonas tunicata. Bar = 200 nm</p><p>(4.80 MB TIF)</p></caption></suppl... | [
"<fn-group><fn fn-type=\"COI-statement\"><p><bold>Competing Interests: </bold>The authors have declared that no competing interests exist.</p></fn><fn fn-type=\"financial-disclosure\"><p><bold>Funding: </bold>Sequencing and assembly were supported by the Betty and Gordon Moore Foundation as part of its Marine Micro... | [
"<graphic xlink:href=\"pone.0003252.g001\"/>",
"<graphic xlink:href=\"pone.0003252.g002\"/>",
"<graphic id=\"pone-0003252-t001-1\" xlink:href=\"pone.0003252.t001\"/>",
"<graphic xlink:href=\"pone.0003252.g003\"/>",
"<graphic xlink:href=\"pone.0003252.g004\"/>",
"<graphic xlink:href=\"pone.0003252.g005\"/>... | [
"<media xlink:href=\"pone.0003252.s001.tif\"><caption><p>Click here for additional data file.</p></caption></media>"
] | [{"label": ["2"], "element-citation": ["\n"], "surname": ["Berk", "Mitchell", "Bobbie", "Nickels", "White"], "given-names": ["SG", "R", "RJ", "JS", "DC"], "year": ["2001"], "article-title": ["Microfouling on metal surfaces exposed to seawater."], "source": ["International Biodeteriation and Biodegradation"], "volume": ... | {
"acronym": [],
"definition": []
} | 96 | CC BY | no | 2022-01-13 07:14:35 | PLoS One. 2008 Sep 24; 3(9):e3252 | oa_package/05/a3/PMC2536512.tar.gz |
PMC2536532 | 17293780 | [
"<title>Introduction</title>",
"<p>The rabbit, because of its large eyes, ease of handling, and cost effectiveness, has become a standard ophthalmic animal model for many surgical experiments, such as glaucoma filtration surgery (GFS), as well as for the development of new devices and medical therapies. Over the ... | [
"<title>Methods</title>",
"<title>Rabbit eye cDNA library construction</title>",
"<p>Eight- to nine-week-old, New Zealand white rabbits were obtained from Myrtle's Rabbitry (Thompsons Station, TN). Animals were treated according to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and ... | [
"<title>Results</title>",
"<title>Sequencing</title>",
"<p>For each library, 3,840 clones were sequenced from both 5' and 3' ends. After removal of empty vector, <italic>E.coli</italic> and mitochondrial contaminants, high quality sequences were obtained for 3,118 and 3,418 clones from the anterior tissue libra... | [
"<title>Discussion</title>",
"<p>Rabbits, because of their large eyes, ease of handling, and cost effectiveness of their use, have become an important and standard ophthalmic animal model for many surgical experiments as well as for the development of new devices and medical therapies. To date, the research commu... | [] | [
"<p>This is an open-access article distributed under the terms of the\n Creative Commons Attribution License, which permits unrestricted use,\n distribution, and reproduction in any medium, provided the original\n work is properly cited.</p>",
"<title>Purpose</title>",
"<p>To develop a micr... | [] | [
"<title>Acknowledgements</title>",
"<p>This work was supported by a Research Opportunity Fund from the University of Florida's Division of Sponsored Research and through the NEIBank project of the National Eye Institute. The authors thank Dr W. Clay Smith for reviewing an earlier version of this manuscript.</p>"
... | [
"<fig id=\"f1\" fig-type=\"figure\" position=\"float\"><label>Figure 1</label><caption><p>Examples of images generated from scanned microarrays. Example of an image generated from a scanned eight-pack microarray (<bold>A</bold>) and a single 1,900 element (<bold>B</bold>) microarray. Each circle represents a unique... | [
"<table-wrap id=\"t1\" position=\"float\"><label>Table 1</label><caption><title>Primer and TaqMan® probe sequences for selected rabbit genes.</title></caption><table frame=\"hsides\" rules=\"groups\"><col width=\"100\" span=\"1\"/><col width=\"214\" span=\"1\"/><col width=\"246\" span=\"1\"/><col width=\"204\" span... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Nucleotide sequence of the TaqMan® probe and both forward and reverse primers used in real-time PCR reactions. The probe and primer sequences used in real-time PCR reactions and the microarray probe for individual rabbit genes were designed from the same contig.</p></table-wrap-foot>",
"<tabl... | [
"<graphic xlink:href=\"mv-v13-164-f1\"/>"
] | [] | [{"label": ["3"], "citation": ["Baxevanis AD, ed. Current Protocols in Bioinformatics. New York: Wiley and Sons; 2003."]}, {"label": ["4"], "surname": ["Farmerie", "Hammer", "Liu", "Sahni", "Schneider"], "given-names": ["WG", "J", "L", "A", "M"], "article-title": ["Biological Workflow with BlastQuest."], "source": ["Da... | {
"acronym": [],
"definition": []
} | 25 | CC BY | no | 2022-01-12 14:47:36 | Mol Vis. 2007 Feb 2; 13:164-173 | oa_package/c1/56/PMC2536532.tar.gz |
PMC2536662 | 18713475 | [
"<title>Background</title>",
"<p>Since the beginning of the AIDS pandemic, opportunistic infections (O.I.'s) have been recognized as common complications of HIV infection. The spectrum of O.I.'s in the HIV infected subjects varies from one region to another [##REF##14556060##1##]. Of these, opportunistic protozoa... | [
"<title>Methods</title>",
"<p>This study was conducted from January 2006 to October 2007 in the Department of Microbiology and ART centre of S.S. Hospital, I.M.S., B.H.U., Varanasi, India. Being a tertiary care hospital, it caters to the patients from the neighbouring areas of U.P., M.P., Bihar, Jharkhand, Chatti... | [
"<title>Results</title>",
"<p>In the study we observed that there was a male preponderance 271/366, (74.0%) in the age group 31–40 years. Maximum patients (95%) belonged to Varanasi and the rural areas of Eastern UP.</p>",
"<p>A total of 366 patients were screened and of these 134(36.6%) patients, showed immune... | [
"<title>Discussion</title>",
"<p>With the emergence of AIDS, parasitic diarrhea has gained significance, as it is one of the important causes of morbidity and mortality. The line of treatment being different for diverse parasites necessitates a definitive diagnosis and study of the etiological agents causing diar... | [
"<title>Conclusion</title>",
"<p>From this study it appears that the CD4 counts and prevalence of the protozoal infection in a particular geographic area should be considered before instituting empirical therapy to the AIDS patients attending the ART centre.</p>"
] | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>All the authors read and approved the final manuscript. LT designed the study, performed the experimental work, conceived and drafted the manuscript. AKG prov... | [
"<title>Acknowledgements</title>",
"<p>The authors would like to acknowledge Prof. Gajendra Singh, Director, IMS, BHU for his support in carrying out the study.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Flowchart showing the symptoms, diarrhoeal episodes and percentage of pathogen positivity among 366 HIV positive patients.</p></caption></fig>"
] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Comparison of the parasites isolated from the stool samples of AIDS patients and normal controls.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Parasites isolated</td><td align=\"center\">Percentage of ... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Figures in parentheses express the percentage (%) of parasites isolated.</p></table-wrap-foot>",
"<table-wrap-foot><p>Figures in parentheses express the percentage (%) of parasites isolated.</p></table-wrap-foot>",
"<table-wrap-foot><p>Figures in parentheses express the percentage (%) of pa... | [
"<graphic xlink:href=\"1471-230X-8-36-1\"/>"
] | [] | [{"collab": ["Government of India"], "source": ["Epidemiology of HIV/AIDS.p 1\u201311 In B.B. Rewari(ed), Specialists Training and Reference Module"], "year": ["1999"], "publisher-name": ["National AIDS Control Organization, New Delhi"]}, {"article-title": ["Diagnostic Procedures for Stool Specimens"]}, {"surname": ["S... | {
"acronym": [],
"definition": []
} | 17 | CC BY | no | 2022-01-12 14:47:36 | BMC Gastroenterol. 2008 Aug 20; 8:36 | oa_package/08/a4/PMC2536662.tar.gz |
PMC2536663 | 18721453 | [
"<title>Background</title>",
"<p>About 16% of middle-aged men and 7% of women snore habitually [##REF##3385458##1##,##REF##12853524##2##]. They suffer from daytime sleepiness and run an increased risk of cardiovascular diseases [##REF##9623692##3##, ####REF##9485530##4##, ##REF##10573247##5##, ##REF##10676674##6#... | [
"<title>Methods</title>",
"<p>A postal questionnaire was sent to 21,802 men and women aged 25–54 years in 1999–2001, with two reminders to non-responders [##REF##15242843##14##]. Altogether 16,190 subjects (74%) responded. The responders were more likely being women (52.9 vs. 47.7%, p < 0.001) and slightly old... | [
"<title>Results</title>",
"<p>The characteristics of the study population according to centre are presented in Table ##TAB##0##1##. Habitual snoring was reported by 2,851 subjects (18%). Habitual snorers were more often men, more obese, older, had a higher prevalence of asthma and chronic bronchitis and had smoke... | [
"<title>Discussion</title>",
"<p>Being hospitalized for a respiratory infection before the age of two years, having had recurrent otitis in childhood, having been exposed to a dog as a newborn, having grown up in a large family were associated with habitual snoring later in life. These findings were independent o... | [
"<title>Conclusion</title>",
"<p>The predisposition for adult snoring and possibly also for obstructive sleep apnea may be partly established early in life. Having had severe airway infections or recurrent otitis in childhood, being exposure to a dog as a newborn, and growing up in a large family appear as possib... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>BMI: Body mass index; CI: Confidence interval; OR: Odds ratio.</p>",
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>KAF participated in the design, analysis, interp... | [
"<title>Acknowledgements</title>",
"<p>The following scientists in the RHINE study group are acknowledged for helpful contributions: Balder B, Bodman G-M, Boman G, Björnsson E, Dahlman-Höglund A, Farkhooy A, Forsberg B, Gislason D, Hellgren J, Jensen EJ, Jõgi R, Lillienberg L, Lundbäck B, Norbäck D, Olin A-C, Rea... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Adjusted population attributable fraction for childhood (black bars) and adult risk factors (white bars) for snoring.</p></caption></fig>"
] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Characteristics of the population.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\">Reykjavik <break/>(n = 1,969)</td><td align=\"center\">Bergen<break/> (n = 2,506)</td><td align=\"center\">Umeå <b... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>BMI = body mass index. Means are expressed ± SD.</p></table-wrap-foot>",
"<table-wrap-foot><p>BMI = body mass index. Means are expressed ± SD.</p></table-wrap-foot>",
"<table-wrap-foot><p>Means are expressed ± SD.</p></table-wrap-foot>",
"<table-wrap-foot><p>CI = confidence interval, *The... | [
"<graphic xlink:href=\"1465-9921-9-63-1\"/>"
] | [] | [{"article-title": ["Respiratory Health in Northern Europe"]}, {"article-title": ["European Community Respiratory Health Survey"]}, {"surname": ["Svanes", "Dharmage", "Norb\u00e4ck", "Wjst", "Villani", "deMarco"], "given-names": ["C", "S", "D", "M", "S", "R"], "article-title": ["Agreement in reporting childhood pets in... | {
"acronym": [],
"definition": []
} | 35 | CC BY | no | 2022-01-12 14:47:36 | Respir Res. 2008 Aug 22; 9(1):63 | oa_package/39/dc/PMC2536663.tar.gz |
PMC2536664 | 18700975 | [
"<title>Background</title>",
"<p>Chronic Fatigue Syndrome (CFS) is characterized by persistent or relapsing unexplained fatigue that lasts for at least six months and results in substantial reduction in previous levels of daily functioning [##UREF##0##1##]. Causes of CFS have not been found and most patients do n... | [
"<title>Methods</title>",
"<title>Design</title>",
"<p>The evaluation was a prospective, non-controlled before and after comparison in a MHC with an observation period of 8 months.</p>",
"<title>Implementation interventions</title>",
"<p>The implementation program contained four major interventions. First, ... | [
"<title>Results</title>",
"<title>Descriptives</title>",
"<p>Figure ##FIG##0##1## presents the patient flow. From the 143 patients that entered the MHC during the observation period, 18 'no show' patients never showed up at the intake session. Since they only caused negligible costs they were excluded from this... | [
"<title>Discussion</title>",
"<p>This study has shown that from a societal perspective the cost outcome ratio (COR) after implementing CBT for CFS in a MHC was dominant compared to before. From a healthcare perspective the COR after implementation was more costly but also more effective than before, and the 100% ... | [
"<title>Conclusion</title>",
"<p>To conclude, the results of this study suggest that implementing cognitive behavioral therapy for chronic fatigue syndrome in a mental health center is feasible and advisable. This strategy appeared to be dominant (resulting in lower costs and higher health states) compared to the... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>KS collected all data, performed the statistical analysis together with JLS and wrote manuscript. JLS contributed to the development of the study design conce... | [
"<title>Acknowledgements</title>",
"<p>None</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Patient flow.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Acceptability curve showing the probability that implementing CBT for CFS has a favorable cost outcome ratio over a range of willing... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Cost-prices used to value the different health care volumes, measured at patient level before and after treatment.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><italic>Health care volume</italic></td><... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>All volumes were valued in terms of Dutch integral cost prices at the price level of 2004 (Oostenbrink et al., 2004).</p></table-wrap-foot>",
"<table-wrap-foot><p>N = the number of patients that had been using this form of healthcare</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1472-6963-8-175-1\"/>",
"<graphic xlink:href=\"1472-6963-8-175-2\"/>",
"<graphic xlink:href=\"1472-6963-8-175-3\"/>"
] | [] | [{"surname": ["Fukuda", "Strauss", "Hickie", "Sharpe", "Dobbins", "Komaroff"], "given-names": ["K", "SE", "I", "MNC", "JG", "A"], "article-title": ["The chronic fatigue syndrome: a comprehensive approach to its definition and study"], "source": ["Annual Internal Medicine"], "year": ["1994"], "volume": ["21"], "fpage": ... | {
"acronym": [],
"definition": []
} | 29 | CC BY | no | 2022-01-12 14:47:36 | BMC Health Serv Res. 2008 Aug 13; 8:175 | oa_package/7e/59/PMC2536664.tar.gz |
PMC2536665 | 18710494 | [
"<title>Background</title>",
"<p>The measurement of volatile gases in breath for the purpose of the diagnosis, screening and monitoring of disease is an attractive proposition due to the inherently non-invasive nature of such methodology [##REF##17305586##1##]. For example, the volatile biomarker nitric oxide has... | [] | [] | [] | [
"<title>Conclusion</title>",
"<p>In conclusion, advances in ion source design have resulted in significant improvements in the sensitivity of the SIFT-MS procedure resulting in the potential for additional biomarkers to be readily investigated. As the ion generation process becomes better understood it is likely ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>",
"<title>Background</title>",
... | [
"<title>Competing interests</title>",
"<p>The author declares that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>All experimental work and production of the manuscript was by BMR.</p>"
] | [
"<title>Acknowledgements</title>",
"<p>This work was aided by a grant from the Northern Cancer Research Foundation to BMR.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Detection of xylene and toluene added to humidified air and human breath</bold>. Xylene (A) or toluene (B) vapour were added to either humidified bottled air (circles) or human breath (triangles) contained in Tedlar bags to produce a range ... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Levels of trace volatile compounds in alveolar and oral air.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Sample</bold></td><td align=\"left\"><bold>Compartment</bold></td><td align=\"left\"><bol... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Levels of indole, methylindole (all isomers), hydrogen sulphide and methylmercaptan were measured in ambient air, or in a single alveolar breath or static oral air (approximately 10 second measurement duration) of 3 healthy human subjects by SIFT-MS using characteristic products ions of the rea... | [
"<graphic xlink:href=\"1756-0500-1-41-1\"/>"
] | [] | [{"surname": ["\u0160pan\u011bl", "Smith"], "given-names": ["P", "D"], "article-title": ["Selected ion flow tube mass spectrometry for on-line trace gas analysis in biology and medicine"], "source": ["Eur J Mass Spectrom"], "year": ["2007"], "volume": ["13"], "fpage": ["77"], "lpage": ["82"], "pub-id": ["10.1255/ejms.8... | {
"acronym": [],
"definition": []
} | 15 | CC BY | no | 2022-01-12 14:47:36 | BMC Res Notes. 2008 Jul 10; 1:41 | oa_package/bc/e3/PMC2536665.tar.gz |
PMC2536666 | 18671876 | [
"<title>Background</title>",
"<p>Access to prophylactic cotrimoxazole and to timely initiation of antiretroviral therapy can tremendously improve the survival of HIV infected children [##REF##15555666##1##, ####REF##14593035##2##, ##REF##17806062##3##, ##REF##14551485##4##, ##REF##17443476##5####17443476##5##]. H... | [
"<title>Methods</title>",
"<p>The study was carried out from December 2002 to May 2005 in the Dowa district of central Malawi, where antenatal and adult HIV prevalence were estimated to be 9.8% and 6.4%, respectively [##REF##14600523##27##,##UREF##5##28##] Voluntary HIV Counselling and Testing (VCT) was offered t... | [
"<title>Results</title>",
"<p>A total of 2,592 children under 5 years of age had participated in the CTC programme prior to the study. Of these, 809 (31.2%) resided outside the study area and were not eligible for the RC. Of the 1783 possible participants, 180 had moved, 69 had died (according to key informants),... | [
"<title>Discussion</title>",
"<p>The study aims were to assess whether a CTC programme can be used as an entry point for HIV services, including HIV testing and treatment of malnutrition in HIV-positive children, and to compare outcomes of HIV-positive and HIV-negative children within the programme. More than hal... | [
"<title>Conclusion</title>",
"<p>The results of the present study demonstrate that CTC is a valuable entry point for HIV testing for severely malnourished children and that good recovery rates can be achieved in HIV-infected severely malnourished children admitted to the program. These results indicate that CTC c... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors Paluku Bahwere, Kate Sadler, Saul Guerrero and Steve Collins work for Valid International, an organisation that has been engaged in the research and development of Community-based Therapeutic Care. Dr Steve Collins is also unpaid director of Valid Nutrition, a... | [
"<title>Acknowledgements</title>",
"<p>The authors would like to acknowledge the invaluable assistance of the Ministry of Health clinic staff in Dowa District and all the CTC programme beneficiaries and their families. Funding for this paper was provided by the Bureau for Africa, Office of Sustainable Development... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Description of the retrospective cohort.</p></caption></fig>"
] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Clinical algorithms for diagnosing paediatric HIV</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Algorithm</bold></td><td align=\"center\" colspan=\"2\"><bold>Variables</bold></td><td align=\"left\... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>† IMCI = integrated management of childhood illness § Pneumonia was ascertained by asking if the child had breathing abnormalities (fast breathing, chest in-drawing or nasal flaring) and/or severe cough. ¶ All children were assumed to have a history of weight loss/low weight gain.</p></table-wr... | [
"<graphic xlink:href=\"1471-2334-8-106-1\"/>"
] | [] | [{"collab": ["UNAIDS"], "source": ["UNAIDS policy position on HIV testing and counselling UNAIDS"], "year": ["2006"], "comment": ["Ref Type: Report"]}, {"surname": ["Thurstans", "Kerac", "Maleta", "Banda", "Nesbit"], "given-names": ["S", "M", "K", "T", "A"], "article-title": ["HIV point-prevalence amongst malnourished ... | {
"acronym": [],
"definition": []
} | 76 | CC BY | no | 2022-01-12 14:47:36 | BMC Infect Dis. 2008 Jul 31; 8:106 | oa_package/22/00/PMC2536666.tar.gz |
PMC2536667 | 18691419 | [
"<title>Background</title>",
"<p>This paper was motivated by a study in which a putative genetic risk marker for disease could not be measured with certainty. The study used a case-control design to assess the association of cervical cancer with a polymorphism in codon 72 of the p53 tumour suppressor gene. DNA sp... | [
"<title>Methods</title>",
"<p>We assume that a true exposure status X exists for the genotype of each study subject, but that it cannot be observed without error – hence X is a latent or unobserved variable. We are interested in the association of disease D (cervical cancer) with the true exposure status X, denot... | [
"<title>Results</title>",
"<p>Our analysis is based on a larger sample of participants obtained subsequent to the original report [##REF##10918193##1##], with 142 cases and 162 controls identified using the same methods as previously. Table ##TAB##4##5## shows the numbers of participants with polymorphism classif... | [
"<title>Discussion</title>",
"<p>Variation in measuring p53 expression has been recognized before, in the context of bladder cancer studies [##REF##10815908##26##]. In this paper, we have illustrated the use of LCMs to evaluate the association of a genotype with cancer, while taking measurement error in the genot... | [
"<title>Conclusion</title>",
"<p>Our analysis provided an estimate of OR for the genotype-cancer association. Subject to the validity of the assumed model, this estimate enjoys the general properties of maximum likelihood estimates, including asymptotic unbiasedness and minimum variance. The model-based estimate ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>SDW developed the methodology presented in this paper, carried out the statistical analysis of the data, and drafted the manuscript. ELF has done research on the impact of exposure misclassification in cancer etiology studies and was responsible for the case-control st... | [
"<title>Acknowledgements</title>",
"<p>The authors thank Drs. Luisa Villa, Greg Matlashewski, and Alan Storey for their valuable contributions as co-investigators in the original case-control study. The work was partly supported by funding from the Natural Sciences and Engineering and Research Council.</p>"
] | [] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Association of invasive cervical cancer with p53 arg/arg genotype<sup>1 </sup>using individual laboratory results</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\" colspan=\"2\"><bold>OR<sup>1 </sup>... | [
"<disp-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2156-9-51-i1\" overflow=\"scroll\"><mml:semantics><mml:mrow><mml:mi>ℓ</mml:mi><mml:mi>n</mml:mi><mml:mo stretchy=\"false\">(</mml:mo><mml:msub><mml:mi>m</mml:mi><mml:mrow><mml:mi>a</mml:mi><mml:mi>b</mml:mi><mml:mi>c</mm... | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p><sup>1 </sup>Odds ratio (OR) relative to reference category combining Arg/Pro and Pro/Pro genotypes.</p><p><sup>2 </sup>OR adjusted for age and race.</p></table-wrap-foot>",
"<table-wrap-foot><p><sup>1 </sup><underline>Non-stringent</underline> definition allows inter-laboratory disagreement ... | [] | [] | [{"surname": ["Streiner", "Miller"], "given-names": ["DL", "HR"], "article-title": ["Maximum likelihood estimates of the accuracy of four diagnostic techniques"], "source": ["Education and Psychological Measurement"], "year": ["1990"], "volume": ["50"], "fpage": ["653"], "lpage": ["662"], "pub-id": ["10.1177/0013164490... | {
"acronym": [],
"definition": []
} | 39 | CC BY | no | 2022-01-12 14:47:36 | BMC Genet. 2008 Aug 8; 9:51 | oa_package/c9/06/PMC2536667.tar.gz |
PMC2536668 | 18715497 | [
"<title>Background</title>",
"<p><italic>Calluna vulgaris </italic>L. (Hull.), an exclusive species within the genus <italic>Calluna</italic>, has increased its economic weight, and not only within the German horticultural industry over the last few decades: In 2005 almost 100 million plants were produced in Germ... | [
"<title>Methods</title>",
"<title>DNA techniques: isolation of genomic DNA (gDNA)</title>",
"<p>gDNA of <italic>C. vulgaris </italic>genotypes was isolated according to [##UREF##20##27##]. About 200 mg young leaf tissue (stored over night and frozen in liquid nitrogen) was homogenized in 2 ml tubes in a mixer m... | [
"<title>Results</title>",
"<title>Estimation of genetic diversity and kinship relations within <italic>C. vulgaris</italic></title>",
"<p>Using RAPD- and iSSR-techniques, we achieved a total of 129 (RAPD) and 39 (iSSR) distinguishable and reproducible bands. This corresponds to 9.9 bands/RAPD primer and 7.8 ban... | [
"<title>Discussion</title>",
"<p>Until now, molecular data on genetic diversity within the species <italic>C. vulgaris </italic>was only available for regionally restricted wild-type populations [##REF##10383687##15##, ####REF##10632855##16##, ##REF##11903905##17####11903905##17##], not for varieties used in comm... | [
"<title>Conclusion</title>",
"<p>As a result of these findings, we would like to suggest the outlined method as an appropriate system for EDV-testing in <italic>C. vulgaris</italic>. Applicability to other vegetatively propagated crops should be tested, as well as the combined use of 'fixed' and 'random/unmapped ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>AFLP: Amplified Fragment Length Polymorphism; ASSINSEL: 'International Association of Plant Breeders for the Protection of Plant Varieties'; EDV: Essentially Derived Variety/Varieties; BSA: Bundessortenamt; CPVO: Community Plant Variety Office; gDNA: genomic DNA; ISF: Internati... | [
"<title>Acknowledgements</title>",
"<p>This study was carried out as part of the BMWi-funded project (KP0172401BN5A) between the IGZ and Heidepflanzen Peter de Winkel, Goch <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.dewinkel.de\"/>. The authors wish specifically to thank the company owner for his sup... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Shoots of two <italic>C. vulgaris </italic>genotypes representing the main inflorescence types</bold>. left: normal ('White Mite'), right: bud ('Anneliese').</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label>... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Identifying essential derivation in <italic>C. vulgaris</italic>. </p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\" colspan=\"2\"><bold>Reference Sets</bold></td></tr></thead><tbody><tr><td/><td ali... | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p><bold>Complete list of included varieties and genotypes, their country of origin and pedigree information where known (source is given in the last column)</bold>. Column 3 defines the flower type either as nor... | [
"<table-wrap-foot><p>Identifying essential derivation in <italic>C. vulgaris</italic>: Reference-Sets A and B chosen for the Test-Sets. Set B differs from A only in the exchange of two wild-type genotypes (Niederohe, San Remo) versus 2 varieties ('Sandy', 'Annegret') as indicated by summarizing both columns of Set ... | [
"<graphic xlink:href=\"1471-2156-9-56-1\"/>",
"<graphic xlink:href=\"1471-2156-9-56-2\"/>",
"<graphic xlink:href=\"1471-2156-9-56-3\"/>",
"<graphic xlink:href=\"1471-2156-9-56-4\"/>"
] | [
"<media xlink:href=\"1471-2156-9-56-S1.xls\" mimetype=\"application\" mime-subtype=\"vnd.ms-excel\"><caption><p>Click here for file</p></caption></media>"
] | [{"article-title": ["ZMP: Zentrale Markt- und Preisberichtstelle f\u00fcr Erzeugnisse der Land-, Forst- und Ern\u00e4hrungswirtschaft GmbH"]}, {"article-title": ["BSA doc"]}, {"article-title": ["CPVO"]}, {"article-title": ["UPOV: International convention for the protection of new varieties of plants"]}, {"surname": ["S... | {
"acronym": [],
"definition": []
} | 31 | CC BY | no | 2022-01-12 14:47:36 | BMC Genet. 2008 Aug 20; 9:56 | oa_package/46/0b/PMC2536668.tar.gz |
PMC2536669 | 18691417 | [
"<title>Background</title>",
"<p>The bovine cluster of differentiation (CD) 14 is an important player in host innate immunity in that it mediates host defense against Gram-negative bacterial infections and also confers immunity against viral infections [##REF##10074110##1##,##REF##8612135##2##]. It is abundant (a... | [
"<title>Methods</title>",
"<title>Animals and genomic DNA extraction</title>",
"<p>Genomic DNA was extracted from the blood of 106 Canadian Holstein cows kept at the Howard Webster Centre-Macdonald Teaching Farm, McGill University and the milks of 46 Jersey cows enrolled in the Quebec Dairy Production Centre of... | [
"<title>Results</title>",
"<title>SNPs in the CD14 gene of Canadian Holsteins and Jersey cows</title>",
"<p>Comparison of the CD14 sequences of 106 Canadian Holsteins and 46 Jersey cows with published sequences (GenBank Nos. <ext-link ext-link-type=\"gen\" xlink:href=\"NW_001495367\">NW_001495367</ext-link> and... | [
"<title>Discussion</title>",
"<p>We report here sequence variations of the bovine CD14 gene of Canadian Holstein and Jersey cows, through genomic DNA sequencing and computational analysis of the promoter. A gene is made up of both coding and non-coding regions which are all important in its expression and functio... | [
"<title>Conclusion</title>",
"<p>Overall, this study provides information on sequence variations of the CD14 gene of Canadian Holstein and Jersey cows. The identified variations and association data have provided information that may shade more light on cell surface expression of CD14 by neutrophils, which are ne... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>EMI-B carried out the molecular genetic studies, sequence and protein comparisons, data analysis and drafted the manuscript. J-WL and XZ conceived the study and participated in its design. XZ attracted funding for the project and coordinated the work. AEI carried out t... | [
"<title>Acknowledgements</title>",
"<p>This research was financed by NSERC, Alberta Milk, Dairy Farmers of New Brunswick, Nova Scotia, Ontario and Prince Edward Island, Novalait Inc., Dairy Farmers of Canada, Canadian Dairy Network, AAFC, PHAC, Technology PEI Inc., Université de Montréal and University of Prince ... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Flow cytometyric analyses of relationship of surface expression of CD14 on monocytes and neutrophils with CD14 genotypes. Cells were stained with fluorescein isothiocyanate (FITC)-labelled mouse anti human CD14 antibody and 20,000 events were gat... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>SNPs, gene alleles, protein variants, haplotypes and their frequencies in the analyzed breeds</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">Parameter</td><td align=\"center\">Holstein (n = 106)</td><t... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>*SNP Numbers are according to GenBank No. <ext-link ext-link-type=\"gen\" xlink:href=\"EU148609\">EU148609</ext-link></p><p>** Amino acid residue numbering is according to GenBank No. <ext-link ext-link-type=\"gen\" xlink:href=\"ABV68569\">ABV68569</ext-link></p></table-wrap-foot>",
"<table-w... | [
"<graphic xlink:href=\"1471-2156-9-50-1\"/>",
"<graphic xlink:href=\"1471-2156-9-50-2\"/>",
"<graphic xlink:href=\"1471-2156-9-50-3\"/>",
"<graphic xlink:href=\"1471-2156-9-50-4\"/>"
] | [] | [{"surname": ["De Schepper", "De Ketelaere", "Bannerman", "Paape", "Peelman", "Burvenich"], "given-names": ["S", "A", "DD", "MJ", "L", "C"], "article-title": ["The toll-like receptor-4 (TLR-4) pathway and its possible role in the pathogenesis of "], "italic": ["Escherichia coli "], "source": ["Vet Res"], "year": ["2008... | {
"acronym": [],
"definition": []
} | 36 | CC BY | no | 2022-01-12 14:47:36 | BMC Genet. 2008 Aug 8; 9:50 | oa_package/da/df/PMC2536669.tar.gz |
PMC2536670 | 18713472 | [
"<title>Background</title>",
"<p>In recent years, the discovery and development of genetic markers such as microsatellites has led to a rapid growth in the number of molecular studies, with the isolation and development of microsatellite loci becoming relatively quick and straight-forward in many taxa [reviewed i... | [
"<title>Methods</title>",
"<title>DNA isolation</title>",
"<p>Genomic DNA was extracted for microsatellite library development and genotyping using a modified CTAB procedure with proteinase K digestion and a chloroform-isoamylalcohol protocol [##REF##8122306##53##].</p>",
"<title>Microsatellite library prepar... | [
"<title>Results</title>",
"<title>Microsatellite library preparation, Primer set_A design and testing</title>",
"<p>The first step was to isolate polymorphic microsatellite loci for <italic>H. ulvae </italic>and test to see if the population examined displayed heterozygote deficiency. Samples were collected fro... | [
"<title>Discussion</title>",
"<p>This study has shown that in order to identify and confidently remove unreliable markers in heterozygote deficient populations, additional techniques are required beyond those currently applied to microsatellite data. The currently used tests such as examination of HWE, heterozygo... | [
"<title>Conclusion</title>",
"<p>While it is clear that <italic>Hydrobia ulvae </italic>is characteristic of its taxon with regard to heterozygosity levels, the methods described here provide a useful tool for assessing genotype data and primer reliability in studies where increased confidence in microsatellites ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>RJB collected and processed specimens for examination, carried out the molecular genetics studies and drafted the manuscript. DAD supervised the molecular work, assisted with interpretation of data and assisted in drafting of the manuscript. GJH prepared the microsatel... | [
"<title>Acknowledgements</title>",
"<p>The authors acknowledge the support of the Natural Environment Research Council (NERC) at the NERC Molecular Genetics Facility (Sheffield) and Aberystwyth University for funding this study. The authors thank Professor Terry Burke for guidance throughout and for constructive ... | [] | [] | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Review of heterozygosity in microsatellite studies of marine and freshwater gastropods.</p></caption></supplementary-material>",
"<supplementary-material content-type=\"local-data\" id=\"S2\"><caption><title... | [] | [] | [
"<media xlink:href=\"1471-2156-9-55-S1.pdf\" mimetype=\"application\" mime-subtype=\"pdf\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2156-9-55-S2.pdf\" mimetype=\"application\" mime-subtype=\"pdf\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href... | [{"surname": ["Dawson", "Chittock", "Jehle", "Whitlock", "Nogueira", "Pellatt", "Birkhead", "Burke"], "given-names": ["DA", "JC", "R", "A", "D", "J", "T", "T"], "article-title": ["Identification of 13 polymorphic microsatellite loci in the zebra finch, "], "italic": ["Taeniopygia guttata "], "source": ["Molecular Ecolo... | {
"acronym": [],
"definition": []
} | 69 | CC BY | no | 2022-01-12 14:47:37 | BMC Genet. 2008 Aug 19; 9:55 | oa_package/ca/18/PMC2536670.tar.gz |
PMC2536671 | 18713462 | [
"<title>Background</title>",
"<p>Gliomas, the most common brain tumor, are currently classified as astrocytic, ependymal, oligodendroglial and choroid plexus tumors. Among astrocytic tumors, glioblastoma (World Health Organization grade IV [##REF##17618441##1##]) is the most lethal primary malignant brain tumor. ... | [
"<title>Methods</title>",
"<title>Patients Samples</title>",
"<p>For this study, tumor samples of 43 patients (19 men and 24 women) ranging in age from 1.3 to 79 years (mean age 24.6 years, with a median and a standard deviation of 12.8 ± 22.6 years) were evaluated. The histopathologic diagnoses were 20 low-gra... | [
"<title>Results</title>",
"<title>Global expression of <italic>HDAC </italic>genes in gliomas and normal brain tissue</title>",
"<p>The expression of 12 <italic>HDAC </italic>genes was analyzed using relative quantification of mRNA levels in normal brain, astrocytomas grades I, II and III, and glioblastomas (Fi... | [
"<title>Discussion</title>",
"<p>In this study we evaluated and compared mRNA levels of 12 <italic>HDAC </italic>genes in astrocytomas and normal brain tissue. As mentioned before, the acetylation levels of histones is a process regulated by two groups of important enzymes: HATs and HDACs, and the balance of the ... | [
"<title>Conclusion</title>",
"<p>Our study has established a negative correlation between <italic>HDAC </italic>gene expression and glioma grade, suggesting that class II and class IV <italic>HDACs </italic>might play an important role in glioma malignancy. This differential <italic>HDAC </italic>expression may p... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interest.</p>",
"<title>Authors' contributions</title>",
"<p>Experiments and collection of data were performed by AKBL-E, MAAC, ETV, FJNM and RGPQ. Collection of tumor samples was performed by HRM and CGCJr. Microdissect... | [
"<title>Acknowledgements</title>",
"<p>We thank Dr. John F. de Groot and Dr. Vinay Puduvalli from MD Anderson Cancer Center (Houston, Tx, USA) for providing Actin and Acetyl-H4 antibodies, respectively. We also thank Priscila C. Leite for the technical assistance in this work.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Classification of classes I, II, and IV HDACs by structure and cellular localization.</bold>[##REF##16450343##2##,##REF##12429021##6##,##REF##15955865##44##,##UREF##2##45##].</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Relative expression (medians) of <italic>HDAC </italic>genes in different groups of tumor and normal brain tissue.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\"><bold>Normal Brain</bold></td><td ... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>ns: no significant</p></table-wrap-foot>",
"<table-wrap-foot><p>AI, AII, and AIII mean astrocytoma grades I, II and III, respectively.</p><p>ns: no significant</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1471-2407-8-243-1\"/>",
"<graphic xlink:href=\"1471-2407-8-243-2\"/>",
"<graphic xlink:href=\"1471-2407-8-243-3\"/>"
] | [] | [{"surname": ["Camphausen", "Cerna", "Scott", "Sproull", "Burgan", "Cerra", "Fine", "Tofilon"], "given-names": ["K", "D", "T", "M", "WE", "MA", "H", "PJ"], "article-title": ["Enhancement of "], "italic": ["in vitro", "in vivo"], "source": ["International journal of cancer"], "year": ["2005"], "volume": ["114"], "fpage"... | {
"acronym": [],
"definition": []
} | 45 | CC BY | no | 2022-01-12 14:47:37 | BMC Cancer. 2008 Aug 19; 8:243 | oa_package/30/11/PMC2536671.tar.gz |
PMC2536672 | 18710549 | [
"<title>Background</title>",
"<p>The relationship between genetic diversity and population size offers a number of tantalizing insights into demographic influences on evolution [##UREF##0##1##, ####REF##14631042##2##, ##UREF##1##3####1##3##]. While life history characteristics of species tend to make the effectiv... | [
"<title>Methods & results</title>",
"<p>To test these ideas, we use a simple numerical model, similar to those used by Pringle and colleagues [##UREF##6##12##,##UREF##7##13##]. In our model, a haploid semelparous individual produces a fixed number of larvae that disperse on average a distance L<sub>adv </sub>... | [
"<title>Methods & results</title>",
"<p>To test these ideas, we use a simple numerical model, similar to those used by Pringle and colleagues [##UREF##6##12##,##UREF##7##13##]. In our model, a haploid semelparous individual produces a fixed number of larvae that disperse on average a distance L<sub>adv </sub>... | [
"<title>Discussion</title>",
"<p>The concept of \"effective population size\" is typically used as a numerical trait of a population more than as a descriptor of biological reality [##UREF##13##26##]. But N<sub>e </sub>is intended to reflect the number of individuals that contribute to the evolutionary potential ... | [
"<title>Conclusion</title>",
"<p>Overall, some of the lowest N<sub>e</sub>/N ratios observed are for species with broad dispersal potential in regions where ocean currents would be expected to generate a large L<sub>adv </sub>[##REF##12454077##6##,##UREF##15##41##]. While a species' fecundity may be associated wi... | [
"<title>Background</title>",
"<p>Genetic estimates of effective population size often generate surprising results, including dramatically low ratios of effective population size to census size. This is particularly true for many marine species, and this effect has been associated with hypotheses of \"sweepstakes\... | [
"<title>Authors' contributions</title>",
"<p>This work was developed as equal-authorship collaboration between JPW, who conceived of the study and drafted the manuscript, and JMP who developed the numerical simulations and scalings and coordinated the results, and helped to draft the manuscript. All authors read ... | [
"<title>Acknowledgements</title>",
"<p>Many thanks to John Wakeley, Scott Small, Mike Hickerson, Robin Waples, Bob Holt, and two anonymous reviewers for comments and discussions during the writing of this manuscript. This work was supported by University of Georgia Research Foundation funds to JPW and NSF grant O... | [
"<fig id=\"F1\" position=\"float\"><label>Figure 1</label><caption><p><bold>In both (A) and (B), the domain is initialized with haploid adults containing 5 different alleles, each geographically isolated to 1/5 of the domain, and each adult colored according to its allelic composition.</bold> The model is run for 4... | [] | [
"<disp-formula id=\"bmcM1\"><label>(1)</label>log(N<sub>allele</sub>) > L<sup>2</sup><sub>adv</sub>/(2L<sup>2</sup><sub>diff</sub>)</disp-formula>",
"<disp-formula id=\"bmcM2\"><label>(2)</label>N<sub>e </sub>= H<sub>dens</sub>L<sup>2</sup><sub>diff</sub>/L<sub>adv</sub>,</disp-formula>"
] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1471-2148-8-235-1\"/>",
"<graphic xlink:href=\"1471-2148-8-235-2\"/>",
"<graphic xlink:href=\"1471-2148-8-235-3\"/>"
] | [] | [{"surname": ["Hedgecock"], "given-names": ["D"], "person-group": ["Beaumont AR"], "article-title": ["Does variance in reproductive success limit effective population sizes of marine organisms?"], "source": ["Genetics and Evolution of Aquatic Organisms"], "year": ["1994"], "publisher-name": ["Springer"], "fpage": ["122... | {
"acronym": [],
"definition": []
} | 44 | CC BY | no | 2022-01-12 17:11:36 | BMC Evol Biol. 2008 Aug 18; 8:235 | oa_package/f3/61/PMC2536672.tar.gz |
PMC2536673 | 18700982 | [
"<title>Background</title>",
"<p>The number of solved RNA secondary structures has increased dramatically in the past decade, and several databases are available to search and download specific classes of RNA secondary structures [##REF##11869452##1##, ####REF##15608164##2##, ##REF##9847214##3##, ##REF##16381838#... | [] | [] | [
"<title>Utility and discussion</title>",
"<p>RNA STRAND v2.0 contains 4666 RNA molecules or interacting complexes of various types, and an abundance of RNA structural motifs (see also Table ##TAB##0##1##). This represents a considerable amount of data from which to draw significant statistics and trends about RNA... | [
"<title>Conclusion</title>",
"<p>In this paper, we presented RNA STRAND, a new database for RNA secondary structure data that provides access to detailed information on known secondary structures as well as statistical analyses of structural aspects of various types of RNAs. We believe that such information will ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Construction and Content</title>",
"<p>Figure ##FIG##1##2## describes the four main modules that comprise RNA STRAND. To create the database, we first collected the data from various external sources, then we processed the data and prepared it for a MySQL relational database. Next, we installed and popula... | [
"<title>Acknowledgements</title>",
"<p>We thank Baharak Rastegari, Yinglei S. Zhao, Mohammad Safari and Jack Jia, who provided an efficient computer program for pseudoknotted structure parsing; Robin Gutell, Christian Zwieb, James Brown and Mathias Sprinzl for providing data and help with the CRW, SRPDB & tmR... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>RNA secondary structure example</bold>. Schematic representation of the secondary structure for the RNase P RNA molecule of <italic>Methanococcus marapaludis </italic>from the RNase P Database; the RNA STRAND ID for this molecule is ASE_001... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>The main RNA types included in RNA STRAND v2.0.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">RNA type</td><td align=\"left\">Main source(s)</td><td align=\"center\">#</td><td align=\"center\" colspan=\... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Overview of the main RNA types in version 2.0 of the RNA STRAND database, their provenance, the number of RNAs, the mean length and standard deviation for each type. % PKBP denotes the percentage of the base pairs that need to be removed in order to render the structure pseudoknot-free. Most of... | [
"<graphic xlink:href=\"1471-2105-9-340-1\"/>",
"<graphic xlink:href=\"1471-2105-9-340-2\"/>",
"<graphic xlink:href=\"1471-2105-9-340-3\"/>",
"<graphic xlink:href=\"1471-2105-9-340-4\"/>"
] | [] | [{"surname": ["Apostolico", "Atallah", "Hambrusch"], "given-names": ["A", "MJ", "SE"], "article-title": ["New clique and independent set algorithms for circle graphs"], "source": ["Discrete Applied Mathematics"], "year": ["1996"], "volume": ["32"], "fpage": ["1"], "lpage": ["24"]}, {"surname": ["Jabbari", "Condon", "Po... | {
"acronym": [],
"definition": []
} | 42 | CC BY | no | 2022-01-12 14:47:37 | BMC Bioinformatics. 2008 Aug 13; 9:340 | oa_package/cd/b8/PMC2536673.tar.gz |
PMC2536674 | 18706106 | [
"<title>1 Background</title>",
"<p>High density oligonucleotide tiling arrays allow the investigation of transcriptional activity, protein-DNA interactions and chromatin structure across a whole genome. Tiling arrays have been used in a wide range of studies, including investigation of transcription factor activi... | [
"<title>4 Methods</title>",
"<title>4.1 Baum-Welch Algorithm</title>",
"<p>The Baum-Welch algorithm [##UREF##0##16##] used to estimate parameters for our model is outlined in Section 2.2.2; further details are given below. Computing the likelihood of the long observation sequences produced by tiling arrays invo... | [
"<title>2 Results and discussion</title>",
"<p>Tiling array data consists of a series of measurements taken along the genome. Typically, microarray probes are designed to interrogate the genome at regular intervals. Design constraints such as probe affinity and uniqueness cause differences in probe density along ... | [
"<title>2 Results and discussion</title>",
"<p>Tiling array data consists of a series of measurements taken along the genome. Typically, microarray probes are designed to interrogate the genome at regular intervals. Design constraints such as probe affinity and uniqueness cause differences in probe density along ... | [
"<title>3 Conclusion</title>",
"<p>With the use of MLEs for all model parameters, our model clearly improves classification performance on simulated data compared to <italic>ad hoc </italic>estimates, and outperforms TileMap. While our model produced some short regions that appear to be false positives, they are ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>5 Availability</title>",
"<p>The parameter estimation methods used in this article are available as part of the R package tileHMM from the authors' webpage <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.bioinformatics.csiro.au/TileHMM/\"/> and from CRAN. The simulated data used in this study is a... | [
"<title>Acknowledgements</title>",
"<p>PH is supported by an MQRES scholarship from Macquarie University and a top-up scholarship from CSIRO. The authors would like to thank Michael Buckley for his helpful suggestions.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Hidden Markov model for the analysis of ChIP-chip tiling array data.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Error rate for different models on datasets I and II</bold>. Error rate resul... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>AUC for different models on both simulated datasets.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\">TileMap</td><td align=\"center\">Baum-Welch</td><td align=\"center\">Viterbi-Training</td><td al... | [
"<disp-formula id=\"bmcM1\"><label>(1)</label><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-343-i1\" overflow=\"scroll\"><mml:semantics><mml:mrow><mml:msub><mml:mi>y</mml:mi><mml:mi>k</mml:mi></mml:msub><mml:mo>=</mml:mo><mml:mfrac><mml:mrow><mml:msub><mml:mover accent=\"tr... | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p><bold>False negative probe calls resulting from different models</bold>. For any given cut-off TileMap produces more false negatives than the Baum-Welch and Viterbi trained models.</p></caption></supplementary... | [
"<table-wrap-foot><p>All models with optimised parameters outperform TileMap on both simulated datasets. While TileMap performs well on dataset I it is only slightly better than the model with <italic>ad hoc </italic>parameter estimates.</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1471-2105-9-343-1\"/>",
"<graphic xlink:href=\"1471-2105-9-343-2\"/>",
"<graphic xlink:href=\"1471-2105-9-343-3\"/>",
"<graphic xlink:href=\"1471-2105-9-343-4\"/>",
"<graphic xlink:href=\"1471-2105-9-343-5\"/>",
"<graphic xlink:href=\"1471-2105-9-343-6\"/>",
"<graphic xlink:href=\... | [
"<media xlink:href=\"1471-2105-9-343-S1.png\" mimetype=\"image\" mime-subtype=\"png\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2105-9-343-S2.png\" mimetype=\"image\" mime-subtype=\"png\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-21... | [{"surname": ["Baum", "Petrie", "Soules", "Weiss"], "given-names": ["LE", "T", "G", "N"], "article-title": ["A Maximization Technique Occuring in the Statistical Analysis of Probabilistic Functions of Markov Chains"], "source": ["The Annals of Mathematical Statistics"], "year": ["1970"], "volume": ["41"], "fpage": ["16... | {
"acronym": [],
"definition": []
} | 26 | CC BY | no | 2022-01-12 14:47:37 | BMC Bioinformatics. 2008 Aug 18; 9:343 | oa_package/22/e2/PMC2536674.tar.gz |
PMC2536675 | 18667080 | [
"<title>Background</title>",
"<p>Skin constantly renews throughout adult life. The proliferative compartment of epidermis is confined to the basal layer, where it harbors stem cells, and their progeny, transient amplifying cells [##REF##3719664##1##, ####REF##5117212##2##, ##REF##3981041##3####3981041##3##]. Stem... | [
"<title>Methods</title>",
"<title>Isolation of keratinocytes</title>",
"<p>Neonatal foreskins were obtained from routine circumcisions. After washing in PBS, and removing of subcutaneous fat, the tissue was cut into 5 × 5 mm pieces and incubated overnight at 4°C in Dulbecco's modified Eagle's medium containing ... | [
"<title>Results and discussion</title>",
"<p>Skin is the largest and most accessible organ in the body. The differentiation axis of the interfollicular epidermis is spatially well defined: the basal layer contains proliferating cells, while suprabasal layers, stratum spinosum, stratum granulosum, and stratum corn... | [
"<title>Results and discussion</title>",
"<p>Skin is the largest and most accessible organ in the body. The differentiation axis of the interfollicular epidermis is spatially well defined: the basal layer contains proliferating cells, while suprabasal layers, stratum spinosum, stratum granulosum, and stratum corn... | [
"<title>Conclusion</title>",
"<p>Most of our knowledge regarding epidermal stem cells comes from murine studies. This is the first report that uncovers the transcriptional profile of human interfollicular epidermal stem cells and their progeny, transient amplifying cells isolated directly from their niches and an... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>α6: integrin alpha 6; BMP: Bone Morphogenic Protein; CDKN: cyclin dependent kinase inhibitor; CFE: colony forming efficiency; IFN-α: interferon alpha; KRT: keratin; MHCI: Major Histocompatibility Complex I; NF-κB: Nuclear Factor kappa B; α6<sup>+</sup>/MHCI<sup>-</sup>; α6<sup>... | [
"<title>Acknowledgements</title>",
"<p><bold>Funding</bold>: This research was supported by grants USPHS/NIH/NIAMS K0-1 AR02079 (MM) and R03 AR49936 (MM).</p>",
"<p>We thank members of Dr. Simon's lab, Microarray Core Facility at SUNY at Stony Brook, Microarray Core Facility at Cold Spring Harbor Laboratory, an... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>MHCI negative cells express low levels of Ki67</bold>. (A) A representative flow cytometric analysis of the expression of proliferation antigen Ki67 in MHCI positive, and MHCI negative cells. Gates were set using isotype control antibodies ... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Selected genes enriched in α6<sup>+</sup>/MHCI<sup>+ </sup>cells compared to α6<sup>+</sup>/MHCI<sup>- </sup>cells.</p></caption><table frame=\"hsides\" rules=\"groups\"><tbody><tr><td colspan=\"2\"><hr/></td></tr><tr><td align=\"left\"><bo... | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>List of the genes that are differentially expressed in α6+/MHCI- cells and in α6+/MHCI+ cells. Entire Affymetrix probe set and their annotated genes that are up-regulated ≥ 2-fold in either α6+/MHCI- cells or ... | [
"<table-wrap-foot><p>Functional classification of some of the genes that are selectively upregulated ≥ 2 fold in α6<sup>+</sup>/MHCI<sup>+ </sup>cells relative to α6<sup>+</sup>/MHCI<sup>- </sup>cells (for the full list see Additional file ##SUPPL##0##1##). The numbers shown in parentheses are in log2 scale and are... | [
"<graphic xlink:href=\"1471-2164-9-359-1\"/>",
"<graphic xlink:href=\"1471-2164-9-359-2\"/>",
"<graphic xlink:href=\"1471-2164-9-359-3\"/>",
"<graphic xlink:href=\"1471-2164-9-359-4\"/>",
"<graphic xlink:href=\"1471-2164-9-359-5\"/>",
"<graphic xlink:href=\"1471-2164-9-359-6\"/>",
"<graphic xlink:href=\... | [
"<media xlink:href=\"1471-2164-9-359-S1.pdf\" mimetype=\"application\" mime-subtype=\"pdf\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2164-9-359-S2.pdf\" mimetype=\"application\" mime-subtype=\"pdf\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:hr... | [{"surname": ["Blumenberg", "Tomic-Canic", "Jolles P, Zahn H, and Hocker H"], "given-names": ["M", "M"], "article-title": ["Human epidermal keratinocytes: keratinization processes"], "source": ["Formation and Structure of Human Hair"], "year": ["1987"], "volume": ["78"], "publisher-name": ["Basel: Birkhauser Verlag"], ... | {
"acronym": [],
"definition": []
} | 100 | CC BY | no | 2022-01-12 14:47:37 | BMC Genomics. 2008 Jul 30; 9:359 | oa_package/dc/96/PMC2536675.tar.gz |
PMC2536676 | 18664289 | [
"<title>Background</title>",
"<p>Splicing of precursor mRNA is one of the essential cellular processes in eukaryotic organisms. Although this process has been extensively studied since the discovery of splicing three decades ago [##REF##902310##1##,##REF##269380##2##], resulting in a thorough understanding of the... | [
"<title>Methods</title>",
"<title>Computational RNA secondary structure prediction</title>",
"<p>In this work we used four different RNA secondary prediction tools: mfold [##UREF##1##14##,##REF##10329189##15##], RNAsubopt [##REF##10070264##20##], RNAfold [##UREF##4##22##] and Alifold [##REF##12824340##26##].</p... | [
"<title>Results</title>",
"<title>Secondary structure of <italic>RPS17B </italic>intron and the efficiency of splicing</title>",
"<p>The first goal of our study was to determine if the splicing efficiency results previously reported for <italic>RPS17B </italic>intron [##REF##7493320##8##] can be correlated with... | [
"<title>Discussion</title>",
"<p>The hypothesis that secondary structure interactions within yeast introns are needed for efficient splicing was proposed two decades ago [##UREF##0##3##]. Since then, experimental evidence in support of this hypothesis was found for several of <italic>S. cerevisiae's </italic>intr... | [
"<title>Conclusion</title>",
"<p>Our computational study offers further insights into the role of pre-mRNA secondary structure in gene splicing in yeast. We show that it is necessary to consider near-optimal structure predictions to be able to detect structural differences between intron mutants that have differe... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>SR conceived the study, performed computational experiments and drafted the manuscript. HHH and AKM participated in the design and coordination of the study and together with BFO supervised the research project. BM designed and performed laboratory experiments and help... | [
"<title>Acknowledgements</title>",
"<p>We gratefully acknowledge valuable feedback from the four anonymous reviewers, which helped us to improve several aspects of our study.</p>",
"<p>S. Rogic was supported by an NSERC (the Natural Sciences and Engineering Research Council of Canada) Discovery Grant to A. Mack... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Distribution histograms of structural branchpoint distances for (a) wt, (b) <italic>3mUB1</italic>, (c) <italic>5mUB1</italic>, (d) <italic>8mUB1</italic>, (e) <italic>3mDB1</italic>, (f) <italic>5mDB1</italic>, (g) <italic>3mUB1_3mDB1</italic>, ... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Average structural branchpoint distances for the wildtype (wt) <italic>RPS17B </italic>intron and Libri et al.'s [##REF##7493320##8##] intron mutants.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\"><bo... | [
"<disp-formula id=\"bmcM1\"><label>(1)</label><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2164-9-355-i1\" overflow=\"scroll\"><mml:semantics><mml:mrow><mml:mi>P</mml:mi><mml:mo stretchy=\"false\">(</mml:mo><mml:msub><mml:mi>S</mml:mi><mml:mi>i</mml:mi></mml:msub><mml:mo stretchy... | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Minimum free energy structures for Libri et al.'s [##REF##7493320##8##] mutants predicted by mfold.</p></caption></supplementary-material>",
"<supplementary-material content-type=\"local-data\" id=\"S2\"><ca... | [
"<table-wrap-foot><p>Levels of splicing efficiency were approximated from the gel images in Figure 2A in [##REF##7493320##8##]. The numbers within parentheses correspond to numerical values assigned to descriptive splicing efficiency labels.</p></table-wrap-foot>",
"<table-wrap-foot><p>We inferred levels of splic... | [
"<graphic xlink:href=\"1471-2164-9-355-1\"/>",
"<graphic xlink:href=\"1471-2164-9-355-2\"/>",
"<graphic xlink:href=\"1471-2164-9-355-3\"/>",
"<graphic xlink:href=\"1471-2164-9-355-4\"/>",
"<graphic xlink:href=\"1471-2164-9-355-5\"/>",
"<graphic xlink:href=\"1471-2164-9-355-6\"/>",
"<graphic xlink:href=\... | [
"<media xlink:href=\"1471-2164-9-355-S1.pdf\" mimetype=\"application\" mime-subtype=\"pdf\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2164-9-355-S2.pdf\" mimetype=\"application\" mime-subtype=\"pdf\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:hr... | [{"surname": ["Parker", "Patterson", "Inouye M, Dudock BS"], "given-names": ["R", "B"], "article-title": ["Architecture of fungal introns: implications for spliceosome assembly"], "source": ["Molecular biology of RNA: new perspectives"], "year": ["1987"], "publisher-name": ["San Diego, CA, USA: Academic Press, Inc"], "... | {
"acronym": [],
"definition": []
} | 46 | CC BY | no | 2022-01-12 14:47:37 | BMC Genomics. 2008 Jul 29; 9:355 | oa_package/08/c9/PMC2536676.tar.gz |
PMC2536677 | 18706115 | [
"<title>Background</title>",
"<p>Efforts at extracting biologically meaningful information from the genome sequence of <italic>Plasmodium sp</italic>. are fueled by the necessity to find new methods of malaria control. <italic>Plasmodium falciparum </italic>resistance to most common antimalarials such as chloroqu... | [
"<title>Methods</title>",
"<title>Parasite cultures</title>",
"<p>The FCR3 strain (FUP/CB line) [##REF##1944415##62##] of <italic>P. falciparum </italic>was used throughout the experiments. Parasites were cultured using the method described by Trager and Jensen with the modifications described in Ralph et al. [... | [
"<title>Results</title>",
"<title>Choice of experimental design</title>",
"<p>In order to work with homogeneous parasite populations, tightly synchronized parasites were used in all experiments, along with an artesunate concentration which irreversibly damages 100% of the parasites within 3 hours. The lethal do... | [
"<title>Discussion</title>",
"<p>The methodology adopted here allowed us to find reproducible alterations of the transcriptome in <italic>P. falciparum </italic>parasites under artesunate pressure. To overcome the major hurdle of developmentally regulated genes, we combined the use of a fast acting drug at high d... | [
"<title>Conclusion</title>",
"<p>The rapid parasiticidal activity of artesunate at high doses allowed us to study the effects of the drug on the transcriptome of synchronized parasite cultures over a short 3 hour time window. A positive bias was observed in favor of subtelomeric localization, polymorphism and pre... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>GSH: reduced glutathione; ACS: Acyl CoA synthetase; TAP: transcription associated protein; CQ: chloroquine; HS: heat-shock; ART: artesunate; SNP: single nucleotide polymorphism; HMM: hidden Markov model</p>",
"<title>Authors' contributions</title>",
"<p>ON establishment of ... | [
"<title>Acknowledgements</title>",
"<p>The work received financial support from the Délégation Générale pour l'Armement (DGA n°22120/DSP/SREAF and n°04 34 025), the Programme PAL+/Fonds National pour la Science, the Institut Pasteur, the Fonds dédié \"Combattre les Maladies parasitaires\" (Sanofi-Aventis/Ministèr... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Association plots of gene expression with gene chromosomal localization, predicted export sequences and polymorphism</bold>. A : Bias in gene expression versus gene chromosomal localization (subtel = subtelomeric position of gene defined as... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Differentially expressed genes involved in antioxidant defence in artesunate-treated cells</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Gene ID</bold></td><td align=\"left\"><bold>Description</bo... | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional File 1</title><p><bold>Distribution of log ratios for statistically significant genes</bold>. Distribution of log ratios for genes differentially expressed upon 3 hour incubation with artesunate. Grey bars: genes selected (log... | [
"<table-wrap-foot><p>Genes coding for proteins involved in antioxidant defence defined in [##REF##15245577##23##].</p><p>Gene ID: identifier as found in PlasmoDB.</p><p>Art columns: log ratios of gene expression under artesunate exposure at 90 minutes and 3 hours.</p><p>HS column: over (+) or under (-) expression.<... | [
"<graphic xlink:href=\"1471-2164-9-388-1\"/>",
"<graphic xlink:href=\"1471-2164-9-388-2\"/>",
"<graphic xlink:href=\"1471-2164-9-388-3\"/>"
] | [
"<media xlink:href=\"1471-2164-9-388-S1.pdf\" mimetype=\"application\" mime-subtype=\"pdf\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2164-9-388-S2.xls\" mimetype=\"application\" mime-subtype=\"vnd.ms-excel\"><caption><p>Click here for file</p></caption></media>",
"<media... | [{"collab": ["WHO"], "article-title": ["Antimalarial drug combination therapy"], "source": ["WHO/CDS/RBM"], "year": ["2001"], "publisher-name": ["Geneva , World Health Organization"]}, {"surname": ["Ginsburg"], "given-names": ["H"], "article-title": ["Malaria Parasite Metabolic Pathways"]}, {"collab": ["R\u00a0Developm... | {
"acronym": [],
"definition": []
} | 69 | CC BY | no | 2022-01-12 14:47:37 | BMC Genomics. 2008 Aug 18; 9:388 | oa_package/b1/1b/PMC2536677.tar.gz |
PMC2536678 | 18667070 | [
"<title>Background</title>",
"<p>Understanding the mode of action of antitumor drugs is considered an absolute prerequisite for the advancement on the design of new drugs. It is generally believed that antitumor activity is mediated by the capacity of certain drugs to induce DNA damage and trigger apoptosis. Howe... | [
"<title>Methods</title>",
"<title>Yeast growth and daunorubicin treatment</title>",
"<p>Daunorubicin (Sigma, St. Louis, MO, U.S.A.) was freshly prepared as a 2 mM stock solution in sterile 150 mM NaCl solution, and diluted to each final concentrations before use. A single colony of <italic>S. cerevisiae </itali... | [
"<title>Results</title>",
"<title>Effects of daunorubicin on the yeast transcriptome</title>",
"<p>The effects of daunorubicin on the yeast transcriptome were studied after 1 h and 4 h of treatment (Figure ##FIG##0##1##). The results indicate a general inhibitory effect of daunorubicin at both time points, as d... | [
"<title>Discussion</title>",
"<p>The yeast <italic>Saccharomyces cerevisiae </italic>is a favourite tool for testing drugs that interact and/or modify gene regulation, since it shares many common regulatory mechanisms with vertebrates, ranging from cell cycle to transcriptional regulation [##REF##11121507##13##,#... | [
"<title>Conclusion</title>",
"<p>The yeast <italic>Saccharomyces cerevisiae </italic>is a powerful tool for the study the effects of drugs on eukaryotic cells. We showed that the antitumor drug daunorubicin alters transcription of some very specific subsets of genes, in a pattern in which sugar- metabolising path... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>MR: Growth effects, microarray analysis, qRT-PCR. MC: qRT-PCR analysis, technical assistance. JP & BP: co-direction, data mining and analysis, preparation and writing of the manuscript. All co-authors read and approved the manuscript.</p>"
] | [
"<title>Acknowledgements</title>",
"<p>This work has been supported by the Spanish Ministry for Education and Science (MEC, grants BIO2005-00840, BFU2007-60998/BMC and AGL2000-0133-P4-03). The contribution of the Centre de Referència en Biotecnologia de la Generalitat de Catalunya is also acknowledged.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Effects of daunorubicin to the yeast transcriptome.</bold> Expression data from treated and untreated cells (expressed as binary logs) were compared before and after one and four hours of incubation with daunorubicin. Data are represented a... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Gene clusters defined by SOM analysis</p></caption><table frame=\"hsides\" rules=\"groups\"><tbody><tr><td align=\"center\" colspan=\"4\">Cluster A</td><td align=\"left\">Cluster B</td><td align=\"left\">Cluster C</td><td align=\"center\" c... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>a) Data expressed as dual logarithmic values of expression ratios, treated versus untreated. Corrected by <italic>RPO21 </italic>expression.</p><p>b) Student's T-Test, time 0 <italic>versus </italic>time 4 h ratios</p></table-wrap-foot>",
"<table-wrap-foot><p>a) Number of genes associated to ... | [
"<graphic xlink:href=\"1471-2164-9-358-1\"/>",
"<graphic xlink:href=\"1471-2164-9-358-2\"/>",
"<graphic xlink:href=\"1471-2164-9-358-3\"/>",
"<graphic xlink:href=\"1471-2164-9-358-4\"/>",
"<graphic xlink:href=\"1471-2164-9-358-5\"/>",
"<graphic xlink:href=\"1471-2164-9-358-6\"/>"
] | [] | [{"surname": ["Chaires", "Hurley L, Chaires JB"], "given-names": ["JB"], "article-title": ["Molecular recognition of DNA by daunorubicin"], "source": ["Advances in DNA sequence specific agents"], "year": ["1996"], "volume": ["2"], "publisher-name": ["Greenwich, CT: JAI Press Inc"], "fpage": ["141"], "lpage": ["167"]}] | {
"acronym": [],
"definition": []
} | 35 | CC BY | no | 2022-01-12 14:47:37 | BMC Genomics. 2008 Jul 30; 9:358 | oa_package/f0/77/PMC2536678.tar.gz |
PMC2536679 | 18671860 | [
"<title>Background</title>",
"<p>We engineered the first respiratory <italic>Saccharomyces cerevisiae </italic>strain, KOY.TM6*P, by integrating the gene encoding a chimeric hexose transporter, Tm6*, into the genome of an <italic>hxt </italic>null yeast [##REF##15071495##1##]. Subsequently we demonstrated the tra... | [
"<title>Methods</title>",
"<title>Yeast strains</title>",
"<p>The auxotrophic wine yeast strain V5 (<italic>MAT</italic>a <italic>ura3 gal</italic>) and the V5 <italic>hxt1–hxt7</italic>Δ mutant strain (<italic>MAT</italic>a <italic>ura3 gal hxt514</italic>Δ::loxP <italic>hxt367</italic>Δ::lox P <italic>hxt2</i... | [
"<title>Results</title>",
"<p>We compared the transcriptional profiles of the V5 and V5.TM6*P strains cultured in 50 g/L glucose, with samples extracted between 38 and 6 g/L residual glucose. We identified 190 genes with adjusted p-values < 0.05 that changed their expression levels either up by a factor of ≥2.... | [
"<title>Discussion</title>",
"<p>The main physiological change in both the diauxic shift and the transition from a respiro-fermentative to a respiratory metabolism is that glycolysis is channelled to support respiration: this occurs upon glucose depletion during the diauxic shift and throughout the growth curve i... | [
"<title>Conclusion</title>",
"<p>In this study, we have been able to characterize the transcriptome of a unique respiratory yeast strain. We have been able to identify highly complete collections of known genes in the TCA cycle, glyoxylate cycle and respiratory chain that are consistent with a respiratory metabol... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>NB initiated the study, prepared the RNA and participated in the data analysis and interpretation, particularly of the transcription factor binding sites. CF carried out the fermentations. PM performed the array analysis. MW performed the statistical analyses of the ar... | [
"<title>Acknowledgements</title>",
"<p>This work was supported by the European Commission via contracts LSHG-CT-2004-504601 (E-MeP) and LSHG-CT-2006-037793 (OptiCryst) to RMB, and QLG2-CT-2002-00988 (SPINE) to LG and RMB. The Wistar Genomics facility is supported in part by NCI P30 CA10815-34S3. The BBSRC support... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>An overview of our dataset in the context of key yeast metabolic pathways</bold>. Genes with altered expression in V5.TM6*P compared with V5 are marked as follows: induced genes are denoted in large, bold font; down-regulated genes are cros... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Growth characteristics of V5 and V5.TM6*P at 30°C starting at 50 g/L glucose.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"left\"><bold>V5</bold></td><td align=\"left\"><bold>V5.TM6*P</bold></td></tr></t... | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p><bold>Transcriptome analysis of V5.TM6*P compared with the parental V5 strain</bold>. Genes were tabulated if their expression was changed on going from the V5 parental strain to V5.TM6*P, as described in 'Mat... | [
"<table-wrap-foot><p>Yields were calculated as g product (dry weight, ethanol or glucose, respectively)/g of glucose consumed/catabolised for V5 and V5.TM6*P, cultured as described in 'Materials and Methods'. The numbers in parentheses are the standard error of the mean, together with the number of replicates (n) f... | [
"<graphic xlink:href=\"1471-2164-9-365-1\"/>",
"<graphic xlink:href=\"1471-2164-9-365-2\"/>",
"<graphic xlink:href=\"1471-2164-9-365-3\"/>",
"<graphic xlink:href=\"1471-2164-9-365-4\"/>"
] | [
"<media xlink:href=\"1471-2164-9-365-S1.pdf\" mimetype=\"application\" mime-subtype=\"pdf\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2164-9-365-S2.xls\" mimetype=\"application\" mime-subtype=\"vnd.ms-excel\"><caption><p>Click here for file</p></caption></media>",
"<media... | [{"surname": ["Smyth", "Gentleman R, Carey V, Dudoit S, Irizarry R, Huber W"], "given-names": ["GK"], "article-title": ["Limma: linear models for microarray data"], "source": ["Bioinformatics and Computational Biology Solutions using R and Bioconductor"], "year": ["2005"], "publisher-name": ["New York , Springer"], "fp... | {
"acronym": [],
"definition": []
} | 41 | CC BY | no | 2022-01-12 14:53:25 | BMC Genomics. 2008 Jul 31; 9:365 | oa_package/3d/58/PMC2536679.tar.gz |
PMC2536680 | 18671881 | [
"<title>Background</title>",
"<p>Microarrays are most often developed from transcript information in the form of EST (Expressed Sequence Tags) sequences [e.g. [##REF##15453914##1##]]. The annotation of those sequences with information on genetics, homology, functions, metabolic regulations and toxicology, are key... | [] | [] | [
"<title>Utility and Discussion</title>",
"<p>We present SoyXpress, where we have integrated 380,095 soybean EST sequences and Affymetrix microarray data with functional annotations such as metabolic pathways and gene ontology. The SoyXpress user web interface was developed to access the database and display the d... | [
"<title>Conclusion</title>",
"<p>Our scope was to develop a database with a suite of web interfaces to allow users to easily retrieve data and results of microarray experiments with cross-referenced annotations of the expressed sequence tags (EST) and hyperlinks to external public databases. The SoyXpress environ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Construction and Content</title>",
"<title>Schema and implementation: Sequence core tables</title>",
"<p>SoyXpress (Figure ##FIG##0##1##) is implemented in MySQL (version 5.0.18 – please see Availability and requirements for more information). Perl (version 5.8.6) and Perl CGI (please see Availability a... | [
"<title>Acknowledgements</title>",
"<p>The authors wish to thank Lee Zamparo, Julie Livingstone, Ernest Retzel and Frederic Latour for bioinformatics assistance. We are also grateful to Lee Zamparo for critical reading of the manuscript. This project was funded by the Advanced Foods and Materials Network (AFMNet)... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>The main page of the soy database</bold>. Users can submit queries to the database to retrieve all available IDs and annotations for the soybean transcript of interest. Queries can be made using EST ID, GenBank accession number, GenBank GI ... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1471-2164-9-368-1\"/>",
"<graphic xlink:href=\"1471-2164-9-368-2\"/>",
"<graphic xlink:href=\"1471-2164-9-368-3\"/>",
"<graphic xlink:href=\"1471-2164-9-368-4\"/>"
] | [] | [{"surname": ["Firth"], "given-names": ["D"], "article-title": ["CGIwithR: Facilities for processing web forms using R"], "source": ["Journal of Statistical Software"], "year": ["2003"], "volume": ["8"], "fpage": ["1"], "lpage": ["8"]}, {"collab": ["Affymetrix"], "article-title": ["Data Sheet: GeneChip Soybean Genome A... | {
"acronym": [],
"definition": []
} | 15 | CC BY | no | 2022-01-12 14:47:37 | BMC Genomics. 2008 Aug 1; 9:368 | oa_package/0a/d7/PMC2536680.tar.gz |
PMC2536681 | 18702810 | [
"<title>Background</title>",
"<p>Lysophosphatidic acid (LPA; monoacyl-glycerol-3-phoshate) is a lipid mediator that stimulates the proliferation, migration and survival of many cell types [##REF##15273989##1##]. LPA acts through at least five distinct G protein-coupled receptors (GPCRs), termed LPA<sub>1–5</sub>,... | [
"<title>Methods</title>",
"<title>Cell culture</title>",
"<p>Mouse embryonic fibroblasts (MEFs) were immortalized at passage 2 by retroviral introduction of the T-box member Tbx2 (LZRS-TBX2-ires-EGFP) to represses p53 function [##REF##11062467##39##]. MEFs were cultured in Dulbecco's Modified Eagle's Medium (DM... | [
"<title>Results and Discussion</title>",
"<title>Characterization of MEFs</title>",
"<p>We examined the mitogenic response and LPA receptor expression profile of immortalized mouse embryonic fibroblasts (MEFs). Stimulation of serum-deprived, nearly confluent MEFs with saturating doses of LPA (5 μM) resulted in ... | [
"<title>Results and Discussion</title>",
"<title>Characterization of MEFs</title>",
"<p>We examined the mitogenic response and LPA receptor expression profile of immortalized mouse embryonic fibroblasts (MEFs). Stimulation of serum-deprived, nearly confluent MEFs with saturating doses of LPA (5 μM) resulted in ... | [
"<title>Conclusion</title>",
"<p>Dissecting the transcriptional response to growth factors in selected cell systems may help to better understand various aspects of embryonic development, adult tissue homeostasis and cancer. The present study characterizes the global transcriptional program of MEFs to LPA and the... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>CS performed the experiments, did the data and bioinformatics analysis and drafted parts of the manuscript. RK participated in the microarray experiments and helped with data analysis. WHM conceived and coordinated the study and wrote the manuscript. All authors read a... | [
"<title>Acknowledgements</title>",
"<p>We thank Marloes Bagijn for PCR and biochemical experiments, Mike Heimerikx and Marja Nieuwland for assistance with the microarray studies, Arno Velds and Daoud Sie for bioinformatics assistance and Lodewijk Wessels for help with statistical analysis. We thank Panthea Taghav... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Characterization of MEFs</bold>. <bold>(A) </bold>Mitogenic responsiveness of MEFs as measured by [<sup>3</sup>H]thymidine incorporation. Serum-deprived cells (\"control\") were treated with fetal calf serum (FCS; 10%), LPA (10 μM) or EGF (... | [] | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p><bold>Complete data set of LPA-regulated target genes in MEFs</bold>. 1508 genes were selected based on the criteria p < 0.01 in at least two samples (i.e. two different time points or the same time point i... | [] | [
"<graphic xlink:href=\"1471-2164-9-387-1\"/>",
"<graphic xlink:href=\"1471-2164-9-387-2\"/>",
"<graphic xlink:href=\"1471-2164-9-387-3\"/>",
"<graphic xlink:href=\"1471-2164-9-387-4\"/>",
"<graphic xlink:href=\"1471-2164-9-387-5\"/>",
"<graphic xlink:href=\"1471-2164-9-387-6\"/>",
"<graphic xlink:href=\... | [
"<media xlink:href=\"1471-2164-9-387-S1.xls\" mimetype=\"application\" mime-subtype=\"vnd.ms-excel\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2164-9-387-S2.ppt\" mimetype=\"application\" mime-subtype=\"vnd.ms-powerpoint\"><caption><p>Click here for file</p></caption></medi... | [] | {
"acronym": [],
"definition": []
} | 43 | CC BY | no | 2022-01-12 14:47:37 | BMC Genomics. 2008 Aug 14; 9:387 | oa_package/e2/b0/PMC2536681.tar.gz |
PMC2537558 | 18793471 | [
"<title>Background</title>",
"<p>It has been established that co-regulated genes exhibit similar expression patterns as a norm and not as an exception [##REF##15173566##1##]. Microarray allows sensitive, detection of small differences in transcript abundance [##UREF##0##2##], therefore it is utilized extensively ... | [
"<title>Methods</title>",
"<title>Microarray datasets</title>",
"<p>The dataset consists of a total of 18 groups of experiments which were already preprocessed in MAS5.0 <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.affymetrix.com\"/> taken from aboveground samples of the abiotic stress series of micr... | [
"<title>Results and discussion</title>",
"<p>Genes represented in the ATH1-1250 chip can be queried based on Affymetrix™ Probeid or AGICode [##REF##15173566##1##]. We utilised carbohydrate biosynthesis genes as a test case and at present, the database (hosted at <ext-link ext-link-type=\"uri\" xlink:href=\"http:/... | [
"<title>Results and discussion</title>",
"<p>Genes represented in the ATH1-1250 chip can be queried based on Affymetrix™ Probeid or AGICode [##REF##15173566##1##]. We utilised carbohydrate biosynthesis genes as a test case and at present, the database (hosted at <ext-link ext-link-type=\"uri\" xlink:href=\"http:/... | [
"<title>Conclusion</title>",
"<p>We tried to incorporate the conditional co-regulation for calculating the relationship among genes by addressing the limitation of clustering methods in which genes that are expressed in most of the measurements are highlighted while genes that are co-expressed in the subset of co... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Setting up database</title>",
"<title>Storage of preprocessed data</title>",
"<p>We utilized Cyber-T <ext-link ext-link-type=\"uri\" xlink:href=\"http://CYBERt.microarray.ics.uci.edu\"/> to measure the confidence value associated with fold change for each gene. The Cyber-T analysis (Control versus Exper... | [
"<title>Acknowledgements</title>",
"<p>AR acknowledges thanks to Dr Georg Seifert for involvement in the data mining project at John Innes Centre, UK and his useful inputs in writing the manuscript. AR is thankful to UCOST (grant UCS&T/R&D/LS-09/06) for supporting the datamining project leading to ASIDB. ... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Overview of the database construction</bold>. E<sub>1</sub>, E<sub>2</sub>, E<sub>3</sub>, E<sub>n </sub>is the representation of the time points in temporal experiments. G<sub>1</sub>, G<sub>2</sub>, G<sub>3</sub>, G<sub>n </sub>is the rep... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Comparison of ASIDB score with CSB.DB for single gene. Descending order of score from ASIDB compared with the pearson correlation and the p value from CSB.DB for QUA1 for atge0200</p></caption><table frame=\"hsides\" rules=\"groups\"><thead... | [
"<disp-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S7-i1\" overflow=\"scroll\">\n <mml:semantics>\n <mml:mrow>\n <mml:mtext>Score</mml:mtext>\n <mml:mo>=<... | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>** Genes not present in CSB.DB (atge0200 matrix)</p></table-wrap-foot>",
"<table-wrap-foot><p>*NA represents genes omitted in the CSB.DB (atge0200 matrix)</p></table-wrap-foot>",
"<table-wrap-foot><p>*NA is genes omitted in the CSB.DB (atge0200 matrix)</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1471-2105-9-S9-S7-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S7-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S7-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S7-4\"/>"
] | [] | [{"surname": ["Causton", "Quackenbush", "Brazma"], "given-names": ["HC", "J", "A"], "source": ["A Beginner's Guide Microarray Gene Expression Data Analysis"], "year": ["2003"], "publisher-name": ["Blackwell Publishing"]}, {"surname": ["Erdal", "Ozturk", "Armbruster", "Ferhatosmanoglu", "Ray"], "given-names": ["S", "O",... | {
"acronym": [],
"definition": []
} | 32 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S7 | oa_package/33/ca/PMC2537558.tar.gz |
PMC2537559 | 18793472 | [
"<title>Introduction</title>",
"<p>Metastasis (originating from Greek <italic>μετισταναι</italic>, to change) is the single most important event changing the course of cancer from manageable to fatal. For metastasis to occur, tumor cells must acquire the ability to detach from the original tumor, relocate through... | [
"<title>Methods</title>",
"<title>Overview of the analysis pipeline</title>",
"<p>The general overview of the analysis pipeline is given in Supplemental Figure ##FIG##0##1## (Additional File ##SUPPL##0##1##). Our pipeline includes most of the standard analysis steps, but has a few important differences. We exte... | [
"<title>Results and discussion</title>",
"<p>Analysis of the Ramaswamy <italic>et al</italic>. meta-set identified 741 genes differentially expressed between 64 primary solid tumor samples and 12 metastatic tumor samples. The complete list of these genes with functional annotation is given in Supplementary Table ... | [
"<title>Results and discussion</title>",
"<p>Analysis of the Ramaswamy <italic>et al</italic>. meta-set identified 741 genes differentially expressed between 64 primary solid tumor samples and 12 metastatic tumor samples. The complete list of these genes with functional annotation is given in Supplementary Table ... | [] | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>AAP has collected the data, developed the algorithms, the software and performed data analysis. AAP, MMW and DHT interpreted the results and wrote the paper.<... | [
"<title>Acknowledgements</title>",
"<p>Dr. Thamm is supported by American Cancer Society grant RSG-04-219-01-CCE.</p>",
"<p>This article has been published as part of <italic>BMC Bioinformatics </italic>Volume 9 Supplement 9, 2008: Proceedings of the Fifth Annual MCBIOS Conference. Systems Biology: Bridging the... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Biological pathways significantly overrepresented in the shortlist of genes differentially expressed between primary solid and metastatic tumors (Ramaswamy et al. data set).</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure... | [] | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Supplementary figures 1–6 and Supplementary tables 1–6.</p></caption></supplementary-material>"
] | [] | [
"<graphic xlink:href=\"1471-2105-9-S9-S8-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S8-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S8-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S8-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S8-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S8-6\"/>"
] | [
"<media xlink:href=\"1471-2105-9-S9-S8-S1.zip\" mimetype=\"application\" mime-subtype=\"x-zip-compressed\"><caption><p>Click here for file</p></caption></media>"
] | [{"surname": ["Fidler", "DeVita VT, Hellman, S, Rosenberg SA"], "given-names": ["IJ"], "article-title": ["Molecular biology of cancer: invasion and metastasis"], "source": ["Cancer Principles and Practice of Oncology"], "year": ["1997"], "publisher-name": ["Philadelphia: Lippincott-Raven"], "fpage": ["135"], "lpage": [... | {
"acronym": [],
"definition": []
} | 58 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S8 | oa_package/15/29/PMC2537559.tar.gz |
PMC2537560 | 18793473 | [
"<title>Background</title>",
"<p>DNA microarray technology [##REF##9634850##1##,##REF##7569999##2##] has rapidly advanced due to the intrinsic and unprecedented ability to simultaneously measure gene expression on a whole genome basis. Microarray technology continues to develop and is widely cited as offering muc... | [
"<title>Materials and methods</title>",
"<title>Microarray datasets and software</title>",
"<p>Nine publicly available microarray datasets were used to demonstrate the relative prediction performance of the proposed VIP gene selection approach. The datasets are from Alon <italic>et al</italic>. [##REF##10359783... | [
"<title>Results</title>",
"<p>The VIP gene selection approach for microarray based molecular signatures was applied to the nine publicly available microarray gene expression datasets described in Table ##TAB##0##1##. For the purpose of comparison, the p-value ranking method was also used. For each dataset, an unb... | [
"<title>Discussion</title>",
"<p>Quantitatively assessing the effectiveness of gene selection methods can be problematic owing to several limitations among which selection bias caused by information leakage from training phase to validation phase figures prominently [##REF##16670007##24##]. The most severe bias w... | [
"<title>Conclusion</title>",
"<p>The new hybrid gene selection approach was investigated for identifying VIP genes from nine diverse gene expression datasets. The VIP gene selection approach quantifies discriminatory capability for differentiating sample classes using both discrimination analysis and p-value rank... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Disclaimer</title>",
"<p>The views presented in this article do not necessarily reflect those of the US Food and Drug Administration.</p>",
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>ZS had... | [
"<title>Acknowledgements</title>",
"<p>ZS is grateful to the National Center for Toxicological Research (NCTR) of U.S. Food and Drug Administration (FDA) for postdoctoral support through the Oak Ridge Institute for Science and Education (ORISE).</p>",
"<p>This article has been published as part of <italic>BMC B... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>The flowchart for the classifier development and validation using three gene sets: (A) Top 50 p-value ranked genes; (B) Top 50 VIP genes; and (C) the unique VIP genes. Specifically, the data set is first randomly divided into two thirds of sample... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Nine microarray datasets used in the study.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\"><bold>Name</bold></td><td align=\"center\"><bold>Cancer type</bold></td><td align=\"center\"><bold>Prediction ... | [
"<inline-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S9-i1\" overflow=\"scroll\"><mml:semantics><mml:mrow><mml:msubsup><mml:mtext>X</mml:mtext><mml:mrow><mml:mn>1</mml:mn><mml:mi>m</mml:mi></mml:mrow><mml:mo>'</mml:mo></mml:msubsup></mml:mrow></mml:semantics></... | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1471-2105-9-S9-S9-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S9-2\"/>"
] | [] | [{"surname": ["Quackenbush"], "given-names": ["J"], "article-title": ["Computational approaches to analysis of DNA microarray data"], "source": ["Methods Inf Med"], "year": ["2006"], "volume": ["45"], "fpage": ["91"], "lpage": ["103"]}, {"surname": ["Jain", "Duin", "Mao"], "given-names": ["AK", "RPW", "J"], "article-ti... | {
"acronym": [],
"definition": []
} | 58 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S9 | oa_package/05/6d/PMC2537560.tar.gz |
PMC2537561 | 18793455 | [
"<title>Background</title>",
"<p>A fundamental step in most microarray experiments is determining one or more short lists of differentially expressed genes (DEGs) that distinguish biological conditions, such as disease from health. Challenges regarding the reliability of microarray results have largely been found... | [
"<title>Methods</title>",
"<title>MAQC data sets</title>",
"<p>The MAQC data sets analyzed in this study are available from GEO under series accession number GSE5350. Analyses identified differentially expressed genes between the primary samples A (Stratagene Universal Human Reference RNA, Catalog #740000) and ... | [
"<title>Results</title>",
"<p>The POG for a number of gene selection scenarios employing <italic>P </italic>and/or FC are compared and a numerical example (see side box) is provided that shows how the simple <italic>t</italic>-test, when sample size is small, results in selection of different genes purely by chan... | [
"<title>Discussion</title>",
"<p>A fundamental requirement in microarray experiments is that the identification of DEG lists must be reproducible if the data and scientific conclusion from them are to be credible. DEG lists are normally developed by rank-ordering genes in accordance with a suitable surrogate valu... | [
"<title>Conclusion</title>",
"<p>The results show that selecting DEGs based solely on <italic>P </italic>from a simple t-test most often predestines a poor concordance in DEG lists, particularly for small numbers of genes. In contrast, using FC-ranking in conjunction with a non-stringent <italic>P</italic>-cutoff... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Disclaimer</title>",
"<p>This document has been reviewed in accordance with United States Food and Drug Administration (FDA) policy and approved for publication. Approval does not signify that the contents necessarily reflect the position or opinions of the FDA nor does mention of trade names or commercia... | [
"<title>Acknowledgements</title>",
"<p>We thank participants of the MicroArray Quality Control (MAQC) project for generating the large data sets that were used in this study. Many MAQC participants contributed to the sometimes-heated discussions on the topic of this paper during MAQC teleconferences and face-to-f... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Concordance for inter-site comparisons. Each panel represents the POG results for a commercial platform of inter-site consistency in terms of DEGs between samples B and A. For each of the six gene selection methods, there are three possible inter... | [] | [
"<disp-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S10-i1\" overflow=\"scroll\">\n <mml:semantics>\n <mml:mrow>\n <mml:mi>t</mml:mi>\n <mml:mo>=</mml:mo>\n ... | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1471-2105-9-S9-S10-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S10-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S10-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S10-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S10-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S10-6\"/>",
"<gr... | [] | [{"surname": ["Shi", "Jones", "Jensen", "Harris", "Perkins", "Goodsaid", "Guo", "Croner", "Boysen", "Fang"], "given-names": ["L", "W", "RV", "SC", "R", "FM", "L", "LJ", "C", "H"], "article-title": ["The reproducibility of lists of differentially expressed genes in microarray studies"], "source": ["Nature Precedings"], ... | {
"acronym": [],
"definition": []
} | 56 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S10 | oa_package/7b/1b/PMC2537561.tar.gz |
PMC2537562 | 18793456 | [
"<title>Introduction</title>",
"<p>Large-scale or systems-wide analysis of relationship networks (e.g. protein-protein) is built from individual links. Since labor is expensive, the domain of knowledge vast, and time short, automated methods of constructing these networks is of paramount importance in bioinformat... | [
"<title>Materials and methods</title>",
"<p>The DREAD algorithm begins with the input of a sentence containing a term of interest, which must appear in a thesaurus of biomedical objects, including genes, chemicals, and clinical phenotypes (described below). The final output of the algorithm is a set of directed e... | [
"<title>Results</title>",
"<title>SVM cross validation on GENIA corpus</title>",
"<p>To benchmark the performance of the convolution dependency path kernel on standardized biomedical corpora, we subjected the GENIA training data for each of the three SVMs (see <italic>GENIA training corpus </italic>section) to ... | [
"<title>Discussion and conclusion</title>",
"<p>Analysis of unstandardized text comes with many challenges for term recognition, synonym mapping, homonym resolution, etc. And directional relation detection is yet another challenge, not just in a technical sense of algorithmically detecting relations, but also in ... | [
"<title>Discussion and conclusion</title>",
"<p>Analysis of unstandardized text comes with many challenges for term recognition, synonym mapping, homonym resolution, etc. And directional relation detection is yet another challenge, not just in a technical sense of algorithmically detecting relations, but also in ... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>JDW conceived of and supervised the project, CBG wrote the programs and implemented them. Both authors contributed to writing the manuscript.</p>"
] | [
"<title>Acknowledgements</title>",
"<p>We would like to acknowledge funding support from NSF-EPSCoR grant EPS-0447262 and NIH/NLM grant 1 R01 LM009758-01.</p>",
"<p>This article has been published as part of <italic>BMC Bioinformatics </italic>Volume 9 Supplement 9, 2008: Proceedings of the Fifth Annual MCBIOS ... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Flowchart of the relation extraction process.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>An example of sentence structure for the sentence \"<italic>Both isobutylmethylxanthine and theophylline i... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Identifying directional relationships in MEDLINE for the chemical compound caffeine on the basis of summarized relationships after analysis of 17,145 abstracts.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"le... | [
"<disp-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S11-i1\" overflow=\"scroll\">\n <mml:semantics>\n <mml:mrow>\n <mml:msub>\n <mml:mi>K</mml:mi>\n ... | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Possible directional relationships are classified as <bold><underline>F</underline></bold>orward (caffeine affects the object) or <bold><underline>R</underline></bold>everse (the object affects caffeine) and as stimulatory (+), inhibitory (-) or neutral (n). No rel = no relationship found, N.D.... | [
"<graphic xlink:href=\"1471-2105-9-S9-S11-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S11-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S11-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S11-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S11-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S11-6\"/>",
"<gr... | [] | [{"surname": ["Pratt", "Yetisgen-Yildiz"], "given-names": ["W", "M"], "article-title": ["LitLinker: Capturing Connections across the Biomedical Literature"], "source": ["Proceedings of the International Conference on Knowledge Capture (K-Cap'03): 2003; Florida"], "year": ["2003"], "fpage": ["105"], "lpage": ["112"]}, {... | {
"acronym": [],
"definition": []
} | 44 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S11 | oa_package/74/3f/PMC2537562.tar.gz |
PMC2537563 | 18793457 | [
"<title>Introduction and background</title>",
"<p>We are exploring hybrid methods where Markov-based statistical profiles, in a log likelihood discriminator framework, are used to create a fixed-length feature vector for Support Vector Machine (SVM) based classification. The core idea of the method is that whenev... | [
"<title>Methods</title>",
"<title>pMM/SVM method</title>",
"<p>In the typical log likelihood discriminator construction, such as for identification of splice sites, binary classification is provided by the sign of the log odds probability of the splice site vs non-splice-site region. The log odds probability, i... | [
"<title>Results</title>",
"<title>Shannon entropy analysis</title>",
"<p>We analyzed large data sets using a variety of MM based techniques to study the areas of lowered entropy within splice site sample sequences. This analysis was critical to identifying information-rich sequence regions around the splice sit... | [] | [
"<title>Conclusion</title>",
"<p>The main result of this preliminary study shows pMM/SVMs can be trained as splice site classifiers with high accuracy. We believe this approach is applicable to other problem sets, and represents a new approach that combines entropy analysis for feature selection and eventual pMM/... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>SWH conceptualized the project and performed the preliminary pMM/SVM tests. BR performed the extensive Shannon entropy tests, and the pMM/SVM tests with the l... | [
"<title>Acknowledgements</title>",
"<p>We would like to extend special thanks to Dr. Alexander Tchoubanov for preparing the large, multispecies, sequence set for our experiments. SWH would also like to thank the UNO CSCI 6990 Advanced Machine Learning Methods in Bioinformatics Class of 2004 that worked on this to... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Examples of GT – AG splice site sequences.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Illustration of a hyperplane separation of two labeled groups in feature space.</p></caption></fig>",
"<fig... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1471-2105-9-S9-S12-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S12-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S12-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S12-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S12-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S12-6\"/>",
"<gr... | [] | [{"surname": ["Shannon"], "given-names": ["CE"], "article-title": ["\"A Mathematical Theory of Communication\""], "source": ["Bell System Technical Journal"], "year": ["1948"], "volume": ["27"], "fpage": ["379"], "lpage": ["423"], "comment": ["623\u2013656"]}, {"surname": ["Shannon", "Claude"], "given-names": ["E"], "a... | {
"acronym": [],
"definition": []
} | 8 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S12 | oa_package/6a/a9/PMC2537563.tar.gz |
PMC2537564 | 18793458 | [
"<title>Background</title>",
"<p>The bacterium <italic>Staphylococcus aureus </italic>secretes <italic>α</italic>-hemolysin monomers that bind to the outer membrane of susceptible cells. Seven monomers can oligomerize to form a very stable water-filled transmembrane channel [##REF##7809129##1##]. The channel can ... | [
"<title>Methods</title>",
"<p>In our approach we used unsupervised distributed learning of nanopore ionic flow blockade toggles with an MHMM. MHMMs have a long record of successful implementations that started in speech recognition [##UREF##0##8##] and later were used for clustering protein families [##UREF##1##9... | [
"<title>Results</title>",
"<p>We have learned blockade signal clusters for five different types of molecules: two such profile mixtures, learned in 50 iterations, are shown in Figure ##FIG##3##4##. The classification accuracy is shown in Figure ##FIG##4##5##, where we used 10-fold resampling of 500 labeled toggle... | [
"<title>Discussion and conclusion</title>",
"<p>There are several advantages in our approach:</p>",
"<p>• Classification is highly accurate with no data dropped from consideration,</p>",
"<p>• Model parameters may have intuitive physical interpretation (but not in this study),</p>",
"<p>• The MHMM implement... | [
"<title>Discussion and conclusion</title>",
"<p>There are several advantages in our approach:</p>",
"<p>• Classification is highly accurate with no data dropped from consideration,</p>",
"<p>• Model parameters may have intuitive physical interpretation (but not in this study),</p>",
"<p>• The MHMM implement... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>AC conceptualized the project, implemented and tested the MHMM EM algorithm for nanopore ionic flow analysis. SWH helped with writing the manuscript and provi... | [
"<title>Acknowledgements</title>",
"<p>This research was partly funded from an NIH K-22 award (K22LM008794), an NIH R-21 award (R21GM073617), and an NIH program grant sub-contract (R01HG003703).</p>",
"<p>This article has been published as part of <italic>BMC Bioinformatics </italic>Volume 9 Supplement 9, 2008:... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><italic>α</italic>-hemolysin nanopore with captured hairpin.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Upper Level Toggler (ULT) with profile example.</p></caption></fig>",
"<fig position=\"fl... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Forward and backward procedures.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">Forward procedure</td><td align=\"center\">Backward procedure</td></tr></thead><tbody><tr><td align=\"left\"><italic>α</i... | [
"<disp-formula id=\"bmcM1\"><label>(1)</label><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S13-i1\" overflow=\"scroll\">\n <mml:semantics>\n <mml:mrow>\n <mml:mi>A</mml:mi>\n <mml:mi>c</m... | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1471-2105-9-S9-S13-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S13-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S13-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S13-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S13-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S13-6\"/>",
"<gr... | [] | [{"surname": ["Juang", "Rabiner"], "given-names": ["B", "L"], "article-title": ["A probabilistic distance measure for hidden Markov models"], "source": ["AT&T technical journal"], "year": ["1985"], "volume": ["64"], "fpage": ["391"], "lpage": ["408"]}, {"surname": ["Krogh", "Brown", "Mian", "Sj\u00f6lander", "Haussler"... | {
"acronym": [],
"definition": []
} | 21 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S13 | oa_package/37/6a/PMC2537564.tar.gz |
PMC2537565 | 18793459 | [
"<title>Background</title>",
"<p>Understanding the statistical properties of genomic sequences helps recreate the dynamical processes that led to the current DNA structure, and determine gene-related diseases like cancer and Alzheimer disease. For instance, based on the view that non-coding DNA exhibits long-rang... | [
"<title>Methods</title>",
"<title>Numerical representation of genomic sequences</title>",
"<p>Converting the DNA sequence into a digital signal offers the opportunity to apply powerful signal processing methods for the handling and analysis of genomic information. This is, however, not an easy task as the analy... | [
"<title>Results</title>",
"<p>All genome sequences considered in this paper have been extracted from the NIH website <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.ncbi.nlm.nih.gov\"/>. The algorithms were implemented in MATLAB. The DNA sequences were mapped to numerical sequences using the purine-pyrimi... | [] | [
"<title>Conclusion</title>",
"<p>In this paper, we modelled the non-stationary genomic sequences by a time-dependent autoregressive moving average (TD-ARMA) model. By expressing the time-dependent coefficients as linear combinations of parametric basis functions, we were able to transform a linear non-stationary ... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>JSZ derived the different estimation algorithms of the TD-ARMA parameters and performed the simulations. NB proposed the use of the non-stationary analysis an... | [
"<title>Acknowledgements</title>",
"<p>The publication of this paper was partially supported by the Arkansas IDeA Networks of Biomedical Research Excellence (INBRE).</p>",
"<p>This article has been published as part of <italic>BMC Bioinformatics </italic>Volume 9 Supplement 9, 2008: Proceedings of the Fifth Ann... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Gene Structure</bold>. Gene structure of the Human gene 276 located in chromosome 1: The boxes correspond to the exons (coding regions), and the lines between them represent the introns (non-coding regions). The total length of the gene is ... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Index of Randomness of the Coding and Non-Coding segments of Various Gene Sequences</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">Gene NIH accession number</td><td align=\"center\">C. length</td><td a... | [
"<disp-formula id=\"bmcM1\"><label>(1)</label><italic>X</italic>(<italic>t</italic>) = ∫ <italic>A</italic>(<italic>t</italic>, <italic>λ</italic>)<italic>e</italic><sup>2<italic>iπλt </italic></sup><italic>dZ</italic>(<italic>λ</italic>),</disp-formula>",
"<disp-formula id=\"bmcM2\"><label>(2)</label><mml:math x... | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1471-2105-9-S9-S14-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S14-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S14-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S14-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S14-5\"/>"
] | [] | [{"surname": ["Buldyrev", "Goldberger", "Havlin", "Mantegna", "Matsa", "Peng", "Simons", "Stanley"], "given-names": ["SV", "AL", "S", "RN", "ME", "CK", "M", "HE"], "article-title": ["Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis"], "source": ["Physical Review E"], "year": ["1... | {
"acronym": [],
"definition": []
} | 24 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S14 | oa_package/cf/81/PMC2537565.tar.gz |
PMC2537566 | 18793460 | [
"<title>Background</title>",
"<p>Originally employed to analyze single or a small collection of targeted molecules, gas chromatography-mass spectrometry (GC-MS) and other chromatography-spectrometry technologies have emerged as viable tools for the wholesale fingerprinting of complex chemical mixtures. This has b... | [] | [
"<title>Results</title>",
"<title>Algorithm</title>",
"<p>Our alignment method operates in a pairwise fashion: one mass chromatogram, a sample <italic>S</italic>, is aligned with a reference chromatogram, <italic>R</italic>. <italic>R </italic>can be any run from the set of all runs but, once selected, must be ... | [
"<title>Discussion</title>",
"<p>Robust alignment is an important step as it affects not only the quality of comparative post-data analysis but also which type of data analysis can be used [##REF##17466315##9##]. Our iterative block-shifting approach is well suited to subsequent data analysis methods that operate... | [] | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>MC conceived, developed the algorithm, and drafted the manuscript. RJSR and JT coordinated the project and revised the manuscript. All authors read and approv... | [
"<title>Acknowledgements</title>",
"<p>We wish to acknowledge Lulu Xu for conducting the GC-MS experiment and Stephen Jennings for helpful discussions on this study. This project was supported by NIH Grant Number P20 RR-16460 from the IDeA Networks of Biomedical Research Excellence (INBRE) program of the National... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Unaligned chromatograms</bold>. A 500-scan region is shown for each of two total-ion-current chromatograms, <italic>S </italic>and <italic>R</italic>, in a GC-MS experiment.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Algorithm input variables</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\"><bold>Variable</bold></td><td align=\"center\"><bold>Formal Definition</bold></td><td align=\"center\"><bold>Default</bold></td>... | [
"<disp-formula id=\"bmcM1\"><label>(1)</label>{(p<sub>11</sub>, q<sub>11</sub>, 30, 5, 1), (p<sub>21</sub>, q<sub>32</sub>, 40, 3, 1), (p<sub>31</sub>, ϕ, 40, 3, 2),...}</disp-formula>"
] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Alignment result if run 1 is selected as the Reference.</p></caption></supplementary-material>",
"<supplementary-material content-type=\"local-data\" id=\"S2\"><caption><title>Additional file 2</title><p>Ali... | [
"<table-wrap-foot><p>*area %error = 100% × (area<sub>aligned </sub>- area<sub>raw</sub>)/area<sub>raw</sub></p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1471-2105-9-S9-S15-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S15-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S15-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S15-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S15-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S15-6\"/>",
"<gr... | [
"<media xlink:href=\"1471-2105-9-S9-S15-S1.jpg\" mimetype=\"image\" mime-subtype=\"jpeg\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2105-9-S9-S15-S2.jpg\" mimetype=\"image\" mime-subtype=\"jpeg\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\... | [{"surname": ["Stein"], "given-names": ["SE"], "article-title": ["An integrated method for spectrum extraction and compound identification from gas chromatography/mass spectrometry data"], "source": ["Journal of the American Society for Mass Spectrometry"], "year": ["1999"], "volume": ["10"], "fpage": ["770"], "lpage":... | {
"acronym": [],
"definition": []
} | 26 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S15 | oa_package/9a/85/PMC2537566.tar.gz |
PMC2537567 | 18793461 | [
"<title>Background</title>",
"<p>Often accompanying the macromolecules deposited in the Protein Data Bank (PDB) [##REF##10592235##1##] are smaller molecules of biological importance. Some of these are energy-carrying cofactors, such as ATP, coenzyme A, and nicotinamide-adenine dinucleotide (NAD). Some analogs of ... | [
"<title>Methods</title>",
"<title>Selection of small molecules for analysis</title>",
"<p>PDB files were selected from the January 7, 2008 \"snapshot\" of the Protein Data Bank. The search feature of the Protein Data Bank website <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.pdb.org/pdb/search/advSear... | [
"<title>Results</title>",
"<title>Inconsistencies in PDB files</title>",
"<p>There were 4167 PDB files containing a total of 295 distinct ligands having prochiral centers that met our strict criteria. Over half of these ligands (175) had two prochiral phosphate centers that were adjacent to carbon, and one had ... | [
"<title>Discussion</title>",
"<p>The inconsistent naming of atoms discussed in our paper is due largely to a lack of standardized names, <italic>not </italic>due to errors on the part of crystallographers or NMR researchers. There can be no errors where there are no rules.</p>",
"<p>A study of NAD(P) molecules ... | [
"<title>Conclusion</title>",
"<p>Current naming conventions do not completely map unique names to unique diastereotopic atoms, resulting in possible confusion or error, or at least the need for researchers to impose their own naming standardization. We herein describe many cases of naming inconsistencies for smal... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>CAB participated in the design of the study, developed the in-house software, carried out the atom name analysis, and drafted the manuscript. DX participated ... | [
"<title>Acknowledgements</title>",
"<p>CAB was supported by NIH Grant Number 2-T15-LM07089-16 from the National Library of Medicine. DX was supported by an NIH Grant (1R21GM078601-01).</p>",
"<p>This article has been published as part of <italic>BMC Bioinformatics </italic>Volume 9 Supplement 9, 2008: Proceedin... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>S and R configurations for chiral centers</bold>. (a) S configuration and (b) R configuration, for atoms A, B, C, and D when they have the highest, second, third, and lowest priorities, respectively. Notice that when the three highest prior... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Naming convention statistics for selected ligands</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>ligand code</bold></td><td align=\"left\"><bold>ligand name</bold></td><td align=\"left\"><bold>cent... | [
"<disp-formula id=\"bmcM1\"><label>(1)</label><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S16-i1\" overflow=\"scroll\">\n <mml:semantics>\n <mml:mrow>\n <mml:mrow>\n <mml:... | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p><bold>Supplemental Table 1</bold>. Contains Table ##TAB##0##1## from this document with about four additional pages of examples of naming convention statistics for selected ligands.</p></caption></supplementar... | [
"<table-wrap-foot><p># = number of PDB files in which the given naming convention was observed.</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1471-2105-9-S9-S16-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S16-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S16-3\"/>"
] | [
"<media xlink:href=\"1471-2105-9-S9-S16-S1.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2105-9-S9-S16-S2.xls\" mimetype=\"application\" mime-subtype=\"vnd.ms-excel\"><caption><p>Click here for file</p></caption></media>",
... | [{"article-title": ["Newsletter 1984"], "source": ["European Journal of Biochemistry"], "year": ["1984"], "volume": ["138"], "fpage": ["5"], "lpage": ["7"], "pub-id": ["10.1111/j.1432-1033.1984.tb07876.x"]}, {"surname": ["Cahn", "Ingold", "Prelog"], "given-names": ["RS", "C", "V"], "article-title": ["Specification of m... | {
"acronym": [],
"definition": []
} | 25 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S16 | oa_package/29/0f/PMC2537567.tar.gz |
PMC2537568 | 18793462 | [
"<title>Background</title>",
"<p>Genome-wide association studies (GWAS) aim to identify genetic variants of single nucleotide polymorphisms (SNPs) across the entire human genome that are associated with phenotypic traits, such as disease status and drug response. The International HapMap project determined genoty... | [
"<title>Methods</title>",
"<title>Raw data</title>",
"<p>The raw data (CEL files) from the Affymetrix GeneChip Human Mapping 500 K array set of the 270 HapMap samples were downloaded from the International HapMap project website <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.hapmap.org/downloads/raw_da... | [
"<title>Results</title>",
"<title>Batch size effect</title>",
"<p>Batch size effect was assessed by comparing the genotypes called from BS1, BS2, and BS3 (see <italic>Methods</italic>) for call rate and concordance. The overall call rates, defined as the proportion of successful calls to the total number of cal... | [
"<title>Discussion</title>",
"<p>GWAS is increasingly used to identify loci containing genetic variants associated with common diseases and drug responses. The number of SNPs interrogated in a GWAS has grown from thousands to millions; for example, the newest Affymetrix SNPs array 6.0 contains ~2 million probe se... | [
"<title>Conclusion</title>",
"<p>As demonstrated above, both batch size and batch composition affect genotype calling results of GWAS using the BRLMM algorithm. The larger the difference of batch sizes, the larger the effect. When the samples in the calling batches are more homogenous, more concordant genotypes a... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>HH coordinated the project, designed the experiments, conducted the genotype calling and association analysis, compared the calling results using R package, a... | [
"<title>Acknowledgements</title>",
"<p>We thank Drs. Federico Goodsaid, Sue Jane Wang, and Li Zhang of CDER/FDA, Ansar Jawaid of AstraZeneca, David Craig of The Translational Genomics Research Institute, Uwe Scherf, Lakshmi Vishnuvajjala, Arkendra De, and Lakshman Ramamurthy of CDRH/FDA, Nick Xiao of Core Genotyp... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>MA-like plots for comparing call rates of samples between two experiments with different batch sizes</bold>. The empty circles depict the 270 samples. The x-axes represent average call rates of individual samples in two experiments with dif... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Concordance of calls between batch sizes</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\" colspan=\"2\">Comparison</td><td align=\"center\">BS1 <italic>vs </italic>BS2</td><td align=\"center\">BS1 <itali... | [
"<inline-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S17-i1\" overflow=\"scroll\"><mml:semantics><mml:mover accent=\"true\"><mml:mi>D</mml:mi><mml:mo>¯</mml:mo></mml:mover></mml:semantics></mml:math></inline-formula>",
"<inline-formula><mml:math xmlns:mml=\"h... | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Successful calls for both: SNP genotypes successfully called in both of the compared experiments; Concordant calls (All): same genotype called in both of the compared experiments; Concordant calls (Hom): homozygous genotype called in both of the compared experiments; Concordant calls (Het): het... | [
"<graphic xlink:href=\"1471-2105-9-S9-S17-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S17-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S17-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S17-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S17-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S17-6\"/>",
"<gr... | [] | [{"article-title": ["See the white paper on BRLMM of Affymetrix"]}, {"surname": ["Benjamini", "Hochberg"], "given-names": ["Y", "Y"], "article-title": ["Controlling the false discovery rate: a practical and powerful approach to multiple testing"], "source": ["J R Statist Soc B"], "year": ["1995"], "volume": ["57"], "fp... | {
"acronym": [],
"definition": []
} | 41 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S17 | oa_package/7b/d7/PMC2537568.tar.gz |
PMC2537569 | 18793463 | [
"<title>Introduction</title>",
"<p>A timely response and preparedness in response to the changing environmental cues are essential for life in plants and animals alike. Since plants are dependent on light for photosynthesis, a natural assumption is that circadian (i.e., approximately daily) oscillation should be ... | [
"<title>Materials and methods</title>",
"<title>Circadian expression data</title>",
"<title>UC Davis data set</title>",
"<p>Col-0 ecotype seeds were stratified at 4°C for 4 days before transfer to a growth chamber (22°C). Seedlings were entrained in 12-h white light (light source was cool white fluorescence t... | [
"<title>Results and discussion</title>",
"<title>Overview of the analysis strategy</title>",
"<p>Independent circadian studies in plants or animals rarely use exactly the same analysis pipeline. However, comparing a representative set of studies [##REF##14712921##10##, ####REF##16166217##11##, ##REF##14734811##... | [
"<title>Results and discussion</title>",
"<title>Overview of the analysis strategy</title>",
"<p>Independent circadian studies in plants or animals rarely use exactly the same analysis pipeline. However, comparing a representative set of studies [##REF##14712921##10##, ####REF##16166217##11##, ##REF##14734811##... | [] | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The author declares that they have no competing interests.</p>"
] | [
"<title>Acknowledgements</title>",
"<p>This article has been published as part of <italic>BMC Bioinformatics </italic>Volume 9 Supplement 9, 2008: Proceedings of the Fifth Annual MCBIOS Conference. Systems Biology: Bridging the Omics. The full contents of the supplement are available online at <ext-link ext-link-... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Overview of the circadian pattern of gene expression in <italic>Arabidopsis thaliana</italic>. All expression profiles are grouped into four separate phase classes by correlation to a cosine curve with the same sampling rate (12 points over 2 com... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Difference between phase groups in Davis and Warwick data sets.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td/><td align=\"center\" colspan=\"4\"><bold>Warwick data set</bold></td></tr><tr><td/><td/><td colspan=\... | [
"<disp-formula><italic>Y </italic>= <italic>x</italic><sub>0</sub>, <italic>x</italic><sub>1</sub>, <italic>x</italic><sub>2</sub>, <italic>x</italic><sub><italic>N</italic>-1</sub></disp-formula>",
"<disp-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S18-i1\" ... | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Diagonal cells show the number and percentage (rounded up) of transcripts found in the same phase in both data sets. Cells off the diagonal show the number and percentage of transcripts oscillating in different phases.</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1471-2105-9-S9-S18-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S18-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S18-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S18-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S18-5\"/>"
] | [] | [{"surname": ["Savitzky", "Golay"], "given-names": ["A", "M"], "article-title": ["Smoothing and differentiation of data by simplified least squares procedures"], "source": ["Analytical Chemistry"], "year": ["1964"], "volume": ["36"], "fpage": ["1627"], "lpage": ["1639"]}, {"surname": ["Priestley"], "given-names": ["MB"... | {
"acronym": [],
"definition": []
} | 26 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S18 | oa_package/55/de/PMC2537569.tar.gz |
PMC2537570 | 18793464 | [
"<title>Background</title>",
"<p>Biological systems can be modeled as complex network systems with many interactions between the components. These interactions give essential information about the function and behavior of the analyzed system. For example, the protein-protein interaction network is the physical ba... | [
"<title>Methods</title>",
"<title>The notion of structure-connected clusters</title>",
"<p>Our goal is to achieve an optimal clustering of the PPI network, as well as to identify hubs and outliers. Therefore, both connectivity and local structure are used in our definition of optimal clustering. In this section... | [
"<title>Results and discussion</title>",
"<title>Protein-Protein Interaction Network</title>",
"<p>Hand-curated databases of PPI in <italic>Saccharomyces cerevisiae </italic>have been studied earlier in the literature [##REF##15048975##16##, ####REF##15374873##17##, ##REF##12089522##18####12089522##18##] and ar... | [
"<title>Results and discussion</title>",
"<title>Protein-Protein Interaction Network</title>",
"<p>Hand-curated databases of PPI in <italic>Saccharomyces cerevisiae </italic>have been studied earlier in the literature [##REF##15048975##16##, ####REF##15374873##17##, ##REF##12089522##18####12089522##18##] and ar... | [
"<title>Conclusion and research directions</title>",
"<p>We devised a new methodology called SCAN (Structural Clustering Algorithm for Networks) that can efficiently find clusters or functional modules in complex biological networks as well as hubs and outliers [##UREF##5##15##]. We showed the effectiveness of ou... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>XX and FT have conceived the study. XX is the inventor of the algorithm SCAN used for this study. NY and MM developed the software and performed data analysis... | [
"<title>Acknowledgements</title>",
"<p>This publication was made possible by NIH Grant # P20 RR-16460 from the IDeA Networks of Biomedical Research Excellence (INBRE) Program of the National Center for Research Resources.</p>",
"<p>This article has been published as part of <italic>BMC Bioinformatics </italic>V... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Comparison of clustering scores for three GO categories.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Cluster of anaphase promoting complex proteins.</p></caption></fig>",
"<fig position=\"float\... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Top-10 SCAN clusters with highest p-values</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\"><bold>Cluster ID</bold></td><td align=\"center\"><bold>P -value</bold></td><td align=\"center\"><bold>GO T... | [
"<disp-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S19-i1\" overflow=\"scroll\">\n <mml:semantics>\n <mml:mrow>\n <mml:mi>p</mml:mi>\n <mml:mo>−</mml:mo>\n ... | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional File 1</title><p>Cluster annotations for SCAN and CNM.</p></caption></supplementary-material>",
"<supplementary-material content-type=\"local-data\" id=\"S2\"><caption><title>Additional File 2</title><p>Clustering result of ... | [] | [
"<graphic xlink:href=\"1471-2105-9-S9-S19-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S19-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S19-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S19-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S19-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S19-6\"/>",
"<gr... | [
"<media xlink:href=\"1471-2105-9-S9-S19-S1.pdf\" mimetype=\"application\" mime-subtype=\"pdf\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2105-9-S9-S19-S2.pdf\" mimetype=\"application\" mime-subtype=\"pdf\"><caption><p>Click here for file</p></caption></media>",
"<media xl... | [{"surname": ["Wagner", "Fell"], "given-names": ["A", "DA"], "article-title": ["The small world inside large metabolic networks"], "source": ["Proc R Soc Lond B"], "year": ["2001"], "volume": ["268"], "fpage": ["1803"], "lpage": ["1810"]}, {"surname": ["Newman", "Girvan"], "given-names": ["MEJ", "M"], "article-title": ... | {
"acronym": [],
"definition": []
} | 26 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S19 | oa_package/cd/84/PMC2537570.tar.gz |
PMC2537571 | 18793466 | [
"<title>Introduction</title>",
"<p>The advent of DNA microarray technology has revolutionized genomic research and medicine because of its ability to simultaneously determine the expression levels of thousands of genes. However, the interpretation of large amounts of microarray gene expression data, and the abili... | [
"<title>Methods</title>",
"<title>Measurement of a treatment effect for each gene</title>",
"<p>Under a fixed-effects linear model, gene expression data for an arbitrary gene can be written as <bold>y </bold>= <bold>Xβ </bold>+ <bold>ε</bold>, where <bold>y </bold>and <bold>ε </bold>are <italic>n </italic>× 1 r... | [
"<title>Results</title>",
"<title>Simulation</title>",
"<p>The derivation of the method presented in the previous section is based on the known correlation matrix of the vector of dependent variable Y. When the correlation matrix is not known, we use an estimate of the correlation matrix. In reality, the correl... | [
"<title>Discussion</title>",
"<p>In many studies that use microarray data, the number of samples is small as in the first example shown above. While the number of samples in the simulations is only 3 for each group, the distribution of corrected <italic>p</italic>-values approximates a uniform distribution. The e... | [
"<title>Conclusion</title>",
"<p>We have presented a method to test the significance of expression changes within a group of genes, while considering the correlation structure among genes in each group. This method will enable the rapid detection of microarray evidence indicating altered cell functions or pathway... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>TL conducted the simulations, analyzed the data and wrote the manuscript. VGD conducted the microarray experiments using Mitochip and made the biological inte... | [
"<title>Acknowledgements</title>",
"<p>TL was supported by an Oak Ridge Institute of Science and Education (ORISE) fellowship at NCTR.</p>",
"<p>This article has been published as part of <italic>BMC Bioinformatics </italic>Volume 9 Supplement 9, 2008: Proceedings of the Fifth Annual MCBIOS Conference. Systems ... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Cumulative distribution of p-values for one-sided test case with sample size n = 9</bold>. The naïve <italic>p</italic>-values (dashed red line) deviate from the diagonal line. Almost 30% of <italic>p</italic>-values are estimated to be les... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Experimental design for the AZT and 3TC effects on mouse-liver gene expression.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\"><bold>Genotype</bold></td><td align=\"center\" colspan=\"3\"><bold>(+/-)</... | [
"<disp-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S20-i1\" overflow=\"scroll\">\n <mml:semantics>\n <mml:mtable columnalign=\"left\">\n <mml:mtr>\n <mml:mtd>\n ... | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Fifteen samples are collected and assayed for gene expression using the experimental design</p></table-wrap-foot>",
"<table-wrap-foot><p><italic>P</italic>-values calculated from four methods are presented for a comparison. The number of genes, up-regulated genes, and significantly expressed ... | [
"<graphic xlink:href=\"1471-2105-9-S9-S20-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S20-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S20-3\"/>"
] | [] | [{"surname": ["Benjamini", "Hochberg"], "given-names": ["Y", "Y"], "article-title": ["Controlling the false discovery rate: a practical and power-ful approach to multiple testing"], "source": ["Journal of the Royal Statistical Society Series B"], "year": ["1995"], "volume": ["57"], "fpage": ["289"], "lpage": ["300"]}, ... | {
"acronym": [],
"definition": []
} | 17 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S20 | oa_package/a2/be/PMC2537571.tar.gz |
PMC2537572 | 18793454 | [
"<title>Introduction</title>",
"<p>MCBIOS 2008 was held February 23–24, 2008 in Oklahoma City, Oklahoma at the Cox Convention Center in Bricktown. It was the best attended in the series of MCBIOS conferences (140 registrants) with the most participation (68 posters submitted). Informative and engaging keynote tal... | [] | [] | [] | [] | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Proceedings summary</title>",
"<p>This year, 19 out of 27 submitted papers were accepted for inclusion in the official conference proceedings (70%), similar to the number published from MCBIOS 2007 [##UREF##0##1##, ####REF##18047732##2##, ##REF##18047731##3##, ##REF##18047730##4##, ##REF##18047729##5##, #... | [
"<title>Acknowledgements</title>",
"<p>We thank the Conference Committee, Program Committee, student volunteers and sponsors for their help in organizing MCBIOS 2008. We would like to especially thank Jim Mason and Frank Waxman for their sponsorship of MCBIOS 2008 as well as OKBIOS 2004 and OKBIOS 2005. We also t... | [] | [] | [] | [] | [] | [] | [] | [] | [] | [] | [] | [{"article-title": ["Computational frontiers in biomedicine. Proceedings of the Fourth Annual Conference of the MidSouth Computational Biology and Bioinformatics Society. February 1\u20133, 2007. New Orleans, Louisiana, USA"], "source": ["BMC Bioinformatics"], "year": ["2007"], "volume": ["8"], "fpage": ["S1"], "lpage"... | {
"acronym": [],
"definition": []
} | 82 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S1 | oa_package/a8/28/PMC2537572.tar.gz |
PMC2537573 | 18793465 | [
"<title>Background</title>",
"<p>A significant proportion of genes that make up a genome are part of larger families of related genes resulting from duplications of individual genes [##REF##15568988##1##], genomic segments [##UREF##0##2##], or even whole genomes ([##UREF##1##3##,##UREF##2##4##]. The accumulation ... | [
"<title>Methods</title>",
"<title>Gene family identification by NSP method</title>",
"<p>The five gene families chosen to validate the NSP strategy were, eukaryotic release factor 1 (<italic>RF1</italic>), ribosomal protein L6 (<italic>L6</italic>), cinnamyl alcohol dehydrogenase (<italic>CAD</italic>), phenyla... | [
"<title>Results</title>",
"<title>Phenylalanine ammonia-lyase gene family</title>",
"<p>The tblastn search of using <italic>AtPAL1 </italic>protein as query resulted in ESTs and contigs reported previously [##REF##17118140##28##]. Here we report the refinement of using dS/dN ratio rather than a tally of 1<sup>s... | [
"<title>Discussion</title>",
"<p>It has been observed for some time that contig assembly from EST sequences can produce artifactual sequences resulting from relatively high error in EST sequences, chimeras generated in cDNA cloning, and regions of highly conserved domains interspersed in related genes. Therefore,... | [
"<title>Conclusion</title>",
"<p>Although the NSP strategy is not a global gene family identification protocol, our tests on the Arabidopsis EST dataset indicate that it performs well in distinguishing contigs that represent real genes from contigs that are artifacts. Every EST tested, from contigs that NSP predi... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>RLF participated in the conception and design of the study, carried out the gene family identification via NSP including BLAST, contig assembly, ORF identific... | [
"<title>Acknowledgements</title>",
"<p>This article has been published as part of <italic>BMC Bioinformatics </italic>Volume 9 Supplement 9, 2008: Proceedings of the Fifth Annual MCBIOS Conference. Systems Biology: Bridging the Omics. The full contents of the supplement are available online at <ext-link ext-link-... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Graph representing potential paralogs with dS/dN >= 2</bold>. Edges are labeled with the dS/dN ratios, followed by the number of substitutions (Sd+Sn) seen An edge indicates dS/dN>=2.00; No edge indicates dS/dN<2.00 OR dS/dN=NA.</p... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>dS/dN calculations for phenylalanine ammonia-lyase (PAL) contigs</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\" colspan=\"2\"><bold>Comparison</bold></td><td align=\"right\"><bold>Sd<sup>a</sup></bold>... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>SNAP output results for all 21 pairwise comparisons of 7 contigs in which an ORF was identified. A ds/dn value greater than 2.00 was chosen as threshold to indicate contigs that potentially represent distinct gene family members.</p><p>a – See <ext-link ext-link-type=\"uri\" xlink:href=\"http:/... | [
"<graphic xlink:href=\"1471-2105-9-S9-S2-1\"/>"
] | [] | [{"surname": ["Peer", "Meyer"], "given-names": ["Y Van de", "A"], "article-title": ["Large-Scale Gene and Ancient Genome Duplications"], "source": ["The Evolution of the Genome"], "year": ["2005"], "publisher-name": ["Elsevier Academic Press"], "fpage": ["329"], "lpage": ["368"]}, {"surname": ["Gregory", "Mable"], "giv... | {
"acronym": [],
"definition": []
} | 34 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S2 | oa_package/21/81/PMC2537573.tar.gz |
PMC2537574 | 18793467 | [
"<title>Background</title>",
"<p>The Human Genome Project [##REF##11237011##1##] was driven by the hope that characterization of the human genome would elucidate the molecular etiology of human disease. This resulted into an abundant amount of data regarding the genetic variation across the human genome as amende... | [
"<title>Methods</title>",
"<title>Overview and basic data sets</title>",
"<p>Our predictive method is based on a Support Vector Machine (SVM) algorithm that one can easily implement using the popular 'R' statistical software tool <ext-link ext-link-type=\"uri\" xlink:href=\"http://www.R-project.org\"/> and more... | [
"<title>Results and discussion</title>",
"<title>Inter-species conservation as a measure of disease susceptibility</title>",
"<p>Using the process detailed in Figure ##FIG##0##1##, we have exhaustively confirmed that known disease mutations in HGMD are disproportionately distributed in the most conserved nucleo... | [
"<title>Results and discussion</title>",
"<title>Inter-species conservation as a measure of disease susceptibility</title>",
"<p>Using the process detailed in Figure ##FIG##0##1##, we have exhaustively confirmed that known disease mutations in HGMD are disproportionately distributed in the most conserved nucleo... | [
"<title>Conclusion</title>",
"<p>We have developed a comparative genomic analysis method for genome-wide identification of genome positions with a greater likelihood of being important to gene function. Mutations occurring at these sites have a higher probability of representing disease alleles. New single base m... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>Vinayak Kulkarni developed the pipeline for SNP analysis, including prepping all the data from different datasets, annotating the SNPs with additional informa... | [
"<title>Acknowledgements</title>",
"<p>We would like to thank Dr. John W Fondon III and Dr Guanghua Xiao, Dr Cristi Galindo, M. Mark Burkart and Dr Wayne Fisher, for discussion about this manuscript and Linda Gunn for administrative assistance. This work was supported by the P.O'B. Montgomery Distinguished Chair,... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Ortholog identification with reciprocal MegaBLAST, and alignment calculation.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Distribution of mutations by dataset and conservation score. The bin... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>SVM performance during testing (labeled with the keyword 'Max') and comparison with SIFT predictions.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\" colspan=\"2\">HGMD</td><td align=\"center\" col... | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Supplementary Table: Genes with the highest and lowest HGMD like scores involved in a disease, as per published literature. The score is the disease association probability (the maximum being 100).</p></captio... | [
"<table-wrap-foot><p>Abbreviations: TP = True Positives; FP False Positives; TN = True Negatives; FN = False Negatives.</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1471-2105-9-S9-S3-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S3-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S3-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S3-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S3-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S3-6\"/>",
"<graphic ... | [
"<media xlink:href=\"1471-2105-9-S9-S3-S1.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>"
] | [{"surname": ["Hastie", "Tibshirani", "Friedman"], "given-names": ["T", "R", "J"], "source": ["The elements of statistical learning"], "year": ["2001"], "publisher-name": ["Springer \u2013 Verlag"]}, {"surname": ["Dayhoff", "Schwartz", "Orcutt"], "given-names": ["MO", "RM", "BC"], "article-title": ["A model for evoluti... | {
"acronym": [],
"definition": []
} | 35 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S3 | oa_package/82/e4/PMC2537574.tar.gz |
PMC2537575 | 18793468 | [
"<title>Background</title>",
"<p>Microarrays are widely used to overview gene expression landscapes under different experimental conditions. Since their initial appearance microarrays developed into very dependable tools with good inter- and intra-platform reproducibility [##REF##17428341##1##,##REF##16964229##2#... | [
"<title>Methods</title>",
"<p>The RT4 bladder transitional cell papilloma cell line (American Type Culture Collection, Manassas Virginia) was cultured on plastic and on cancer-remodeled ECM, Matrigel™ (crECM), and RNA was isolated as described previously using the RNAeasy kit (QIAGEN Inc., Valencia, CA) [##REF##1... | [
"<title>Results</title>",
"<p>The workflow chart of our approach is shown in Figure ##FIG##0##1##. The normalization process is presented because it is different from most approaches using normalization to the mean, median, or housekeeping genes. The frequency histogram of the un-normalized expression values yiel... | [] | [
"<title>Conclusion</title>",
"<p>In this study we present a self-guided approach for analyzing a complex biological change by microarrays and illustrate its use to describe the complex change in gene expression that occur when papilloma cells are placed on a crECM. The flowchart of each step of this approach is s... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>List of abbreviations used</title>",
"<p>cDNA – complementary deoxyribonucleic acid; crECM – cancer-remodeled extracellular matrix; DAVID – Database for Annotation, Visualization and Integrated Discovery; DNA – deoxyribonucleic acid; ECM – extracellular matrix; FDR – false discovery rate; HV – hypervariab... | [
"<title>Acknowledgements</title>",
"<p>The authors gratefully acknowledge the technical assistance of Jean Coffman. This work was supported in part by a grant from the NIH to REH, R01 DK069808</p>",
"<p>This article has been published as part of <italic>BMC Bioinformatics </italic>Volume 9 Supplement 9, 2008: P... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Schematic diagram of steps in microarray analysis.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Identification of noise level and microarray adjustment</bold>. A) Frequency histogram of gene ... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Major functional groups overrepresented among state-change genes and corresponding overrepresented TREs. The groups are presented according to the order of significance identified by DAVID. Overrepresented TREs marked in bold are either \"o... | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Supplemental Table S1. Activity of 345 transcription factors in cells grown on Matrigel and on Plastic. Values were obtained as described in Methods and are arbitrary units, but are normalized to protein conte... | [] | [
"<graphic xlink:href=\"1471-2105-9-S9-S4-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S4-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S4-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S4-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S4-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S4-6\"/>"
] | [
"<media xlink:href=\"1471-2105-9-S9-S4-S1.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>"
] | [] | {
"acronym": [],
"definition": []
} | 20 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S4 | oa_package/cc/41/PMC2537575.tar.gz |
PMC2537576 | 18793469 | [
"<title>Background</title>",
"<p>The concept of networks is ubiquitous in systems biology. In the past decade, high-throughput experimental techniques such as yeast 2-hybrid systems and mass spectrometry-based proteomics led to an influx of biomolecular interaction data in curated databases such as HPRD [##REF##1... | [] | [
"<title>Results and discussion</title>",
"<title>New features</title>",
"<p>Figure ##FIG##1##2## illustrates the core functionalities of ProteoLens. We compared ProteoLens with several existing popular visualization software tools, including Cytoscape, VisANT and BiologicalNetworks, and summarized the compariso... | [
"<title>Results and discussion</title>",
"<title>New features</title>",
"<p>Figure ##FIG##1##2## illustrates the core functionalities of ProteoLens. We compared ProteoLens with several existing popular visualization software tools, including Cytoscape, VisANT and BiologicalNetworks, and summarized the compariso... | [
"<title>Conclusion</title>",
"<p>We developed ProteoLens as a multi-scale network visual analytic software tool for advanced network biology studies. It is built on robust software architecture that supports flexible network data association specification using rules, integrates data processing through relational... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Implementation</title>",
"<p>ProteoLens is a standalone software tool written in Java programming language. Its software architecture consists of two separate functional layers – a data processing layer at the backend and a data visualization layer at the frontend–connected by a network data association e... | [
"<title>Acknowledgements</title>",
"<p>We thank Indiana University – Purdue University Indianapolis (IUPUI) RSFG fund, IUPUI Signature Center Fund, and China scholarship council for providing partial funding support for this work. We thank Josh Hayen, Yan Zhong, Dr. Mark Goebl, and Dr. Zengliang Bai for providing... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>An overview of the ProteoLens core architecture</bold>. The design of ProteoLens decoupled the data processing and visualization presenting in two layers and the two layers communicated by the abstract Data Associations. The major component... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Compare ProteoLens against Cytoscape, VisANT and BiologicalNetworks.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"left\"><bold>ProteoLens</bold></td><td align=\"left\"><bold>Cytoscape</bold></td><td alig... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>*A summary of attributes of Cytoscape, VisANT and BiologicalNetworks as presented in detail by Matthew Suderman <italic>et al </italic>in review. [##REF##17720984##26##]</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1471-2105-9-S9-S5-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S5-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S5-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S5-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S5-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S5-6\"/>",
"<graphic ... | [] | [{"article-title": ["HAPP"]}, {"surname": ["Chen", "Sivachenko"], "given-names": ["JY", "A"], "article-title": ["Data Mining in Protein Interactomics: Six Computational Research Challenges and Opportunities"], "source": ["IEEE Magazine in Biology and Medicine"], "year": ["2005"], "volume": ["24"], "fpage": ["95"], "lpa... | {
"acronym": [],
"definition": []
} | 31 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S5 | oa_package/87/93/PMC2537576.tar.gz |
PMC2537577 | 18793470 | [
"<title>Background</title>",
"<p>The regulation of gene expression in the cell is controlled by regulatory proteins and functional RNAs that interact specifically with binding locations on the DNA. In the past century, molecular biologists have developed many innovative techniques to identify sites on the DNA tha... | [] | [
"<title>Results</title>",
"<p>In this section we will provide illustrative examples of how our benchmarking technology can be used to evaluate several important parameters in cis-regulatory motif discovery. To construct a series of tests for evaluation, we extracted 2247 known transcription factor binding positio... | [
"<title>Discussion</title>",
"<p>The most practical outcome of this work is an ability to rank motif prediction tools based on a known TFBS dataset. Tools with favourable performance characteristics can then be used to discover additional binding sites in closely related genomes or used in conjunction with experi... | [
"<title>Conclusion</title>",
"<p>In this paper we have presented a general method, MTAP, for evaluating cis-regulatory motif discovery tools. MTAP is novel and completely different from other approaches in that it allows both algorithm practitioners and users the flexibility to dynamically change attributes of da... | [
"<p>This is an open access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Problem description</title>",
"<p>A cis-regulatory motif discovery pipeline, <italic>M</italic><sub><italic>i</italic></sub>, contains a series of steps to separate transcription factor binding sites from 'background noise'. Motif discovery pipelines require collecting the positive example sequences, coll... | [
"<title>Acknowledgements</title>",
"<p>We would like to thank each of the authors of motif prediction tools for making their tools available and for helping us in running and automating tool pipelines including their method. We would like to thank Laura A. Quest for help with the manuscript.</p>",
"<p>This rese... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>The Motif Tool Assessment Platform (MTAP) enables a researcher to automate each of the steps in cis-regulatory motif discovery, evaluate tools, and propose changes. MTAP is built as a platform where the data collection methods, motif discovery pi... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Nucleotide Level Statistics. <italic>u</italic><sub><italic>i</italic>, <italic>j </italic></sub>represents the upstream regulatory sequence <italic>j </italic>at position <italic>i</italic>, <italic>RED </italic>is the set of annotated dat... | [
"<inline-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1471-2105-9-S9-S6-i1\" overflow=\"scroll\"><mml:semantics><mml:mrow><mml:msubsup><mml:mi>B</mml:mi><mml:mrow><mml:mi>k</mml:mi><mml:mo>,</mml:mo><mml:mi>u</mml:mi><mml:mo>,</mml:mo><mml:mi>v</mml:mi></mml:mrow><mml:mi>u</mm... | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1471-2105-9-S9-S6-1\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S6-2\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S6-3\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S6-4\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S6-5\"/>",
"<graphic xlink:href=\"1471-2105-9-S9-S6-6\"/>",
"<graphic ... | [] | [{"surname": ["Pavesi", "Mereghetti", "Mauri", "Pesole"], "given-names": ["G", "P", "G", "G"], "article-title": ["Weeder Web: discovery of transcription factor binding sites in a set of sequences from co-regulated genes"], "source": ["Nucleic Acids Res"], "year": ["2004"]}, {"surname": ["Sinha", "Blanchette", "Tompa"],... | {
"acronym": [],
"definition": []
} | 35 | CC BY | no | 2022-01-12 14:53:45 | BMC Bioinformatics. 2008 Aug 12; 9(Suppl 9):S6 | oa_package/ed/8c/PMC2537577.tar.gz |
PMC2537813 | 18797514 | [
"<title>Introduction</title>",
"<p>RNA interference (RNAi) in <italic>Drosophila</italic> cell cultures is a powerful tool for the identification of proteins involved in mitotic cell division. The addition of a double stranded RNA (dsRNA) to the cell medium leads to rapid downregulation of the corresponding mitot... | [
"<title>Methods</title>",
"<title>Generation of Co-Expression Lists</title>",
"<p>Co-expression analysis was perfomed on a previously described gene expression dataset ##REF##12144710##[14]##. This comprised 267 GeneChip <italic>Drosophila</italic> Genome Arrays (Affymetrix, Santa Clara, CA, USA) that covered 8... | [
"<title>Results</title>",
"<title>Construction of a Mitotic-Gene-Enriched Co-Expression List</title>",
"<p>Numerous studies indicate that genes involved in the same biological process tend to be transcriptionally co-expressed (see, for example,##REF##9843981##[11]##–##REF##15588312##[13]##. We thus exploited ex... | [
"<title>Discussion</title>",
"<p>Our RNAi screen for mitotic genes differs from those previously performed in two important ways. First, we used a bioinformatic approach to focus our experiments on a group of genes that was enriched in mitotic functions. Second, we analyzed potential mitotic phenotypes not only b... | [] | [
"<p><bold>¤a:</bold> Current address: Institut Gustave Roussy, Villejuif, France</p>",
"<p><bold>¤b:</bold> Current address: MCDB Department, University of California Santa Cruz, Santa Cruz, California, United States of America</p>",
"<p>Conceived and designed the experiments: MPS MG. Performed the experiments:... | [
"<title>Supporting Information</title>"
] | [
"<p>We thank C. Sunkel, C. Lehner and G. Karpen for kindly providing some of the antibodies used in this study.</p>"
] | [
"<fig id=\"pgen-1000126-g001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pgen.1000126.g001</object-id><label>Figure 1</label><caption><title>The functions of 155 <italic>Drosophila</italic> genes detected by an RNAi screen of 1000 genes enriched in mitotic functions by co-expression analysis... | [] | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"pgen.1000126.s001\"><label>Figure S1</label><caption><p>Precocious sister chromatid separation and defective chromosome segregation after RNAi for <italic>Bub3</italic>. Ctr, control; c-meta, colchicine/hypotonic-treated metaphase chromosomes. Note in additi... | [
"<fn-group><fn fn-type=\"COI-statement\"><p>The authors have declared that no competing interests exist.</p></fn><fn fn-type=\"financial-disclosure\"><p>This work was supported in part by grants from AIRC (Italian Association for Cancer Research) and Italian Telethon to MG, and by a PRIN grant from MUR (Ministero d... | [
"<graphic xlink:href=\"pgen.1000126.g001\"/>",
"<graphic xlink:href=\"pgen.1000126.g002\"/>",
"<graphic xlink:href=\"pgen.1000126.g003\"/>",
"<graphic xlink:href=\"pgen.1000126.g004\"/>",
"<graphic xlink:href=\"pgen.1000126.g005\"/>",
"<graphic xlink:href=\"pgen.1000126.g006\"/>",
"<graphic xlink:href=\... | [
"<media xlink:href=\"pgen.1000126.s001.tif\"><caption><p>Click here for additional data file.</p></caption></media>",
"<media xlink:href=\"pgen.1000126.s002.tif\"><caption><p>Click here for additional data file.</p></caption></media>",
"<media xlink:href=\"pgen.1000126.s003.tif\"><caption><p>Click here for addi... | [] | {
"acronym": [],
"definition": []
} | 63 | CC BY | no | 2022-01-12 23:38:06 | PLoS Genet. 2008 Jul 18; 4(7):e1000126 | oa_package/1b/b0/PMC2537813.tar.gz |
PMC2537934 | 18797515 | [
"<title>Introduction</title>",
"<p>The innate immune system, based on antimicrobial peptides (AMP) and proteins, provides a first line of defence against invading microbes ##REF##11753073##[1]##–##REF##11807545##[3]##. At present, over 880 different AMPs have been identified in eukaryotes (<ext-link ext-link-type... | [
"<title>Materials and Methods</title>",
"<title>Materials</title>",
"<p>The peptides GHH20 (GHHPHGHHPHGHHPHGHHPH) and histatin 5 (DSHAKRHHGYKRKFHEKHHSHRGPY) were synthesized by Innovagen AB (Lund, Sweden), and were of >95% purity. The purity and molecular weight was confirmed by MALDI-TOF MS analysis (Voyage... | [
"<title>Results</title>",
"<title>Antifungal activity of HRG and binding to <italic>Candida</italic> cells</title>",
"<p>In order to assess possible antifungal effects of HRG, we tested the activity of the protein against various <italic>Candida</italic> isolates. HRG was shown to be antifungal against <italic>... | [
"<title>Discussion</title>",
"<p>The key findings in our study are the identification of an antifungal activity of HRG <italic>in vivo</italic> together with the characterization of possible epitopes of HRG mediating this effect, as well as mechanistic data on HRG targeting of <italic>Candida</italic> membranes. ... | [] | [
"<p>Conceived and designed the experiments: V. Rydengård, O. Shannon, M. Mörgelin, M. Malmsten, A. Schmidtchen. Performed the experiments: V. Rydengård, O. Shannon, K. Lundqvist, L. Kacprzyk, A. Chalupka, A. Olsson, M. Mörgelin, M. Malmsten. Analyzed the data: V. Rydengård. Contributed reagents/materials/analysis t... | [
"<title>Supporting Information</title>"
] | [
"<p>We wish to thank Ms. Lise-Britt Wahlberg and Ms. Maria Baumgarten for expert technical assistance.</p>"
] | [
"<fig id=\"ppat-1000116-g001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.ppat.1000116.g001</object-id><label>Figure 1</label><caption><title>Antifungal activity and binding of HRG to <italic>Candida</italic>.</title><p>(A) Antifungal activity of HRG. <italic>C. parapsilosis</italic> ATCC 900... | [] | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"ppat.1000116.s001\"><label>Table S1</label><caption><p>Synthetic 20-mer peptides spanning the whole sequence of HRG, used in the screening of antifungal activity in ##FIG##2##Figure 3B##, and relevant descriptive parameters (net charge, activity against <ita... | [
"<fn-group><fn fn-type=\"COI-statement\"><p>Drs. Schmidtchen and Malmsten have shares in DermaGen AB, a company involved in therapeutical development of antimicrobial peptides. Peptides of HRG are included in patent applications of the company.</p></fn><fn fn-type=\"financial-disclosure\"><p>This research was suppo... | [
"<graphic xlink:href=\"ppat.1000116.g001\"/>",
"<graphic xlink:href=\"ppat.1000116.g002\"/>",
"<graphic xlink:href=\"ppat.1000116.g003\"/>",
"<graphic xlink:href=\"ppat.1000116.g004\"/>",
"<graphic xlink:href=\"ppat.1000116.g005\"/>",
"<graphic xlink:href=\"ppat.1000116.g006\"/>"
] | [
"<media xlink:href=\"ppat.1000116.s001.doc\"><caption><p>Click here for additional data file.</p></caption></media>",
"<media xlink:href=\"ppat.1000116.s002.tif\"><caption><p>Click here for additional data file.</p></caption></media>",
"<media xlink:href=\"ppat.1000116.s003.psd\"><caption><p>Click here for addi... | [] | {
"acronym": [],
"definition": []
} | 59 | CC BY | no | 2022-01-13 03:40:04 | PLoS Pathog. 2008 Aug 1; 4(8):e1000116 | oa_package/e9/73/PMC2537934.tar.gz |
PMC2537989 | 18797516 | [
"<title>Introduction</title>",
"<p>The first Europeans from the Old World to land in what is now US territory were Columbus' men in 1493. The initial colonization of the region by the Spanish, English, Scots and Irish, French, Dutch, Swedes, Germans, Italians and Portuguese during the 16th and 17th centuries was ... | [
"<title>Methods</title>",
"<title>Datasets</title>",
"<p>We studied two independent European American datasets. The first dataset (CHORI dataset-Children's Hospital Oakland Research Institute), consists of 980 individuals, that were collected as part of two community-based clinical trials evaluating the anti-in... | [
"<title>Results</title>",
"<title>Population Substructure and Ancestry in European Americans</title>",
"<p>We first examined the number of significant principal components in the two European American datasets that we studied (CHORI and CORIELL). ##FIG##0##Figure 1## (panel A) shows the top few singular values ... | [
"<title>Discussion</title>",
"<p>We have identified small sets of structure informative markers for the European American population through the direct investigation of European American samples and without depending on any assumptions about the ancestry or admixture proportions of the studied individuals. We hav... | [] | [
"<p>Conceived and designed the experiments: PP PD EZ. Performed the experiments: PP PD JL. Analyzed the data: PP PD JL CN EZ. Contributed reagents/materials/analysis tools: PP PD DN JS PR DC RK EZ. Wrote the paper: PP PD EZ.</p>",
"<p>Genetic structure in the European American population reflects waves of migrati... | [
"<title>Supporting Information</title>"
] | [] | [
"<fig id=\"pgen-1000114-g001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pgen.1000114.g001</object-id><label>Figure 1</label><caption><title>Singular values and test of significance of principal components in the CHORI and CORIELL datasets.</title><p>(A) Histogram of the first eigenSNP of th... | [
"<table-wrap id=\"pgen-1000114-t001\" position=\"float\"><object-id pub-id-type=\"doi\">10.1371/journal.pgen.1000114.t001</object-id><label>Table 1</label><caption><title>Number of pairs of the top 3000 PCAIMs with <italic>r</italic>\n<sup>2</sup> values above 0.1 in the CORIELL dataset, the CHORI dataset, and the ... | [
"<disp-formula><label>(1)</label></disp-formula>",
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>"
] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"pgen.1000114.s001\"><label>Figure S1</label><caption><p>Plot of 970 CHORI, 541 CORIELL, and 270 HapMap subjects on their first, second, and third eigenSNPs. Five CHORI pairs (ten CHORI subjects) were suspiciously similar and were excluded prior to this plot.... | [
"<table-wrap-foot><fn id=\"nt101\"><p>There are numerous highly correlated pairs. However, after our redundancy removal step, in the retained 500 PCAIMs there was no pair (in any of the three datasets) with an <italic>r</italic>\n<sup>2</sup> value above 0.2 and only three pairs in the CORIELL dataset with an <ital... | [
"<graphic xlink:href=\"pgen.1000114.e001.jpg\" mimetype=\"image\" position=\"float\"/>",
"<inline-graphic xlink:href=\"pgen.1000114.e002.jpg\" mimetype=\"image\"/>",
"<inline-graphic xlink:href=\"pgen.1000114.e003.jpg\" mimetype=\"image\"/>",
"<inline-graphic xlink:href=\"pgen.1000114.e004.jpg\" mimetype=\"im... | [
"<media xlink:href=\"pgen.1000114.s001.pdf\"><caption><p>Click here for additional data file.</p></caption></media>",
"<media xlink:href=\"pgen.1000114.s002.pdf\"><caption><p>Click here for additional data file.</p></caption></media>",
"<media xlink:href=\"pgen.1000114.s003.pdf\"><caption><p>Click here for addi... | [{"label": ["1"], "element-citation": ["\n"], "surname": ["Carter", "Gartner", "Haines", "Olmstead", "Sutch"], "given-names": ["SB", "SC", "MR", "AL", "R"], "year": ["2006"], "source": ["The Historical Statistics of the United States"], "publisher-loc": ["Cambridge, UK"], "publisher-name": ["Cambridge University Press"... | {
"acronym": [],
"definition": []
} | 60 | CC BY | no | 2022-01-12 23:38:05 | PLoS Genet. 2008 Jul 4; 4(7):e1000114 | oa_package/a2/d8/PMC2537989.tar.gz |
PMC2538491 | 18806879 | [
"<title>Introduction</title>",
"<p>Adjuvant use of mitomycin C (MMC) is prevalent in the treatment of various ocular diseases including pterygium [##REF##16546105##1##], glaucoma [##REF##18091183##2##], and refractive surgery [##REF##18047001##3##] to improve the success of clinical therapy. MMC is applied by top... | [
"<title>Methods</title>",
"<title>Materials</title>",
"<p>Cell culture materials including trypsin, minimal essential medium (MEM), glutamine, gentamicin, and fetal bovine serum were obtained from Gibco (Grand Island, NY). MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) was purchased from Si... | [
"<title>Results</title>",
"<title>Effects of mitomycin C on cell viability and apoptotic caspase pathways</title>",
"<p>The MTT assay is used as a marker for cell viability. In the present study, MMC produced toxic effects on corneal endothelial cells. After incubation with MMC for 15 h and 24 h, cell viability... | [
"<title>Discussion</title>",
"<p>In the present study, the mechanism of MMC-induced apoptosis in corneal endothelial cells was investigated using cultured porcine cells. This work presents the findings that MMC treatment not only decreases cell viability but also induces apoptosis. The effects included turnover o... | [] | [
"<p>This is an open-access article distributed under the terms of the\n Creative Commons Attribution License, which permits unrestricted use,\n distribution, and reproduction in any medium, provided the original\n work is properly cited.</p>",
"<title>Purpose</title>",
"<p>Previous studies ... | [] | [
"<title>Acknowledgments</title>",
"<p>This work was supported by the research grant from the Kaohsiung Medical University Hospital (KMUH95–5D02) and the National Health Research Institute of Taiwan (NHRI-EX92, 93, 94, 95–9213SI).</p>"
] | [
"<fig id=\"f1\" fig-type=\"figure\" position=\"float\"><label>Figure 1</label><caption><p>Effects of mitomycin C on cell viability and apoptotic caspase pathways. <bold>A:</bold> Cell viability was measured under exposure to various concentrations of mitomycin C at 15 h and 24 h in cultured porcine corneal endothel... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"mv-v14-1705-f1\"/>",
"<graphic xlink:href=\"mv-v14-1705-f2\"/>",
"<graphic xlink:href=\"mv-v14-1705-f3\"/>",
"<graphic xlink:href=\"mv-v14-1705-f4\"/>",
"<graphic xlink:href=\"mv-v14-1705-f5\"/>",
"<graphic xlink:href=\"mv-v14-1705-f6\"/>"
] | [] | [] | {
"acronym": [],
"definition": []
} | 29 | CC BY | no | 2022-01-12 14:47:37 | Mol Vis. 2008 Sep 15; 14:1705-1712 | oa_package/0a/35/PMC2538491.tar.gz |
PMC2538492 | 18806880 | [
"<title>Introduction</title>",
"<p>Keratins are intermediate filament proteins that form a dense fibrous scaffold within the cytoplasm of epithelial cells. Based on the amino acid sequence, they are classified into type I or type II intermediate filaments, which are expressed in pairs and form obligate heterodime... | [
"<title>Methods</title>",
"<p>A three-generation Polish family with four affected individuals was studied. All subjects gave informed consent in accordance with the tenets of the Declaration of Helsinki. A complete ophthalmological check-up including slit-lamp examination and confocal microscopy in vivo by Rostoc... | [
"<title>Results</title>",
"<p>In the proband (III-1, 24 years old), the diagnosis of MCD was made on the basis of the typical clinical appearance of the corneal microcysts, which were detected in both eyes during routine eye examination (##FIG##0##Figure 1## and ##FIG##1##Figure 2##). They were also found in thre... | [
"<title>Discussion</title>",
"<p>The E498V mutation in <italic>KRT3</italic> found in the Polish family with MCD affects a strongly conserved residue within the 2B subdomain of the intermediate filament chain [##REF##12064940##9##]. Conservation of an amino acid residue indicates its significance for protein func... | [] | [
"<p>The first two authors contributed equally to this work.</p>",
"<p>This is an open-access article distributed under the terms of the\n Creative Commons Attribution License, which permits unrestricted use,\n distribution, and reproduction in any medium, provided the original\n work is prope... | [] | [
"<title>Acknowledgments</title>",
"<p>This work was supported by Medical University of Warsaw Grants No. 1M15/N/2008 and 2WF/W/09.</p>"
] | [
"<fig id=\"f1\" fig-type=\"figure\" position=\"float\"><label>Figure 1</label><caption><p>Slit-lamp photography of proband (III-1). This image demonstrates the microcystic appearance of the corneal epithelium.</p></caption></fig>",
"<fig id=\"f2\" fig-type=\"figure\" position=\"float\"><label>Figure 2</label><cap... | [
"<table-wrap id=\"t1\" position=\"float\"><label>Table 1</label><caption><title>Primers for polymerase chain reaction amplification and sequencing of <italic>KRT3</italic> and <italic>KRT12</italic>, their annealing temperature (Ta), and expected amplicon size.</title></caption><table frame=\"hsides\" rules=\"group... | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"mv-v14-1713-f1\"/>",
"<graphic xlink:href=\"mv-v14-1713-f2\"/>",
"<graphic xlink:href=\"mv-v14-1713-f3\"/>",
"<graphic xlink:href=\"mv-v14-1713-f4\"/>"
] | [] | [{"label": ["11"], "surname": ["Mueller-Malesinska", "Nowak", "Ploski", "Waligora", "Korniszewski"], "given-names": ["M", "M", "R", "J", "L"], "article-title": ["Epidemiology of 35delG mutation in GJB2 gene in a Polish population"], "source": ["J Audiolog Med"], "year": ["2001"], "volume": ["10"], "fpage": ["136"], "lp... | {
"acronym": [],
"definition": []
} | 21 | CC BY | no | 2022-01-12 14:47:37 | Mol Vis. 2008 Sep 15; 14:1713-1718 | oa_package/df/39/PMC2538492.tar.gz |
PMC2538493 | 18806881 | [
"<title>Introduction</title>",
"<p>Usher syndrome (USH) is an autosomal recessive disorders characterized by sensorineural hearing impairment (HI), retinitis pigmentosa (RP), and variable vestibular dysfunction [##REF##10704190##1##]. It is clinically and genetically heterogeneous, and it is categorized into thre... | [
"<title>Methods</title>",
"<title>Family and clinical data</title>",
"<p>In this study, we investigated a Tunisian family with USH2. This family originates from centre of Tunisia. Two affected (1 male and 1 female aged 28 and 18 years, respectively) and six healthy family members (2 males and 4 females aged 21-... | [
"<title>Results</title>",
"<title>Family and clinical data</title>",
"<p>The pedigree in ##FIG##0##Figure 1## displays a consanguineous Tunisian family segregating USH based on clinical history and audiometric and ophthalmologic tests. Audiometric test showed a moderate sloping bilateral sensorineural HI in USH... | [
"<title>Discussion</title>",
"<p>In this paper, we report a consanguineous family of Tunisian origin, composed of two affected children with USH. On the whole, the clinical signs observed in affected subjects from this family were indicative of USH2. USH2 is characterized by moderate to severe HI, and onset of RP... | [] | [
"<p>This is an open-access article distributed under the terms of the\n Creative Commons Attribution License, which permits unrestricted use,\n distribution, and reproduction in any medium, provided the original\n work is properly cited.</p>",
"<title>Purpose</title>",
"<p>Chronic diseases ... | [] | [
"<title>Acknowledgments</title>",
"<p>We are indebted to the family members for their invaluable cooperation and for providing the blood samples. We thank Dr. Sandrine Marlin and Dr. Hela Azaiez for helpful suggestions on the manuscript. We also thank Dr. Roser González for comments in preparing the manuscript an... | [
"<fig id=\"f1\" fig-type=\"figure\" position=\"float\"><label>Figure 1</label><caption><p>Pedigree, haplotype and statistical data for a Tunisian family segregating Usher type 2 syndrome. <bold>A-C:</bold> In pedigree, the square symbol indicates male, the circle symbol denotes female and black symbols represent af... | [
"<table-wrap id=\"t1\" position=\"float\"><label>Table 1</label><caption><title>Primer pairs used to sequence coding exons of <italic>CERKL</italic>.</title></caption><table frame=\"hsides\" rules=\"groups\"><col width=\"36\" span=\"1\"/><col width=\"216\" span=\"1\"/><col width=\"194\" span=\"1\"/><col width=\"48\... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Two-point LOD scores for the different markers studied were computed using Genehunter software. Close linkage to the known USH genes on chromosomes 1, 5, and 9 was excluded with negative 2-point LOD scores.</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"mv-v14-1719-f1\"/>",
"<graphic xlink:href=\"mv-v14-1719-f2\"/>",
"<graphic xlink:href=\"mv-v14-1719-f3\"/>",
"<graphic xlink:href=\"mv-v14-1719-f4\"/>"
] | [] | [] | {
"acronym": [],
"definition": []
} | 25 | CC BY | no | 2022-01-12 14:47:37 | Mol Vis. 2008 Sep 19; 14:1719-1726 | oa_package/e3/cd/PMC2538493.tar.gz |
PMC2538494 | 18806882 | [
"<title>Introduction</title>",
"<p>Diabetic retinopathy is a progressive neurologic disease that is characterized by neuronal degeneration and extensive vascular changes. However, our knowledge of the mechanisms leading to neuronal cell loss and vascular dysfunction in diabetic retinopathy is still incomplete. We... | [
"<title>Methods</title>",
"<p>The experiments were done in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The protocol for this study complies with the guidelines of the Brazilian College for Animal Experimentation (COBEA) and was approved by the institutional Committ... | [
"<title>Results</title>",
"<p>SHR rats are normotensive when they are 4 weeks old, but are fully hypertensive by the time they are 12 weeks old. We used both age groups because they allowed us to assess the contribution of the genetics of hypertension (4-week-old rats) and the influence of genetics plus hypertens... | [
"<title>Discussion</title>",
"<p>The results of this study show that the adult rat retina contains a small number of BrdU-positive cells that also express glial, neural, and endothelial progenitor cell markers. The number of these cells was higher in hypertensive rats but was markedly reduced by the concomitant p... | [] | [
"<p>This is an open-access article distributed under the terms of the\n Creative Commons Attribution License, which permits unrestricted use,\n distribution, and reproduction in any medium, provided the original\n work is properly cited.</p>",
"<title>Purpose</title>",
"<p>Hyperglycemia and... | [] | [
"<title>Acknowledgments</title>",
"<p>We thank Sérgio Magalhães, Elisa B. M. Peixoto, and Flávia F. Mesquita for technical assistance and Stephen Hyslop for editing the manuscript. This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP; grant nos. 04/00455–9 and 05/58189–5).</p>"
... | [
"<fig id=\"f1\" fig-type=\"figure\" position=\"float\"><label>Figure 1</label><caption><p>Immunohystochemistry for BrDU in retinal slides from studied rats. The BrDU positive cells, although rare, are localized in ganglion cell layer <bold>(A)</bold> and in inner nuclear layer <bold>(B).</bold> The scale bar repres... | [
"<table-wrap id=\"t1\" position=\"float\"><label>Table 1</label><caption><title>General characteristics of the studied rats</title></caption><table frame=\"hsides\" rules=\"groups\"><col width=\"65\" span=\"1\"/><col width=\"65\" span=\"1\"/><col width=\"66\" span=\"1\"/><col width=\"63\" span=\"1\"/><col width=\"6... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>The following abbreviations are in effect: CT-WKY: control WKY; DM-WKY: diabetic WKY; CT-SHR: control SHR; DM-SHR: diabetic SHR; SBP: systolic blood pressure; * p<0.005 versus respectively WKY groups, <sup>†</sup> p<0.003 versus control groups, <sup>‡</sup> p=0.0001 versus WKY groups, <su... | [
"<graphic xlink:href=\"mv-v14-1680-f1\"/>",
"<graphic xlink:href=\"mv-v14-1680-f2\"/>",
"<graphic xlink:href=\"mv-v14-1680-f3\"/>",
"<graphic xlink:href=\"mv-v14-1680-f4\"/>",
"<graphic xlink:href=\"mv-v14-1680-f5\"/>",
"<graphic xlink:href=\"mv-v14-1680-f6\"/>",
"<graphic xlink:href=\"mv-v14-1680-f7\"/... | [] | [] | {
"acronym": [],
"definition": []
} | 50 | CC BY | no | 2022-01-12 14:47:37 | Mol Vis. 2008 Sep 11; 14:1680-1691 | oa_package/43/0a/PMC2538494.tar.gz |
PMC2538495 | 18806883 | [
"<title>Introduction</title>",
"<p>Arteriosclerotic retinopathy involves vessel walls by medial layer hypertrophy, hyalinization in the intima, and hyperplasia in the endothelial layer [##REF##9541437##1##]. Arteriosclerotic retinopathy usually occurs as a result of progressive hardening of blood vessels by calci... | [
"<title>Methods</title>",
"<p>This case-control study was performed from July, 2005 to May, 2006 in the Retina service, Department of Ophthalmology of Tabriz University of Medical Sciences. All participants were recruited from male patients presenting for routine eye examination at the Tabriz Nikookari Eye Hospit... | [
"<title>Results</title>",
"<p>We compared a group of 80 male patients with retinal arteriosclerosis to 54 male control patients. There were no statistically significant differences between the mean ages of case (64.3±6.8 years) and control (66.7±8.0 years) groups (p>0.05). There was no significant difference i... | [
"<title>Discussion</title>",
"<p>Increased blood pressure, elevated total cholesterol, smoking status, coronary bypass surgery history, and high white blood cell count are important etiologic factors in retinal arteriosclerosis, but there is limited information about a possible role of Lp(a) and Hcy in the pathop... | [] | [
"<p>This is an open-access article distributed under the terms of the\n Creative Commons Attribution License, which permits unrestricted use,\n distribution, and reproduction in any medium, provided the original\n work is properly cited.</p>",
"<title>Purpose</title>",
"<p>Elevated levels o... | [] | [] | [
"<fig id=\"f1\" fig-type=\"figure\" position=\"float\"><label>Figure 1</label><caption><p>Relationship between Hcy level and the degree of retinal arteriosclerosis. There was a direct linear correlation between Hcy level and the degree of retinal arteriosclerosis in the study population (r=0.72, p<0.01), i.e. pa... | [
"<table-wrap id=\"t1\" position=\"float\"><label>Table 1</label><caption><title>Scheie classification</title></caption><table frame=\"hsides\" rules=\"groups\"><col width=\"42\" span=\"1\"/><col width=\"318\" span=\"1\"/><thead><tr><th valign=\"top\" align=\"center\" scope=\"col\" rowspan=\"1\" colspan=\"1\"><bold>... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Retinal arteriosclerosis was graded by slit-lamp with super-field lens and fundus photography in retina according to Scheie classification as above [##REF##13007237##30##,##UREF##0##31##].</p></table-wrap-foot>",
"<table-wrap-foot><p>This table shows the comparison of the lipid profiles betwe... | [
"<graphic xlink:href=\"mv-v14-1692-f1\"/>",
"<graphic xlink:href=\"mv-v14-1692-f2\"/>",
"<graphic xlink:href=\"mv-v14-1692-f3\"/>",
"<graphic xlink:href=\"mv-v14-1692-f4\"/>"
] | [] | [{"label": ["31"], "citation": ["Murphy RP, Lam LA, Chew EY. Hypertension. In: Ryan SJ, Hinton DR, Schachat AP, Wilkinson P, editors. Retina. Philadelphia: Mosby; 2006. p. 1377\u20131382."]}] | {
"acronym": [],
"definition": []
} | 46 | CC BY | no | 2022-01-12 14:47:37 | Mol Vis. 2008 Sep 15; 14:1692-1697 | oa_package/85/7c/PMC2538495.tar.gz |
PMC2538496 | 18806884 | [
"<title>Introduction</title>",
"<p>Diabetic retinopathy (DR), a leading cause of blindness worldwide, is a microvascular complication of diabetes characterized by increased vascular permeability and hemostatic abnormalities which can eventually lead to vascular occlusion in spite of antidiabetic treatment and res... | [
"<title>Methods</title>",
"<title>Study subjects</title>",
"<p>Unrelated participants with type 2 noninsulin-dependent diabetes mellitus (NIDDM) were recruited from the Eye Clinic of the Prince of Wales Hospital, Hong Kong. Diagnosis of type 2 diabetes was based on WHO criteria [##REF##9686693##12##]. This stud... | [
"<title>Results</title>",
"<p>The distributions of the six polymorphisms of <italic>EDN1</italic>, <italic>eNOS</italic>, <italic>LTA</italic>, and <italic>ITGA2</italic> in both case and control groups were under Hardy–Weinberg equilibrium. A significantly higher frequency of the <italic>EDN1</italic> Asn/Asn ge... | [
"<title>Discussion</title>",
"<p>The vasodilator NO and vasoconstrictor endothelin-1 (ET-1) effectively determine the tone of blood vessels [##REF##11839570##2##,##REF##11756889##17##]. Changes in blood flow contribute to early diabetic microangiopathy in DR [##REF##9315390##18##]. Genetic studies on <italic>eNO<... | [] | [
"<p>This is an open-access article distributed under the terms of the\n Creative Commons Attribution License, which permits unrestricted use,\n distribution, and reproduction in any medium, provided the original\n work is properly cited.</p>",
"<title>Purpose</title>",
"<p>We tested the hyp... | [] | [
"<title>Acknowledgements</title>",
"<p>We are grateful to patients for their participation in this study. This study is supported by a block grant of the Chinese University of Hong Kong and the Li Ka Shing Foundation, Ophthalmology research and training fund.</p>"
] | [] | [
"<table-wrap id=\"t1\" position=\"float\"><label>Table 1</label><caption><title>Clinical and metabolic characteristics of patients with type 2 diabetes</title></caption><table frame=\"hsides\" rules=\"groups\"><col width=\"216\" span=\"1\"/><col width=\"62\" span=\"1\"/><col width=\"63\" span=\"1\"/><col width=\"63... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>The table showed the comparisons of the clinical and metabolic characteristics among diabetes mellitus controls (DM) and diabetic retinopathy (DR) and DR subtypes. All p values were computed by χ2 or student t-tests. DR group showed a significantly higher level of HbA1c and higher percentage of... | [] | [] | [] | {
"acronym": [],
"definition": []
} | 33 | CC BY | no | 2022-01-12 14:47:37 | Mol Vis. 2008 Sep 15; 14:1698-1704 | oa_package/c9/b3/PMC2538496.tar.gz |
PMC2538497 | 18718026 | [
"<title>Background</title>",
"<p>Each year an estimated 1.2 million people die and a further 20–50 million are injured worldwide from road traffic accidents: a major public health problem [##UREF##0##1##]. In Vietnam, road traffic injuries are now the leading cause of fatal and non-fatal injuries [##UREF##1##2##]... | [
"<title>Methods</title>",
"<p>The study was undertaken at VietDuc Hospital, Hanoi, the major trauma centre in North Vietnam. Patients discharged between January 2005 and mid July 2005 with a history of TBI were enrolled in the study, based on the following inclusion criteria: aged 16 years and over; residential a... | [
"<title>Results</title>",
"<title>Demographic characteristics of study population</title>",
"<p>Discharge records from VietDuc hospital showed 61 patients met the inclusion criteria. Initial telephone contacts with these 61 patients and their families showed that five patients were deceased, ten were not contac... | [
"<title>Discussion</title>",
"<p>This study is the first estimate of the costs of non-fatal TBI in motorcycle users not wearing helmets in Vietnam, in their first year post-injury. Given the limited coverage of health and social insurance in Vietnam, the study focused on out of pocket expenses and foregone earnin... | [
"<title>Conclusion</title>",
"<p>This study has shown that all three components costs of TBI were high; the direct cost accounted for the largest proportion, with costs rising with the severity of TBI. The results suggest that the burden of TBI can be catastrophic for families because of high direct costs, signif... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>DALY: Disability Adjusted Life Years; DW: Disability weight; EQ6D: The European Quality of Life Instrument – 6 Dimensions; GCS: Glasgow Coma Scale; TBI: Traumatic Brain Injury; VND: Vietnamese Dong (currency; USD = 15,850 VND, July 2005); WHO: World Health Organization; YLD: Ye... | [
"<title>Acknowledgements</title>",
"<p>The researchers would like to acknowledge the University of Queensland and Atlantic Philanthropies for financial support and student scholarships, and the director of VietDuc hospital, Dr Nguyen Tien Quyet and Dr Nguyen Duc Chinh, Vice-Head of Planning Department for their a... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Change in ability to function in the six health dimensions.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Predicted average disability weight under DALY form.</p></caption></fig>"
] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>One-year costs associated with treatment by level of traumatic brain injury <italic>(Unit: USD, 1USD = 15,850 Vietnam dong)</italic></p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\" colspan=\"9\"><b... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>(*) Anova: p < 0.05</p></table-wrap-foot>",
"<table-wrap-foot><p>(*) Anova: p < 0.05</p></table-wrap-foot>",
"<table-wrap-foot><p>(*) Anova: p < 0.05</p><p><sup>1</sup>General Statistic Office: The Vietnam Living Standard Survey in 2004 showed that per capita income for urban area ... | [
"<graphic xlink:href=\"1478-7547-6-17-1\"/>",
"<graphic xlink:href=\"1478-7547-6-17-2\"/>"
] | [] | [{"surname": ["Peden", "Scurfield", "Sleet", "Mohan", "Hyder", "Jarawan", "Mathers"], "given-names": ["M", "R", "D", "D", "AA", "E", "C"], "source": ["World report on road traffic injury prevention"], "year": ["2004"], "publisher-name": ["Geneva: WHO"]}, {"collab": ["DHYTCC"], "source": ["Bao cao ket qua nghien cuu de ... | {
"acronym": [],
"definition": []
} | 16 | CC BY | no | 2022-01-12 14:47:37 | Cost Eff Resour Alloc. 2008 Aug 22; 6:17 | oa_package/ef/c7/PMC2538497.tar.gz |
PMC2538498 | 18691393 | [
"<title>Background</title>",
"<p>Use of complementary and alternative medicine (CAM) among people with cancer has been found to be common and widespread with estimates ranging between 7–64% [##REF##9708945##1##]. Apart from probable differences in CAM utilization in different settings and countries, this variatio... | [
"<title>Methods</title>",
"<p>The data presented here are drawn from a larger project exploring different stakeholder perspectives of exceptional CAM experiences, inspired by a similar program by National Cancer Institute (N.C.I.), N.I.H., U.S. [##UREF##2##13##]. We used an inductive approach to allow insight int... | [
"<title>Results</title>",
"<title>Demographic and disease characteristics of participants</title>",
"<p>Tables ##TAB##0##1## and ##TAB##1##2## present sample characteristics as reported by the study participants, with resulting gaps in information on occupational status and level of education. At the time of in... | [
"<title>Discussion and Conclusion</title>",
"<p>This study is an attempt to disentangle and further understand some of the variability involved in descriptions of CAM use. Based on users' own accounts, we have categorized CAM use and identified patterns in this use among a group of individuals with reported excep... | [
"<title>Discussion and Conclusion</title>",
"<p>This study is an attempt to disentangle and further understand some of the variability involved in descriptions of CAM use. Based on users' own accounts, we have categorized CAM use and identified patterns in this use among a group of individuals with reported excep... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>CAM: Complementary and Alternative Medicine; BHC: Biomedically-oriented health care; NCCAM: National Center for Complementary and Alternative Medicine; IQR: Inter-quartile Ranges; PC: Principal Component</p>",
"<title>Competing interests</title>",
"<p>The authors declare th... | [
"<title>Acknowledgements</title>",
"<p>We thank all the 38 participants who contributed with their stories. Suzanne Schönström for providing a secondary categorization of the CAM therapies and our colleagues at Unit for studies of integrative care for input during the research process.</p>",
"<p>Financial suppo... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Scree plot showing the proportion of variance explained by consecutive principal components (PCs)</bold>. Bootstrapped 95% confidence intervals are shown as vertical lines. The dotted horizontal reference line indicates the proportion of va... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Participant characteristics.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Characteristics</td><td align=\"right\">Frequency (n = 38)</td></tr></thead><tbody><tr><td align=\"left\">Age</td><td align=\"r... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Number of participants reporting a certain CAM is indicated in parentheses (if more than one).</p></table-wrap-foot>",
"<table-wrap-foot><p>* lci = lower confidence interval **uci = upper confidence interval</p></table-wrap-foot>",
"<table-wrap-foot><p>The table shows number of participants... | [
"<graphic xlink:href=\"1472-6882-8-48-1\"/>",
"<graphic xlink:href=\"1472-6882-8-48-2\"/>",
"<graphic xlink:href=\"1472-6882-8-48-3\"/>",
"<graphic xlink:href=\"1472-6882-8-48-4\"/>"
] | [] | [{"article-title": ["National Center for Complementary and Alternative Medicine (NCCAM)"]}, {"article-title": ["National Center in Complementary and Alternative Medicine: Exceptional case history registry"]}, {"article-title": ["Office of Cancer Complementary and Alternative Medicine: NCI Best Case Series Program"]}, {... | {
"acronym": [],
"definition": []
} | 26 | CC BY | no | 2022-01-12 14:47:37 | BMC Complement Altern Med. 2008 Aug 8; 8:48 | oa_package/5a/52/PMC2538498.tar.gz |
PMC2538499 | 18775076 | [
"<title>Background</title>",
"<p>Adolescent idiopathic scoliosis (AIS) is a structural three-dimensional deformity of the spine that occurs at or near the onset of puberty for which no cause can be established. In patients with small curve magnitude in the mean of 10° or so, the male and female prevalence is appr... | [
"<title>Methods</title>",
"<p>Methodologically, a retrospective review of the records of all patients who had been surgically treated for AIS between May 1996 and September 2005 at our hospital was performed at first. 18 patients were treated with Harington instrumentation and 132 patients with modern segmental s... | [
"<title>Results</title>",
"<p>This analysis includes the data for 150 patients (112 females; 74.7% and 38 males; 25.3%). All patients had clinical and radiographic follow-up of at least 2 years. The mean age of the males at the time of operation was 17.3 ± 2.2 years and that of the females 16.3 ± 2.8 years (p = 0... | [
"<title>Discussion</title>",
"<p>In the initial reports of segmental spinal instrumentation in the treatment of AIS, some radiographic distinctions between boys and girls had been reported [##REF##6239334##12##,##REF##4071271##13##]. According to these reports, between 10% and 30% of patients requiring operative ... | [
"<title>Conclusion</title>",
"<p>In conclusion, male patients with AIS have the similar curve pattern as that of female patients. Males had more rigid primary curves compared to females but a similar degree of postoperative scoliosis correction. Male AIS patients were older at the time of surgery. These preoperat... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>EA, the senior surgeon and has made substantial contributions to conception and design of the manuscript. HB has been involved in drafting the manuscript, par... | [
"<title>Acknowledgements</title>",
"<p>The authors acknowledge the assistance of Mohamadian N in data management and statistical analysis.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>A 15 years old boy presented with AIS.</bold> Above: preoperative standing posteroanterior and lateral views, below: supine left and right bending films.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><cap... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Curve pattern according to King classification</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">King Classification</td><td align=\"center\">Male (%)</td><td align=\"center\">Female (%)</td></tr></thead>... | [
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>",
"<inline-formula></inline-formula>"
] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>*Mean ± Standard Deviation NS: Not Significant</p></table-wrap-foot>",
"<table-wrap-foot><p>* Mean ± Standard Deviation NS: Not Significant</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1748-7161-3-12-1\"/>",
"<graphic xlink:href=\"1748-7161-3-12-2\"/>",
"<inline-graphic xlink:href=\"1748-7161-3-12-i1.gif\"/>",
"<inline-graphic xlink:href=\"1748-7161-3-12-i1.gif\"/>",
"<inline-graphic xlink:href=\"1748-7161-3-12-i1.gif\"/>",
"<inline-graphic xlink:href=\"1748-7161-... | [] | [{"surname": ["Cobb"], "given-names": ["JR"], "article-title": ["Outline for the study of scoliosis"], "source": ["Instr Course Lect AAOS"], "year": ["1948"], "volume": ["5"], "fpage": ["261"], "lpage": ["75"]}, {"surname": ["Aebi", "Thalgott", "Webb"], "given-names": ["M", "JS", "JK"], "source": ["AO ASIF principles i... | {
"acronym": [],
"definition": []
} | 17 | CC BY | no | 2022-01-12 14:47:37 | Scoliosis. 2008 Sep 6; 3:12 | oa_package/15/6b/PMC2538499.tar.gz |
PMC2538500 | 18717988 | [
"<title>Introduction</title>",
"<p>It has been estimated that pelagic bacteria are extremely abundant, achieving densities of up to 10<sup>6 </sup>per ml of seawater, and account for most oceanic biomass and metabolism [##UREF##0##1##]; while numbers of bacteria which are thought to colonize marine snow can reach... | [] | [] | [] | [
"<title>Conclusion</title>",
"<p>This review is intended to focus the reader's attention on the potential of exploiting metagenomics, specifically the use of metagenomic libraries constructed from unique marine environments as an approach to successfully exploit the largely \"untapped\" resources within various m... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>ADWD drafted the manuscript. JK and JRM contributed additional content throughout the article. All authors have read and approved the final manuscript.</p>"
] | [
"<title>Acknowledgements</title>",
"<p>J.K. is in receipt of a Marie Curie Transfer of Knowledge Host Fellowship (Grant No. MTKD-CT-2006-042062). This project was funded by the Marine Biodiscovery Research award funded by the Irish Government under the National Development Plan (2007–2013).</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Omic based approaches to identify novel biocatalysts from marine ecosystems</bold>.</p></caption></fig>"
] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Enzymes from marine microbes</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\"><bold>Enzyme</bold></td><td align=\"center\"><bold>Producing Organism</bold></td><td align=\"center\"><bold>Habitat</bold></t... | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1475-2859-7-27-1\"/>"
] | [] | [{"surname": ["Azam"], "given-names": ["F"], "article-title": ["Oceanography: Microbial Control of Cceanic Carbon Flux: The Plot Thickens"], "source": ["Science"], "year": ["1998"], "volume": ["280"], "fpage": ["694"], "lpage": ["696"], "pub-id": ["10.1126/science.280.5364.694"]}, {"surname": ["Lorentzen", "Moe", "Jouv... | {
"acronym": [],
"definition": []
} | 89 | CC BY | no | 2022-01-12 14:47:37 | Microb Cell Fact. 2008 Aug 21; 7:27 | oa_package/70/06/PMC2538500.tar.gz |
PMC2538501 | 18759978 | [
"<title>Background</title>",
"<p>A daily aspirin delays the progression of occlusive atherosclerotic vascular disease [##UREF##0##1##, ####REF##8298418##2##, ##REF##8312766##3##, ##REF##8054013##4##, ##REF##15494585##5####15494585##5##]. Patients with a history of myocardial infarction who are taking aspirin have... | [
"<title>Methods</title>",
"<p>Subjects were contacted by phone, and after a detailed explanation of the study were invited to participate. Prior to the study informed consent was obtained. Inclusion criteria for the MI. patients were hospital admission for a myocardial infarction during the period between 1995 an... | [
"<title>Results</title>",
"<title>Compliant Subjects</title>",
"<p>The mean age for the 184 known compliant subjects was 63 ± 11 years, with 63% males and 37% females. The mean BMI for myocardial infarction patients was 29.4 with 39 percent having a BMI of more than 31. Thirty nine percent of the coronary arter... | [
"<title>Discussion</title>",
"<p>After assuring compliance by observing post MI and normal subjects taking their aspirin, we determined that only 7 of 184 (3%) demonstrated decreased platelet inhibition that could be defined as aspirin resistance. There was no difference in net aspirin inhibitory response between... | [
"<title>Conclusion</title>",
"<p>Aspirin resistance is an unfortunate descriptor. It suggests an inherited or acquired defect for the ability of aspirin to acetylate platelet COX-1. Our current data interpreted in the context of our prior publication as well as several recent reviews reinforces the importance of ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>MI: myocardial infarction; NANSAIDs: non-steroidal anti-inflammatory drugs; AA: light aggregometry; PPA: platelet prostaglandin agonist; COX: cyclooxygenase; CAD: coronary arterial disease.</p>",
"<title>Competing interests</title>",
"<p>The authors declare that they have n... | [
"<title>Acknowledgements</title>",
"<p>Institution where work was carried out – Ingham Regional Medical Center and McLaren Regional Medical Center</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Note that PPA demonstrates a gradual return of platelet aggregation to normal over 3 days.</bold> This characteristic of PPA stimulated aggregation makes it useful for measuring gradations of aspirin induced platelet inhibition. AA aggregat... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Demonstration of Aspirin non-Compliance by Repeat Testing</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td/><td align=\"center\" colspan=\"2\">Methods for</td><td/></tr><tr><td/><td/><td colspan=\"2\"><hr/></td><td/... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>NOTES:</p><p>Clinical measures were not available for the control subjects.</p><p>Not all MI patients have complete clinical measures data.</p></table-wrap-foot>",
"<table-wrap-foot><p>93% (62 of 67) of aberrant platelet responses to aspirin were due to non-compliance. Among compliant post MI... | [
"<graphic xlink:href=\"1479-5876-6-46-1\"/>",
"<graphic xlink:href=\"1479-5876-6-46-2\"/>",
"<graphic xlink:href=\"1479-5876-6-46-3\"/>"
] | [] | [{"collab": ["ATC"], "article-title": ["Secondary prevention of vascular disease by prolonged anti-platelet treatment"], "source": ["British Medical Journal"], "year": ["1988"], "volume": ["26"], "fpage": ["320"], "lpage": ["31"]}, {"surname": ["Rao", "Johnston", "Reddy", "White"], "given-names": ["G", "G", "K", "J"], ... | {
"acronym": [],
"definition": []
} | 39 | CC BY | no | 2022-01-12 14:47:37 | J Transl Med. 2008 Aug 29; 6:46 | oa_package/e3/34/PMC2538501.tar.gz |
PMC2538502 | 18752684 | [
"<title>Introduction</title>",
"<p>Peroxisome proliferator-activated receptor-γ (PPARγ) has been shown to be expressed in many of the cells that play a role in the response to vascular injury and to modulate the actions that are thought to initiate neointimal (NI) growth, including inflammation [##REF##14517165##... | [
"<title>Methods</title>",
"<title>Animals</title>",
"<p>Thirty-nine white adult male rabbits (New Zealand), weighing 2.474 ± 348 Kg, were utilized for this experiment. Animals were handled in compliance with the Guiding Principles in the Care and Use of Animals. Protocol approval was obtained from the Pontifica... | [
"<title>Results</title>",
"<title>Metabolic and lipid profiles</title>",
"<p>The rabbit's weight did not differ between groups (data not shown). Baselineglucose, total cholesterol, HDL-cholesterol and triglycerides levels were equal in all groups before initiation of the diet. On day 14, two weeks after feeding... | [
"<title>Discussion</title>",
"<p>Prevention of restenosis after balloon coronary angioplasty or stent implantation with the use of local and systemic therapy is a challenging issue in interventional cardiology [##REF##16740417##4##,##REF##12055567##17##, ####REF##16267248##18##, ##REF##12478229##19##, ##REF##1107... | [
"<title>Conclusion</title>",
"<p>The results of our study indicate that when rosiglitazone is administered in hypercholesterolemic rabbits before, but not after, undergoing vascular injury, there is significantly reduced neointimal formation.</p>"
] | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>AA participated in the study design, ORFN participated in the study design, PRSB oriented in the surgical procedures, CP oriented in the management of the ani... | [] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Representative histological sections demonstrating neointimal formation – Orcein Staining.</bold><bold>Panel A</bold>: Control group. <bold>Panel B</bold>: Group I. <bold>Panel C</bold>: Group II. NI represents neointima.</p></caption></fig... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Metabolic and lipid profiles (mean ± SD)</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td/><td align=\"left\">CG</td><td align=\"left\">Group I</td><td align=\"left\">Group II</td><td align=\"left\">P value</td></tr... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>NS – non significant.</p><p>* Kruskal-Wallis</p></table-wrap-foot>",
"<table-wrap-foot><p>IMR represents intima/media area ratio. Area was estimated in square micrometer.</p></table-wrap-foot>",
"<table-wrap-foot><p>No represents less than 50% of cells in the balloon injury area. Yes repres... | [
"<graphic xlink:href=\"1477-9560-6-12-1\"/>",
"<graphic xlink:href=\"1477-9560-6-12-2\"/>"
] | [] | [{"surname": ["Taskiran", "Taskiran", "Yercan", "Kutay"], "given-names": ["D", "E", "H", "FZ"], "article-title": ["Quantification of total collagen in rabbit tendon by the Sirius red method"], "source": ["Tr J of Medical Scienses"], "year": ["1999"], "volume": ["29"], "fpage": ["7"], "lpage": ["9"]}, {"surname": ["Sun"... | {
"acronym": [],
"definition": []
} | 38 | CC BY | no | 2022-01-12 14:47:37 | Thromb J. 2008 Aug 27; 6:12 | oa_package/ff/10/PMC2538502.tar.gz |
PMC2538503 | 18768083 | [] | [] | [] | [
"<title>Discussion</title>",
"<p>Spinal manifestations of vertebral artery dissection (VAD) are a rare event.[##REF##16960096##1##] Typical manifestations of VAD include brain ischemia combined with neck pain.[##REF##8073471##2##] In previous reports of patients with spinal manifestations of VAD the prominent sig... | [] | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Case presentation</title>",
"<p>A 51-year-old women presented with a two-weeks history of progressive pain and weakness of her right arm. Ten days earlier an orthopaedic specialist had performed a chiropractic maneuver to resolve the pain radiating from the neck to the right upper arm without alleviation ... | [] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>MRI of the cervical spine, axial views (A,B): The T1-weighted fat-saturated axial image (A) shows an eccentric hyperintensity surrounding the right VA at C5 level (arrow) indicating an intramural hematoma.</bold> The T2-weighted image <bold... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1757-1626-1-139-1\"/>"
] | [] | [] | {
"acronym": [],
"definition": []
} | 5 | CC BY | no | 2022-01-12 14:47:37 | Cases J. 2008 Sep 3; 1:139 | oa_package/2d/b0/PMC2538503.tar.gz |
PMC2538504 | 18775077 | [
"<title>Introduction</title>",
"<p>Granular cell tumour (GCT) was first described in 1926 by Abrikosoff as a rare myogenic lesion affecting the tongue. Further immunohistochemical tests have subsequently shown this lesion to have probably a perineural or Schwann cell origin. Abrikosoff in 1931 described a similar... | [] | [] | [
"<title>Discussion</title>",
"<p>GCT is a rare usually benign tumour which is most frequently encountered in the tongue, but can occur in a variety of visceral and cutaneous sites. Although there are a limited number of reported cases in the English literature the frequency of GCT is estimated to be 1 per 1000 ca... | [
"<title>Conclusion</title>",
"<p>In conclusion, as GCT can easily be misdiagnosed as primary breast carcinoma clinically and radiologically, histological analysis of these lesions is needed to achieve a diagnosis. This case highlights the benefits of triple assessment in the management of beast lumps Surgeons sho... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Case presentation</title>",
"<p>A 55 year old female presented with a 2 month history of a painless lump in her upper outer quadrant of her right breast. She was on hormone replacement therapy for the previous 4 years. There was no family history of breast cancer and past medical history was unremarkable.... | [] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Mammographic appearance of granular cell tumour</bold>. Mammogram shows a dense mass deep in the upper outer quadrant of the right breast adjacent to the pectoralis major muscle.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><l... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1757-1626-1-142-1\"/>",
"<graphic xlink:href=\"1757-1626-1-142-2\"/>",
"<graphic xlink:href=\"1757-1626-1-142-3\"/>"
] | [] | [{"surname": ["Abrikosoff"], "given-names": ["A"], "article-title": ["\"Weitere untersuchungen uber mublastenmyome\""], "source": ["Virchow Arch Path Anat"], "year": ["1931"], "volume": ["280"], "fpage": ["723"], "pub-id": ["10.1007/BF02038883"]}, {"surname": ["Regalado", "Sittler"], "given-names": ["J", "S"], "article... | {
"acronym": [],
"definition": []
} | 10 | CC BY | no | 2022-01-12 14:47:37 | Cases J. 2008 Sep 6; 1:142 | oa_package/99/29/PMC2538504.tar.gz |
PMC2538505 | 18724874 | [
"<title>Background</title>",
"<p>Most patients with colorectal cancer survive at least five years after diagnosis [##UREF##0##1##], making health-related quality of life (HRQL) an important outcome for these patients. Patient-reported outcomes including HRQL have been used in conjunction with traditional clinical... | [
"<title>Methods</title>",
"<title>Study population</title>",
"<p>Men and women aged 40 to 84 diagnosed with invasive (i.e., excluding <italic>in situ</italic>) colorectal cancer from April 1999 through June 2000 were identified from three of the ten regional registries that comprise the statewide population-bas... | [
"<title>Results</title>",
"<title>Sample characteristics</title>",
"<p>Of the 830 English-speaking patients invited to participate in the follow-up study, 26 were ineligible because they had died. Follow-up surveys were completed by 568 (70.6%) of the 804 eligible patients. Of the 236 patients who did not parti... | [
"<title>Discussion</title>",
"<p>Exploratory longitudinal analyses were conducted to evaluate the relationship between three HRQL outcomes and sociodemographic, cancer/health, and healthcare variables in a population-based sample of patients with colorectal cancer. General health was the only variable common to a... | [
"<title>Conclusion</title>",
"<p>We identified sociodemographic, clinical, and healthcare variables that predict HRQL as measured by the FACT-C. The most consistent finding was that patients with poor general health and problems with certain domains of perceived quality of cancer care may be at risk for poor HRQL... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>List of abbreviations</title>",
"<p>HRQL: Health-related quality of life; FACT-C: Functional Assessment of Cancer Therapy-Colorectal; PWB: Physical well-being; EWB: Emotional well-being; SWB: Social/family well-being, FWB: Functional well-being; TOI: Trial outcome index; CCR: California Cancer Registry; S... | [
"<title>Acknowledgements</title>",
"<p>This work was supported by grants from the Surveillance, Epidemiology and End Results Special Study program (NO1-PC-65107), and the Agency for Healthcare Research and Quality and the National Cancer Institute (R01 HS09869, U01 CA93324). The authors would like to thank Willia... | [] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Characteristics of follow-up survey respondents and non-respondents at the time of diagnosis or the initial survey</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Variable Type</bold></td><td align=... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>HRQL, Health-related Quality of Life; TOI, Trial Outcome Index-Colorectal; SWB, Social/family well-being; EWB, Emotional well-being; SD, standard deviation; IQR, interquartile range.</p><p><sup>a</sup>Data for all variables were collected via self report in the initial survey except gender, sta... | [] | [] | [{"collab": ["American Cancer Society"], "source": ["Cancer Facts and Figures, 2007"], "year": ["2007"], "publisher-name": ["Atlanta, GA, American Cancer Society"]}, {"surname": ["Kwong", "Perkins", "Morris", "Cohen", "Allen", "Wright"], "given-names": ["S", "CI", "CR", "R", "M", "WE"], "source": ["Cancer in California... | {
"acronym": [],
"definition": []
} | 49 | CC BY | no | 2022-01-12 14:47:37 | Health Qual Life Outcomes. 2008 Aug 25; 6:66 | oa_package/62/7b/PMC2538505.tar.gz |
PMC2538506 | 18684327 | [
"<title>Background</title>",
"<p>Patient reported outcome measures (PROMs) are increasingly being used as primary or secondary outcome measures in clinical trials [##REF##14645463##1##,##REF##18031706##2##]. As such, the quality of inferences made from clinical trials is dependent on the PROMs used. This increasi... | [
"<title>Methods</title>",
"<title>Setting and Participants</title>",
"<p>A random sample of 460 people with CD was recruited from a complete list of 1110 members from the Dystonia Society of Great Britain. The sampling strategy is described elsewhere [##REF##15534247##6##]. A booklet of questionnaires was admin... | [
"<title>Results</title>",
"<title>Sample</title>",
"<p>Of the 460 patients who received the CDIP-58, 391 returned completed questionnaires (corrected response rate = 87%). Of the 140 TRT questionnaires, 105 were returned completed (corrected response rate = 75%). The sample included people with a wide range of ... | [
"<title>Discussion</title>",
"<p>The forthcoming FDA guidelines make it increasingly important for researchers and clinicians to be exposed to the science behind PROMs. In this study, the CDIP-58 satisfied traditional psychometric criteria for data quality, scaling assumptions, targeting, reliability and validity... | [
"<title>Conclusion</title>",
"<p>This study has shown that new psychometric methods can produce a PROM that stands up to traditional criteria and supports the clinical advantages of Rasch analysis. In addition, the CDIP-58 satisfied traditional reliability and validity criteria further supporting it as a clinical... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>SC collected, conducted, analysed and interpreted the data and wrote the manuscript. JH conceived and designed the study and contributed to the interpretation... | [
"<title>Acknowledgements</title>",
"<p>We wish to thank the people with CD who participated in this study and Mr Alan Leng and Ms Laura Camfield at the Dystonia Society of Great Britain for help with recruitment. This study was supported by a project grant from the Wellcome Trust. During the writing of this paper... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Measurement model of the CDIP-58.</p></caption></fig>"
] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Adapted from table 4 of the FDA draft guidelines for measurement properties reviewed for PRO instruments used in clinical trials</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Measurement Property<... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>✓ = tested; ✗ = not tested; * Reported in Cano et al 2004 [##REF##15534247##6##]; ** Reported in Cano et al 2006 [##REF##17190951##28##]; *** Although not including MID in our responsiveness paper (Cano et al, 2006 [##REF##17190951##28##]), we include a comparison of relative responsiveness to ... | [
"<graphic xlink:href=\"1477-7525-6-58-1\"/>"
] | [] | [{"surname": ["Administration"], "given-names": ["FD"], "article-title": ["Patient reported outcome measures: use in medical product development to support labelling claims"]}, {"surname": ["Agency"], "given-names": ["EM"], "source": ["Reflection paper on the regulatory guidance for the use of the health-related qualit... | {
"acronym": [],
"definition": []
} | 37 | CC BY | no | 2022-01-12 14:47:37 | Health Qual Life Outcomes. 2008 Aug 6; 6:58 | oa_package/35/7c/PMC2538506.tar.gz |
PMC2538507 | 18680583 | [] | [] | [] | [] | [
"<title>Conclusion</title>",
"<p>This presentation is intended to stimulate thinking about the difficulties in stepping outside of our primary areas of interest, and to offer frames of reference for considering where synergies might be identified and acted upon. Dedicated individuals and organizations who care ab... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>The issue</title>",
"<p>Reproduction may be defined as the successful creation of the next generation of individuals of the same species who are also able to reproduce. Given the importance of breastfeeding for ensuring the health and survival of the next generation, its impact on fertility, and its impac... | [] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Vase? Or two profiles?</bold>. Our initial perspective may make it difficult to view things from a new perspective, but it is possible.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Lact... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1746-4358-3-16-1\"/>",
"<graphic xlink:href=\"1746-4358-3-16-2\"/>",
"<graphic xlink:href=\"1746-4358-3-16-3\"/>",
"<graphic xlink:href=\"1746-4358-3-16-4\"/>",
"<graphic xlink:href=\"1746-4358-3-16-5\"/>"
] | [] | [{"surname": ["Piaget"], "given-names": ["J"], "article-title": ["L'\u00e9pist\u00e9mologie des relations interdisciplinaires"], "source": ["Proceedings of the workshop: L'interdisciplinarit\u00e9 probl\u00e8mes d'enseignement et de recherche dans les universit\u00e9: 7\u201312 September 1970; Nice (France)"], "year": ... | {
"acronym": [],
"definition": []
} | 18 | CC BY | no | 2022-01-12 14:47:37 | Int Breastfeed J. 2008 Aug 4; 3:16 | oa_package/77/47/PMC2538507.tar.gz |
PMC2538508 | 18706090 | [
"<title>Background</title>",
"<p>Infection of cells by HIV requires a number of host cell factors [##REF##12091904##1##]. Differences in these factors can contribute to variability in infection levels between individuals. Previous studies show that HIV infection levels of cells differ between individuals, with up... | [
"<title>Methods</title>",
"<title>Cell culture</title>",
"<p>PBMC were obtained from healthy donors by Ficoll-Hypaque (Whittaker M.A. Bioproducts, Walkersville, MD) gradient centrifugation of freshly obtained heparanized blood. To activate PBMC, 3 μg/ml phytohemagglutinin (PHA-L; Sigma/Aldrich, St. Louis, MO) w... | [
"<title>Results</title>",
"<p>We assessed the possibility of differences in HIV binding to donor PBMC using the R5 primary isolate HIV<sub>TH </sub>and freshly isolated PBMC from 19 different healthy donors. HIV binding was variable between donors, with up to a 3.9-fold difference in virus binding between the hig... | [
"<title>Discussion</title>",
"<p>In this study we found that differences exist in the level of HIV binding to donor PBMC, that binding phenotypes of the donors are stable over four weeks, and that binding phenotypes are consistent across several HIV strains. Importantly, the variability in virus binding to cells ... | [
"<title>Conclusion</title>",
"<p>By showing that high and low HIV-binding phenotypes exist, these studies highlight the impact of host-acquired molecules on the initial steps of HIV infection. This study therefore provides added insight into understanding the mechanism of HIV tethering to cells, which could poten... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>JJA and GGO performed all of the experiments. JJA participated in writing of the manuscript. GTS provided overall direction and co-wrote the manuscript. All a... | [
"<title>Acknowledgements</title>",
"<p>This work was supported by National Institutes of Health grant P01HD40539.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>HIV binding to PBMC is variable between donors</bold>. <bold>(A) </bold>Freshly isolated PBMC (3 × 10<sup>6</sup>) were incubated with HIV<sub>TH </sub>(2000 pg of p24) in serum-free RPMI-1640 medium for 45 minutes on ice. After incubation ... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1743-422X-5-95-1\"/>",
"<graphic xlink:href=\"1743-422X-5-95-2\"/>",
"<graphic xlink:href=\"1743-422X-5-95-3\"/>",
"<graphic xlink:href=\"1743-422X-5-95-4\"/>"
] | [] | [] | {
"acronym": [],
"definition": []
} | 19 | CC BY | no | 2022-01-12 14:47:37 | Virol J. 2008 Aug 15; 5:95 | oa_package/06/ef/PMC2538508.tar.gz |
PMC2538509 | 18715509 | [
"<title>Background</title>",
"<p>Smallpox epidemiology has the longest and richest history in investigating the mechanisms of spread and in evaluating the effectiveness of vaccination [##UREF##0##1##,##UREF##1##2##]. Modern epidemiological methods have developed in parallel with smallpox control practice, and con... | [] | [] | [] | [
"<title>Conclusion</title>",
"<p>This article has reviewed quantifications of the transmission and spread of smallpox using historical data. Although historical data are limited and we cannot answer all questions regarding smallpox epidemiology, many publications are available from previous efforts. However, a sy... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Review</title>",
"<title>Extracting key information from historical data</title>",
"<p>Although historical data have frequently been revisited using modern statistical techniques to identify epidemiological determinants of smallpox, many key issues remain unknown in spite of great efforts. To clarify im... | [
"<title>Acknowledgements</title>",
"<p>This review would not have been possible without technical support and input from Klaus Dietz and Isao Arita. This study was in part supported by European Union project INFTRANS (FP6 STREP; contract no. 513715). The study of HN was supported by The Netherlands Organisation f... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Incubation period distribution of smallpox fitted to a lognormal distribution (n = 131)</bold>. The vertical arrow indicates the maximum likelihood estimate of the 99th percentile of the incubation period [##UREF##11##42##]. The median and ... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Reported estimates of <italic>R</italic><sub>0 </sub>for smallpox</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">Location</td><td align=\"center\"><italic>R</italic><sub>0</sub></td><td align=\"center\... | [
"<disp-formula id=\"bmcM1\"><label>(1)</label><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1742-4682-5-20-i1\" overflow=\"scroll\"><mml:semantics><mml:mrow><mml:mi>f</mml:mi><mml:mo stretchy=\"false\">(</mml:mo><mml:msub><mml:mi>t</mml:mi><mml:mi>i</mml:mi></mml:msub><mml:mo>;</mml:mo... | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p><sup>‡</sup>The ranges for the outbreak in Abakaliki are 95% confidence intervals.</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1742-4682-5-20-1\"/>",
"<graphic xlink:href=\"1742-4682-5-20-2\"/>",
"<graphic xlink:href=\"1742-4682-5-20-3\"/>",
"<graphic xlink:href=\"1742-4682-5-20-4\"/>"
] | [] | [{"surname": ["Fenner", "Henderson", "Arita", "Ladnyi"], "given-names": ["F", "DA", "I", "ID"], "source": ["Smallpox and its eradication"], "year": ["1988"], "publisher-name": ["Geneva: World Health Organization"]}, {"surname": ["Greenwood"], "given-names": ["M"], "source": ["Epidemics and Crowd Diseases An Introductio... | {
"acronym": [],
"definition": []
} | 120 | CC BY | no | 2022-01-12 14:47:37 | Theor Biol Med Model. 2008 Aug 20; 5:20 | oa_package/9d/5c/PMC2538509.tar.gz |
PMC2538510 | 18673579 | [
"<title>Background</title>",
"<p>Insulin, secreted by pancreatic islet <italic>β</italic>-cells, is the principal regulating hormone of glucose metabolism. In humans, plasma insulin exhibits oscillatory characteristics across several time scales independent of changes in plasma glucose [##REF##11815487##1##, ####... | [
"<title>Methods</title>",
"<title>Mathematical model of the electrical excitability of <italic>β</italic>-cells</title>",
"<p>As we have previously described in [##REF##17912360##40##], we adopt the formulation developed by Sherman et al [##REF##8770032##67##,##REF##11276531##68##] of the Hodgkin-Huxley model f... | [
"<title>Results</title>",
"<title>Sorting cells using Lomb-Scargle periodogram</title>",
"<p>The first step post simulation of a <italic>β</italic>-cell cluster is to determine the bursting status of each <italic>β</italic>-cell in the cluster. In general it can be a burster, a spiker, or a silent cell [##REF##... | [
"<title>Discussion</title>",
"<p>Previously we have, for the first time, studied the functional dependence of islet pulsatile insulin release on its cytoarchitectural organization of <italic>β</italic>-cells [##REF##17912360##40##]. In the current study, we further investigated two key islet structural parameters... | [] | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>CCI: cluster coupling index; CSI: cluster synchronization index; HCP: hexagonal closest packing; SCP: simple cubic packing; T1D: type 1 diabetes; T2D: type 2 diabetes; ROI: region of interest; PSD: power spectral density.</p>",
"<title>Competing interests</title>",
"<p>The ... | [
"<title>Acknowledgements</title>",
"<p>This work is supported in part by a special fund from Children's Hospital Foundation, Children's Research Institute of Wisconsin and Children's Hospital of Wisconsin. Most simulations were run on the cluster Zeke of the Computational Bioengineering group at MCW, courtesy of ... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Cell sorting using Lomb-Scargle periodogram. (a) Calcium profiles, (b) membrane action potential profiles, and (c) Lomb-Scargle periodogram, of a burster cell, a spiker cell and a silent cell. The burster has a clear peak frequency at <italic>f <... | [] | [
"<disp-formula id=\"bmcM1\"><label>(1)</label><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1742-4682-5-17-i1\" overflow=\"scroll\"><mml:semantics><mml:mrow><mml:mstyle displaystyle=\"true\"><mml:munder><mml:mo>∑</mml:mo><mml:mrow><mml:mi>j</mml:mi><mml:mo>=</mml:mo><mml:mtext>all cell... | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1742-4682-5-17-1\"/>",
"<graphic xlink:href=\"1742-4682-5-17-2\"/>",
"<graphic xlink:href=\"1742-4682-5-17-3\"/>",
"<graphic xlink:href=\"1742-4682-5-17-4\"/>",
"<graphic xlink:href=\"1742-4682-5-17-5\"/>",
"<graphic xlink:href=\"1742-4682-5-17-6\"/>"
] | [] | [{"surname": ["Lomb"], "given-names": ["N"], "article-title": ["Least-squares frequency analysis of unevenly spaced data"], "source": ["Astrophysics and Space Science"], "year": ["1976"], "volume": ["39"], "fpage": ["447"], "lpage": ["462"], "pub-id": ["10.1007/BF00648343"]}, {"surname": ["Scargle"], "given-names": ["J... | {
"acronym": [],
"definition": []
} | 69 | CC BY | no | 2022-01-12 14:47:37 | Theor Biol Med Model. 2008 Aug 3; 5:17 | oa_package/2e/88/PMC2538510.tar.gz |
PMC2538511 | 18771582 | [
"<title>Background</title>",
"<p>The patellofemoral (PF) joint consists of the distal femur and patella. PF pain syndrome – also known as anterior knee pain or chondromalacia – is very common and is widely believed to be caused by abnormal motion of the patella relative to the femur (often referred to as patellar... | [
"<title>Methods</title>",
"<title>Overview</title>",
"<p>We have developed a CT model-based technique for accurately measuring <italic>in-vivo</italic> joint motion from biplane x-ray images. Specific details of this technique, which tracks the position of bones by maximizing the correlation between biplane x-r... | [
"<title>Results</title>",
"<p>There was very high agreement between the results from the model-based tracking and RSA techniques (Figure ##FIG##1##2##). In comparing the position of the implanted tantalum beads, bias ranged from -0.174 to 0.248 mm (depending on coordinate direction), precision ranged from 0.023 t... | [
"<title>Discussion</title>",
"<p>Accurately measuring PF joint motion is important for understanding, among other things, the effect of conservative and surgical treatment of PF pain syndrome. A previous study that compared patellar tracking patterns between subjects with PF pain and subjects without PF pain repo... | [] | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>MJB designed this study, participated in the data collection and analysis, and drafted the manuscript. SKK participated in the data collection and analysis. S... | [] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Experimental testing configuration.</bold> The tibia of each cadaveric leg specimen was rigidly attached to a custom testing fixture, with the leg suspended within the biplane x-ray system in an inverted position. The quadriceps tendon was ... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Accuracy of the model-based technique for tracking the patella and femur was expressed in terms of bias and precision as mean ± standard deviation.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"center\" c... | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1749-799X-3-38-1\"/>",
"<graphic xlink:href=\"1749-799X-3-38-2\"/>",
"<graphic xlink:href=\"1749-799X-3-38-3\"/>"
] | [] | [{"collab": ["ASTM"], "source": ["Standard Practice for Use of the Terms Precision and Bias in ASTM Test Methods"], "year": ["1996"], "publisher-name": ["West Conshohocken, PA, "]}] | {
"acronym": [],
"definition": []
} | 43 | CC BY | no | 2022-01-12 14:47:37 | J Orthop Surg. 2008 Sep 4; 3:38 | oa_package/12/8d/PMC2538511.tar.gz |
PMC2538512 | 18700017 | [
"<title>Background</title>",
"<p>The network or directed graph description has become the preferred representation of the integrated activity of components of biological processes. The exponential growth of biological network data in the last five years has its source in recent advances in technologies such as ma... | [
"<title>Methods</title>",
"<p>We use the transcription regulatory networks of <italic>Saccharomyces cerevisiae </italic>under various physiological conditions – composite, cell cycle, sporulation, diauxic shift, DNA damage, and stress response – published by Luscombe and coworkers [##REF##15372033##5##]. Their la... | [
"<title>Results</title>",
"<p>We enumerated the occurrences of FFL, 3-CYC, SIM, MIM, and Bifan subgraph patterns (see Figure ##FIG##0##1##) in:</p>",
"<p>1. the transcription networks of <italic>Saccharomyces cerevisiae </italic>(Yeast) under various physiological states [##REF##15372033##5##] (see Table ##TAB#... | [
"<title>Discussion</title>",
"<title>The observed discrepancy in occurrence frequency of FFLs and 3-CYCs is a natural consequence of topological properties of networks</title>",
"<p>Occurrences of FFLs and 3-CYCs in various biological networks (see Table ##TAB##0##1##) show patterns: there are a relatively larg... | [
"<title>Conclusion</title>",
"<p>We have analysed several biological networks. Our results suggest that there is no evidence suggesting selection for or against subgraph patterns such as FFL, 3-CYC, SIM, MIM, Bifan. We have shown that, in contrast to the need to invoke selection to explain the structure of observ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>Both the authors contributed equally to the planning and execution of this study; both authors contributed to the draft, and have read and approved the final manuscript.</p>"
] | [] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Canonical subgraph patterns in biological networks</bold>. Canonical subgraph patterns in biological networks. (a) Feed-forward loop (FFL): contains a \"source\" (at the top), \"intermediate\" (bottom-left), and \"target\" (bottom-right) no... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Frequencies of canonical subgraph patterns in biological networks</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"right\">FFL</td><td align=\"right\">3-CYC</td><td align=\"right\">SIM</td><td align=\"right\... | [
"<inline-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathML\" id=\"M1\" name=\"1752-0509-2-73-i1\" overflow=\"scroll\"><mml:semantics><mml:mtext mathvariant=\"script\">P</mml:mtext></mml:semantics></mml:math></inline-formula>",
"<inline-formula><mml:math xmlns:mml=\"http://www.w3.org/1998/Math/MathM... | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Frequencies of FFL, 3-CYC, SIM, MIM, and Bifan in (a-f) various transcription networks of <italic>Saccharomyces cerevisiae</italic>, (g) transcription network of <italic>Escherichia coli</italic>, and (h) signalling pathway of hippocampal CA1 neuron. The observed frequencies, <italic>n</italic>... | [
"<graphic xlink:href=\"1752-0509-2-73-1\"/>",
"<graphic xlink:href=\"1752-0509-2-73-2\"/>",
"<graphic xlink:href=\"1752-0509-2-73-3\"/>"
] | [] | [{"surname": ["Ullmann"], "given-names": ["JR"], "article-title": ["An Algorithm for Subgraph Isomorphism"], "source": ["J ACM"], "year": ["1976"], "volume": ["23"], "fpage": ["31"], "lpage": ["42"]}, {"surname": ["Alon"], "given-names": ["U"], "source": ["An Introduction to Systems Biology: Design Principles of Biolog... | {
"acronym": [],
"definition": []
} | 20 | CC BY | no | 2022-01-12 14:47:37 | BMC Syst Biol. 2008 Aug 12; 2:73 | oa_package/89/76/PMC2538512.tar.gz |
PMC2538513 | 18710582 | [
"<title>Introduction</title>",
"<p>Parasites alter physiology and/or morphology of hosts in order to survive in a new environment. It is remarkable how some parasites make a new architecture in the host tissue, by morphological remodeling. <italic>Trichinella spiralis </italic>is a typical example. Parasites buil... | [] | [] | [] | [
"<title>Conclusion</title>",
"<p>The process of nurse cell formation is complex. Many aspects of it are still unknown. The response of infected muscle cell at early stage is quite similar to that occurring in myogensis and muscle regeneration, including the activation, proliferation and differentiation of satelli... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>All authors engaged in drafting manuscript and approved the final version.</p>"
] | [
"<title>Acknowledgements</title>",
"<p>This work was supported by a Grant-in-Aid for Scientific Research (17590370) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Muscle cell regeneration: A: Normal muscle cell with myonuclei and satellite cells; B: Damaged muscle cell. Muscle injury causes inflammatory response and mononucleated cells are mobilized; C: Necrosis occurs in the damaged site. Macrophages inva... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Expression change of the genes related to apoptosis after <italic>Trichinella </italic>infection</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Gene Name</td><td align=\"left\">Description</td><td align=... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>a: Ts: <italic>Trichinella spiralis</italic>; Tp: <italic>T. pseudospiralis</italic></p><p>b: NC: no change</p><p>c: UR: no result</p></table-wrap-foot>",
"<table-wrap-foot><p>a: Ts: <italic>Trichinella spiralis</italic>; Tp: <italic>T. pseudospiralis</italic></p><p>b: NC: no change</p><p>c: ... | [
"<graphic xlink:href=\"1756-3305-1-27-1\"/>",
"<graphic xlink:href=\"1756-3305-1-27-2\"/>",
"<graphic xlink:href=\"1756-3305-1-27-3\"/>",
"<graphic xlink:href=\"1756-3305-1-27-4\"/>"
] | [] | [{"surname": ["Carlson", "Conboy"], "given-names": ["ME", "IM"], "article-title": ["egulating the Notch pathway in embryonic, adult and old stem cells"], "source": ["Curr Opin Pharmacol"], "year": ["2007"], "volume": ["7"], "fpage": ["R303"], "lpage": ["309"], "pub-id": ["10.1016/j.coph.2007.02.004"]}, {"surname": ["Ma... | {
"acronym": [],
"definition": []
} | 129 | CC BY | no | 2022-01-12 14:47:37 | Parasit Vectors. 2008 Aug 19; 1:27 | oa_package/70/98/PMC2538513.tar.gz |
PMC2538514 | 18721469 | [
"<title>Background</title>",
"<p>The spatial pattern of disease cases in an epidemic, and the apparent process of diffusion, will vary dependent on the geographic scale of investigation. Although it is commonly accepted that such geographic variation exists, a lack of suitable epidemic data at the individual case... | [
"<title>Methods</title>",
"<p>Mortality locations were extracted from the ORD, and mapped in a GIS containing georegistered Sanborn and Robinson Fire Insurance maps which had been georegistered in ArcMap 9.1 (ESRI, Redlands, CA). This georegistration was achieved by adding known coordinate locations to sections o... | [
"<title>Results</title>",
"<p>The first investigation of the French Quarter involved creating a KD surface to show the overall pattern of disease intensity. This can be seen in Figure ##FIG##1##2## where the surface has been contoured, raised 500 m above the three-dimensional rendering of the French Quarter, and ... | [
"<title>Discussion</title>",
"<p>Spatial patterns associated with the yellow fever epidemic of 1878 have been previously discussed in the literature even if not from a spatial analytical perspective. These include the spread from initial point of entry within New Orleans, the spread throughout Louisiana and then ... | [
"<title>Conclusion</title>",
"<p>The relevance of this paper to current epidemiology is in the suggestion of how to protect against a newly emerging infection, or even a bioterrror release. The traditional approach would be a combination of vaccination and cordon sanitaire. The primary rationale for this is space... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The author declares that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>AC performed all analyses and writing of this paper</p>"
] | [
"<title>Acknowledgements</title>",
"<p>The author wishes to acknowledge John Anderson a valued collaborator on the early stages of the yellow fever project. His insight into all things cartographic was and is greatly valued. The author also wishes to thank Jacqueline Mills for her editorial advise on an early ver... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Nearest Neighbor Hierarchical Clusters of Deaths For Each Month</bold>. The probability for the clusters generated by nearest neighbor hierarchical clustering (NNHC) in Figure 1 is set at 0.05, the clusters displayed being first-order stand... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Number of mortalities and density by nativity</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">Nativity or Age</td><td align=\"center\">Deaths</td><td align=\"center\">KD</td></tr></thead><tbody><tr><td ... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Table 1 displays the total number of deaths falling into each of the four cohorts during the entire epidemic, for just the French Quarter. The table also displays mortality densities (as output from a kernel density surface) for each cohort. The density of Italian mortalities (1376 per square k... | [
"<graphic xlink:href=\"1476-072X-7-47-1\"/>",
"<graphic xlink:href=\"1476-072X-7-47-2\"/>",
"<graphic xlink:href=\"1476-072X-7-47-3\"/>",
"<graphic xlink:href=\"1476-072X-7-47-4\"/>",
"<graphic xlink:href=\"1476-072X-7-47-5\"/>"
] | [] | [{"surname": ["Acha", "Szyfres"], "given-names": ["PN", "B"], "source": ["Zoonoses and Communicable Diseases Common to Man and Animals"], "year": ["1987"], "edition": ["2nd Edition"], "publisher-name": ["Washington, D.C, Pan American Health Organization"]}, {"surname": ["Speilman", "D'Antonio"], "given-names": ["A", "M... | {
"acronym": [],
"definition": []
} | 33 | CC BY | no | 2022-01-12 14:47:37 | Int J Health Geogr. 2008 Aug 22; 7:47 | oa_package/35/fb/PMC2538514.tar.gz |
PMC2538515 | 18700963 | [
"<title>Background</title>",
"<p>Surveillance of routinely collected data for unusual clusters of disease in space and time is a topic of general importance. Many epidemiologists resist community pressures to conduct cluster investigations believing they rarely provide conclusive information regarding the etiolog... | [
"<title>Methods</title>",
"<title>Study population</title>",
"<p>We investigated the association between residential history and breast cancer in upper Cape Cod, Massachusetts (USA) using data from two population-based case-control studies [##REF##7355880##2##,##REF##8215591##6##]. Participants or their next-of... | [
"<title>Results</title>",
"<title>Spatial analyses</title>",
"<p>We investigated the association between residential history since 1947 and risk of breast cancer during 1983–1993 using data from two population-based case-control studies [##REF##8215591##6##,##REF##9703477##10##]. There were a total of 1,631 par... | [
"<title>Discussion</title>",
"<p>Space-time maps allow for disease-pattern analysis of cases and controls using historical residences [##UREF##7##24##]. The GAM method visualizes breast cancer risk while adjusting for known confounders and testing for the statistical significance of location and time. Our analyse... | [
"<title>Conclusion</title>",
"<p>Spatial-temporal analysis of the breast cancer data may help identify new exposure hypotheses that warrant future epidemiologic investigations with detailed exposure models. We performed a spatial-temporal analysis of breast cancer risk during 1983–1993 that combined statistical a... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>AIC: Akaike's Information Criterion; GAM: generalized additive model; GIS: geographical information systems; ORs: odds ratios</p>",
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</t... | [
"<title>Acknowledgements</title>",
"<p>The project described was supported by grant numbers 5R03CA119703-02 from the National Cancer Institute and 5P42ES007381 from the National Institute of Environmental Health (NIEHS), NIH. Its contents are solely the responsibility of the authors and do not necessarily represe... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Geographic location of the upper Cape Cod study area</bold>. Upper Cape Cod consists of the five towns: Barnstable, Bourne, Falmouth, Mashpee, and Sandwich. Map was reproduced with permission from Environmental Health Perspectives (Paulu et... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Years of diagnosis and residential history characteristics of study participants. The analyses used data from two existing population-based case-control studies.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"l... | [
"<disp-formula id=\"bmcM1\"><label>(1)</label>logit [p()] = S() + <bold>γ'z</bold></disp-formula>"
] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Spatial-temporal analysis of breast cancer risk during 1983–1993. A movie that shows changing patterns of breast cancer risk during 1983–1993 based on participants' historical residence</p></caption></suppleme... | [] | [
"<graphic xlink:href=\"1476-072X-7-46-1\"/>",
"<graphic xlink:href=\"1476-072X-7-46-2\"/>",
"<graphic xlink:href=\"1476-072X-7-46-3\"/>",
"<graphic xlink:href=\"1476-072X-7-46-4\"/>",
"<graphic xlink:href=\"1476-072X-7-46-5\"/>",
"<graphic xlink:href=\"1476-072X-7-46-6\"/>",
"<graphic xlink:href=\"1476-... | [
"<media xlink:href=\"1476-072X-7-46-S1.wmv\" mimetype=\"video\" mime-subtype=\"x-ms-wmv\"><caption><p>Click here for file</p></caption></media>"
] | [{"surname": ["Wartenberg"], "given-names": ["D"], "article-title": ["Investigating disease clusters: Why, when, how?"], "source": ["J Royal Statist Soc A"], "year": ["2001"], "volume": ["164"], "fpage": ["13"], "lpage": ["22"], "pub-id": ["10.1111/1467-985X.00181"]}, {"surname": ["Aschengrau", "Ozonoff"], "given-names... | {
"acronym": [],
"definition": []
} | 40 | CC BY | no | 2022-01-12 14:47:37 | Int J Health Geogr. 2008 Aug 13; 7:46 | oa_package/ee/d4/PMC2538515.tar.gz |
PMC2538516 | 18775066 | [
"<title>Background</title>",
"<title>Why the genetic code originated</title>",
"<p>There are two completely different interpretations on why the genetic code might have originated. The first is obtained by means of an extreme interpretation of the stereochemical hypothesis of genetic code origin which suggests ... | [] | [
"<title>Results</title>",
"<title>The extended coevolution theory</title>",
"<p>In order to eliminate some criticisms on certain pairs of amino acids that are in an unclear precursor-product relationship [##REF##11087835##14##,##REF##11677632##16##] and, above all, to provide a more complete description of the ... | [
"<title>Discussion</title>",
"<title>Some comments on the evolution of the genetic code, as suggested by the extended coevolution theory</title>",
"<p>The evolution of the genetic code as suggested here needs some discussion and clarification.</p>",
"<p>(i) Ser is not codified by any of the GNN codons whereas... | [
"<title>Conclusion</title>",
"<p>The coevolution theory [##REF##1057181##9##] does not give a complete description of genetic code origin as it seems not to consider that the biosynthetic pathways of the amino acids that first entered the genetic code were important in the earliest phases of the origin of the cod... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Appendix</title>",
"<p>It is necessary to calculate the probability with which the amino acids Ser, Gly, Ala, Val, Asp and Glu can be observed in the GNN codons of the genetic code while also taking into account the distribution of the amino acids in the non-GNN codons. Fisher's exact test seems to be abl... | [] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Biosynthetic relationships between amino acids, as defined by their biosyntheses and their relationships with the glycolytic pathway and the citric acid cycle.</bold> The figure was taken from Taylor and Coates [##REF##2650752##11##] with a... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>The biosynthetic pathways that transform one amino acid into another when the transformation takes place on tRNAs and their phylogenetic distribution. See Sheppard et al [##REF##18279892##53##] for further information.</p></caption><table f... | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1745-6150-3-37-1\"/>",
"<graphic xlink:href=\"1745-6150-3-37-2\"/>",
"<graphic xlink:href=\"1745-6150-3-37-3\"/>",
"<graphic xlink:href=\"1745-6150-3-37-4\"/>"
] | [] | [{"surname": ["Wong", "Xue"], "given-names": ["JT", "H"], "article-title": ["Self-perfecting evolution of heteropolymer building blocks and sequences as the basis of life"], "source": ["Fundamentals of Life"], "year": ["2002"], "publisher-name": ["Editions scientifiques et medicales Elsevier SAS, Paris"], "fpage": ["55... | {
"acronym": [],
"definition": []
} | 71 | CC BY | no | 2022-01-12 14:47:37 | Biol Direct. 2008 Sep 5; 3:37 | oa_package/63/a2/PMC2538516.tar.gz |
PMC2538517 | 18715507 | [
"<title>Background</title>",
"<p>Inflammation is a prominent pathological feature of the Alzheimer's disease (AD) brain, and might be initiated by the extracellular accumulation of amyloid β (Aβ) peptide [##REF##9762518##1##]. Activated microglia and astrocytes cluster around the Aβ deposits and neurofibrillary t... | [
"<title>Methods</title>",
"<title>Genotyping</title>",
"<p>Alleles carried at <italic>BAT1 </italic>-22 (G→C) and <italic>TNFA </italic>-308 (G→A) and <italic>TNFA </italic>-850 (C→T) promoter polymorphisms was determined in 631 individuals from a population of Northern European descent (97% Caucasian). There w... | [
"<title>Results</title>",
"<p>Pearson's chi-square (χ<sup>2</sup>) and Odds ratio (OR) analysis of the <italic>BAT1 </italic>-22 1/1 and 1/2 genotypes revealed a significant association between a complete absence of the <italic>BAT1 </italic>-22*2 allele and AD (Table ##TAB##0##1##). However, this apparent level ... | [
"<title>Discussion</title>",
"<p>AD is a multifactorial disorder with a number of alterations in the immune profile occurring during disease progression in both the brain [##REF##12587940##33##] and the periphery [##REF##12505423##34##,##REF##12928049##35##]. Recently studies have reported links between risk for ... | [
"<title>Conclusion</title>",
"<p>The current study has revealed an <italic>APOE </italic>ε4 independent association of <italic>TNFA </italic>-850*2 with increased risk for AD, and an <italic>APOE </italic>ε4 independent association of <italic>BAT1 </italic>-22*2/2 with decreased risk for AD. These findings were n... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>AG has isolated RNA from AD and control brain tissue and has been drafting and writing the manuscript, has performed data analysis for the mRNA work, and has ... | [
"<title>Acknowledgements</title>",
"<p>This project was supported by the McCusker Foundation for Alzheimer's Disease Research, Edith Cowan University and Hollywood Private Hospital, Department of Veteran Affairs and the NHMRC. The authors would also like to acknowledge the excellent help in form of statistical an... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold><italic>BAT1 </italic>-22 G/C promoter polymorphism genotyping</bold>. A representation of a typical -22 C/G genotyping gel produced after digested PCR product was run on an 8% non-denaturing PAGE gel. M = Marker (100 base pair marker – arr... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Analysis of Genotype and Allele frequencies of the <italic>BAT1 </italic>-22, <italic>TNFA </italic>-308 and <italic>TNFA </italic>-850 polymorphisms</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">Mark... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Ctrl = Control cases without AD pathology</p><p>AD = Alzheimer's disease cases</p><p><sup>a </sup><italic>BAT1 </italic>-22*2/2 <italic>versus </italic>non-2/2 in AD, <italic>P </italic>< .005 (Pearson χ<sup>2 </sup>= 8.49) OR = 0.43 (95% CI = 0.24 – 0.77).</p><p><sup>b </sup><italic>TNFA </... | [
"<graphic xlink:href=\"1742-2094-5-36-1\"/>",
"<graphic xlink:href=\"1742-2094-5-36-2\"/>"
] | [] | [{"surname": ["Laws", "Taddei", "Fisher", "Small", "Clarnette", "Hallmayer", "Brooks", "Kwok", "Schofield", "Gandy", "Martins"], "given-names": ["SM", "K", "C", "D", "R", "J", "WS", "JBJ", "PR", "SE", "RN"], "article-title": ["Evidence that the butyrylcholinesterase K variant can protect against late-onset Alzheimer's ... | {
"acronym": [],
"definition": []
} | 43 | CC BY | no | 2022-01-12 14:47:37 | J Neuroinflammation. 2008 Aug 20; 5:36 | oa_package/ec/cb/PMC2538517.tar.gz |
PMC2538518 | 18755038 | [
"<title>Background</title>",
"<p>In industrialised countries otitis media (OM) is the most common paediatric illness for which medical advice is sought and antibiotics are prescribed [##REF##11163456##1##]. OM can lead to impaired hearing, which can seriously affect early language development, performance at scho... | [
"<title>Methods</title>",
"<p>Details of the methods used in the study, socioeconomic and demographic characteristics and the completeness of follow-up are described elsewhere [##REF##18173785##22##]. Briefly, between April 1999 and January 2003, children born in Kalgoorlie Regional Hospital to mothers intending ... | [
"<title>Results</title>",
"<title>Transient evoked otoacoustic emissions</title>",
"<p>180 infants (57 Aboriginal and 123 non-Aboriginal) were screened at age <1 month and 168 infants (45 Aboriginal and 123 non-Aboriginal) were screened at 1–2 months. TEOAE responses were inconclusive for 6 (11%) Aboriginal ... | [
"<title>Discussion</title>",
"<p>To our knowledge this is the first comprehensive investigation of middle ear health (which includes hearing assessment) conducted simultaneously in young indigenous and non-indigenous children living in an urban setting, although an Australia-wide study of Aboriginal and non-Abori... | [
"<title>Conclusion</title>",
"<p>In summary we have found high rates of OM in generally asymptomatic Aboriginal and non-Aboriginal children in an urban/periurban setting in a semi-arid zone of Australia, the rates being particularly high in Aboriginal children, though lower than reported in more remote settings. ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>DL established the study, designed questionnaires and supervised all aspects of the study and wrote the article for submission. PJ undertook data analysis and... | [
"<title>Acknowledgements</title>",
"<p>We thank V Verma and D Hill for audiologic assessments and Drs K Taylor and MP Alpers for helpful comments on the manuscript. The Eastern Goldfields Division of General Practice, the midwives at Kalgoorlie Regional Hospital, G Stokes and his family, and J Doyle, Goldfields S... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Proportion of Aboriginal and non-Aboriginal children with TEOAE responses present in both ears at ages <1 month and 1–2 months.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Age-specific prevalen... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Classification of tympanograms in Aboriginal and non-Aboriginal children by age during routine follow-up by research assistants in the field or by audiologists at routine ENT follow-up.</p></caption><table frame=\"hsides\" rules=\"groups\">... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Note: During the first year of study, children were seen by the visiting ENT specialist or by an audiologist who was resident in Kalgoorlie and examined children at time of field follow-up. Thereafter, children were to be seen routinely by an ENT 3 times before age 2 years.</p></table-wrap-foot... | [
"<graphic xlink:href=\"1471-2431-8-32-1\"/>",
"<graphic xlink:href=\"1471-2431-8-32-2\"/>",
"<graphic xlink:href=\"1471-2431-8-32-3\"/>"
] | [] | [{"surname": ["Daly", "Roberts JE, Wallace IF, Henderson FW"], "given-names": ["KA"], "article-title": ["Definition and epidemiology of otitis media"], "source": ["Otitis Media in Young Children"], "year": ["1997"], "publisher-name": ["Baltimore , Paul H. Brookes Publishing Co."], "fpage": ["3"], "lpage": ["41"]}, {"su... | {
"acronym": [],
"definition": []
} | 35 | CC BY | no | 2022-01-12 14:47:37 | BMC Pediatr. 2008 Aug 28; 8:32 | oa_package/f8/e3/PMC2538518.tar.gz |
PMC2538519 | 18764939 | [
"<title>Background</title>",
"<p>Processing of Amyloid Precursor Protein (APP) by β- and γ-secretase produces Aβ peptides and APP IntraCellular Domain [##REF##16930452##1##,##REF##12142353##2##], the former being the major component of AD amyloid plaques. Recent evidence indicates that AID is a biologically activ... | [
"<title>Materials and methods</title>",
"<title>Construction of the transgenic plasmid</title>",
"<p>The cDNA sequence corresponding to human AID 50, 57 or 59 was subcloned into BamHI-XhoI sites of pHY12 vector, which bears SV40 polyA signal. A NotI-NotI fragment, comprising the transgene, was then cloned into ... | [
"<title>Results</title>",
"<title>Generation of AID transgenic animals</title>",
"<p>To directly examine the effects of AID in vivo, and in the brain, we generated transgenic mice expressing AID under the control of the CaMKIIα promoter, targeting its expression to the forebrain regions (which comprise the thal... | [
"<title>Discussion and Conclusion</title>",
"<p>The findings that AID might regulate apoptosis and Ca++ flux were met with some skepticism. On the contrary, hints to a transcriptional role of AID generated great enthusiasm given the parallel with Notch signaling. Several reports have pointed to few possible AID t... | [
"<title>Discussion and Conclusion</title>",
"<p>The findings that AID might regulate apoptosis and Ca++ flux were met with some skepticism. On the contrary, hints to a transcriptional role of AID generated great enthusiasm given the parallel with Notch signaling. Several reports have pointed to few possible AID t... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>LG participated in the design of the study, handled the mice colony and genotyping, designed the experiments, performed most of the experiments and cultures, ... | [
"<title>Acknowledgements</title>",
"<p>This work was supported in part by Alzheimer Disease Research Grant A2003-076; National Institutes of Health Grants RO1 AG22024 and RO1 AG21588, the CARISA Foundation, the MIUR and the Regione Piemonte.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Characterization of AID transgenic mice</bold>. <bold>A </bold>Schematic representation of the transgenic AID constructs (fragments are not depicted in scale). The location of the PCR primers a and b used for genotyping is shown. <bold>B </... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1750-1326-3-12-1\"/>",
"<graphic xlink:href=\"1750-1326-3-12-2\"/>",
"<graphic xlink:href=\"1750-1326-3-12-3\"/>",
"<graphic xlink:href=\"1750-1326-3-12-4\"/>",
"<graphic xlink:href=\"1750-1326-3-12-5\"/>"
] | [] | [] | {
"acronym": [],
"definition": []
} | 29 | CC BY | no | 2022-01-12 14:47:37 | Mol Neurodegener. 2008 Sep 2; 3:12 | oa_package/93/1b/PMC2538519.tar.gz |
PMC2538520 | 18761749 | [
"<title>Background</title>",
"<p>The Chronic Care Model is a conceptual framework that supports the evidence-based proactive and planned care for chronic diseases [##UREF##0##1##,##REF##12132606##2##]. It has received widespread acceptance as a framework for improving the care of chronically ill patients. Measure... | [
"<title>Methods</title>",
"<title>Design and setting</title>",
"<p>An observational study was performed in randomly sampled patients from four general practices, which were situated in a rural area in the south-eastern part of The Netherlands. Two practices were single-handed and two practices were group practi... | [
"<title>Results</title>",
"<p>In total, we received completed questionnaires from 165 patients: 88 diabetes patients (response rate 73%) and 77 COPD patients (70%). Table ##TAB##0##1## provides descriptive information on the patient samples. The patients' mean age was 68 years); only a minority had medium or high... | [
"<title>Discussion</title>",
"<p>This study showed that the Dutch version of the PACIC instrument had mixed measurement properties when applied for assessing diabetes care and COPD care in general practice in a rural setting. The five previously defined domains were confirmed and their internal consistency was go... | [
"<title>Conclusion</title>",
"<p>A validated Dutch version of the PACIC instrument is now available. Further research into its validity is recommended, particularly with respect to the high number of non-responders and the counterintuitive finding regarding patient enablement. Also, the questionnaire needs to be ... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>MW initiated, designed and coordinated the study, carried out data-analysis and wrote the manuscript. JvL contributed to the development of the Dutch version ... | [
"<title>Acknowledgements</title>",
"<p>We thank the participating patients and practices.</p>"
] | [] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Patient characteristics (n = 165)</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"left\">Total population<break/></td><td align=\"left\">Diabetes patients <break/>(n = 88)</td><td align=\"left\">COPD patien... | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Dutch version of the PACIC. The PACIC questionnaire in Dutch language, which we have used in our study.</p></caption></supplementary-material>"
] | [
"<table-wrap-foot><p>* P < 0.05 of difference between diabetes patients and COPD patients.</p></table-wrap-foot>"
] | [] | [
"<media xlink:href=\"1472-6963-8-182-S1.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>"
] | [{"surname": ["Wagner", "Austin", "Von Korff"], "given-names": ["EH", "BT", "M"], "article-title": ["Organizing care for patients with chronic illness"], "source": ["Milb Quat"], "year": ["1996"], "volume": ["34"], "fpage": ["511"], "lpage": ["544"], "pub-id": ["10.2307/3350391"]}, {"surname": ["Kim", "Mueller"], "give... | {
"acronym": [],
"definition": []
} | 9 | CC BY | no | 2022-01-12 14:47:37 | BMC Health Serv Res. 2008 Sep 1; 8:182 | oa_package/e6/9f/PMC2538520.tar.gz |
PMC2538521 | 18691428 | [
"<title>Background</title>",
"<p>There is an increasing trend in the utilization of complementary or alternative medicine (CAM) worldwide [##REF##8688771##1##]. According to the estimation of the World Health Organization, the usage of CAM ranges from 9 to 65% in different countries [##REF##10743298##2##]. In the... | [
"<title>Methods</title>",
"<title>Data Resource</title>",
"<p>Since all citizens in Taiwan who have established a registered domicile should be enrolled in the NHI Program, the NHI Bureau has accumulated 23.75 million administrative and claims records, forming the largest such collection in the world. The NHI r... | [
"<title>Results</title>",
"<p>Table ##TAB##0##1## shows the demographic characteristics of the studied cohort. Adjusted ORs and 95% confidence intervals (95% CIs) resulting from the logistic regression model are displayed in Table ##TAB##1##2##. The odds of using CM (OR 1.48) and WM (OR 1.74) were higher for fema... | [
"<title>Discussion</title>",
"<p>In this study, the logistic regression method was used to identify patient characteristics associated with the utilization patterns of CM and WM over time. Females used both health care services more than males. The higher utilization of CM in females has also been reported in Sin... | [
"<title>Conclusion</title>",
"<p>The utilization of CAM has rapidly increased in many countries during the last two decades [##REF##9820257##4##, ####REF##8038643##5##, ##REF##9260354##6##, ##REF##8596318##7####8596318##7##]. CAM is rarely covered in national health systems. However, 75% of the Dutch population w... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>LCC, NH, YJC, CHL and YTH contributed equally to this paper. FYK carried out the analysis. LCC, NH, YJC, CHL, FYK and HYT pictured the idea and drafted the ma... | [
"<title>Acknowledgements</title>",
"<p>This study is based on the data from the National Health Insurance Research Database provided by the Bureau of National Health Insurance and managed by the National Health Research Institutes in Taiwan. The interpretations and conclusions do not represent those of Bureau of ... | [] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Demographic characteristics of the studied cohort (<italic>n </italic>= 136,720)</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Characteristic*</td><td align=\"center\">No. of subjects</td><td align=\"ce... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>*Determined from 1997 prospectively.</p></table-wrap-foot>",
"<table-wrap-foot><p>*Odds ratio (95% confidence interval).</p></table-wrap-foot>",
"<table-wrap-foot><p>*%.</p></table-wrap-foot>",
"<table-wrap-foot><p>*More than one component may be provided in each visit.</p></table-wrap-fo... | [] | [] | [{"surname": ["Lim", "Sadarangani", "Chan", "Heng"], "given-names": ["MK", "P", "HL", "JY"], "article-title": ["Complementary and alternative medicine use in multiracial Singapore"], "source": ["Compl Therap Med"], "year": ["2005"], "volume": ["13"], "fpage": ["16"], "lpage": ["24"], "pub-id": ["10.1016/j.ctim.2004.11.... | {
"acronym": [],
"definition": []
} | 46 | CC BY | no | 2022-01-12 14:47:37 | BMC Health Serv Res. 2008 Aug 9; 8:170 | oa_package/36/25/PMC2538521.tar.gz |
PMC2538522 | 18700041 | [
"<title>Introduction</title>",
"<p>Cystic adventitial disease (CyAD) is a rare non-atherosclerotic condition which results in intermittent claudication due to peripheral vascular insufficiency caused by compression of the arterial lumen by a cystic collection of mucinous material containing varying combination of... | [] | [] | [
"<title>Discussion</title>",
"<p>The most common non-atherosclerotic diseases of the popliteal artery include thrombosed aneurysm, embolism, entrapment syndrome, and CyAD [##REF##8281006##4##]. The incidence of CyAD is estimated to be 1 in 1200 cases of claudication [##REF##426549##1##], with cases described invo... | [
"<title>Conclusion</title>",
"<p>Utilizing various high resolution image acquisition sequences in multiple orientations combined with CE-MRA at 3T, CMR has an important role for non-invasive morphological assessment, tissue characterization, and vascular evaluation in cystic adventitial disease.</p>"
] | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Case report</title>",
"<p>A 26-year old male presented with a 15-month history of progressive right calf intermittent claudication which was more severe on stairs. The maximum walking distance was approximately 50 meters at the time of presentation. The patient had no risk factors for vascular disease suc... | [] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Axial T2-weighted fat saturated turbo spin echo images demonstrate a well defined, homogeneously hyper-intense multi-lobulated cystic lesion in the right popliteal fossa (Figure 1a and 1b, arrows).</p></caption></fig>",
"<fig position=\"float\"... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Imaging Sequences and Parameters for Cardiovascular Magnetic Resonance</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Pulse sequence</bold></td><td align=\"center\"><bold>TE (msec)</bold></td><td a... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>*Generalized Autocalibrating Partially Parallel Acquisition or GRAPPA factor of 4 was applied. CE-MRA was performed following intravenous administration of 15 mL of contrast (Magnevist, Berlex Laboratories, Wayne, New Jersey, USA) at the rate of 1.2 mL/second followed by 30 mL of saline at the ... | [
"<graphic xlink:href=\"1532-429X-10-38-1\"/>",
"<graphic xlink:href=\"1532-429X-10-38-2\"/>",
"<graphic xlink:href=\"1532-429X-10-38-3\"/>",
"<graphic xlink:href=\"1532-429X-10-38-4\"/>"
] | [] | [{"surname": ["Lewis", "Douglas", "Reid", "Kennedy J"], "given-names": ["GJT", "DM", "W", "Watt"], "article-title": ["Cystic adventitial disease of the popliteal artery"], "source": ["Br Med J"], "year": ["1967"], "volume": ["3"], "fpage": ["411"], "lpage": ["415"]}] | {
"acronym": [],
"definition": []
} | 12 | CC BY | no | 2022-01-12 14:47:37 | J Cardiovasc Magn Reson. 2008 Aug 13; 10(1):38 | oa_package/90/1e/PMC2538522.tar.gz |
PMC2538523 | 18759965 | [
"<title>Introduction</title>",
"<p>Breast cancer is one of the leading causes of death in women worldwide. BRCA1 (MIM113705) is a high risk-associated gene responsible for breast cancer of both hereditary and sporadic origin. Although several studies around the world and few studies in Pakistan, have emphasized t... | [
"<title>Methods</title>",
"<p>Breast cancer patients were determined from various hospitals and Nuclear Medicine Institute(s) from January 2006 – March 2007. Peripheral blood samples were collected from Nuclear and Oncology Institutes all over the country. Ethical approval was obtained from the respective researc... | [
"<title>Results and discussion</title>",
"<p>After extensive screening, five samples were found positive showing an altered mobility shift on the exon 13 of BRCA1. No mutation was detected with respect to exon 2 and 3 of BRCA1 gene. Sequencing reveals an evidence of mis-sense variation on 1435 amino acid Ser. of ... | [
"<title>Results and discussion</title>",
"<p>After extensive screening, five samples were found positive showing an altered mobility shift on the exon 13 of BRCA1. No mutation was detected with respect to exon 2 and 3 of BRCA1 gene. Sequencing reveals an evidence of mis-sense variation on 1435 amino acid Ser. of ... | [
"<title>Conclusion</title>",
"<p>The continuing uncertainty as to the exact penetrance for breast cancer among BRCA1 mutation carriers may be due to several factors including differences owing to study design, allelic heterogeneity and to modifying genetic and or environmental factors. Pakistani population, altho... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>FAM performed laboratory tests and prepared the manuscript; SA, IAB, AM, MA and RS contributed clinical samples and clinical information; MAK and WGJ participated in study design, coordination and manuscript preparation.</p>"
] | [
"<title>Acknowledgements</title>",
"<p>We are extremely thankful to all those patients who took part in this study and want to extend our immense gratitude for the above mentioned institutes for their friendly response and support in this research. Funding approved by COMSATS Institute of information Technology f... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Graphical display of the number of participants from the four provinces.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Germline mutation of exon-13 of BRCA1 with splice site deletion.</bold><u... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Information on source of patients from the participating institutes</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\">Basic Characteristics of cases and Controls</td><td align=\"center\">Breast Cases (%)<... | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1477-7800-5-21-1\"/>",
"<graphic xlink:href=\"1477-7800-5-21-2\"/>"
] | [] | [{"surname": ["Anderson", "Tian-Wei", "Malgorzata", "Dobrzy\u00f1ska", "Ribas", "Marcos"], "given-names": ["D", "Y", "M", "G", "R"], "article-title": ["Effects in the comet assay of storage conditions on human blood"], "source": ["Teratogenesis Carcinogenesis and Mutagenesis"], "year": ["1997"], "volume": ["17"], "fpag... | {
"acronym": [],
"definition": []
} | 28 | CC BY | no | 2022-01-12 14:47:37 | Int Semin Surg Oncol. 2008 Aug 29; 5:21 | oa_package/4b/fc/PMC2538523.tar.gz |
PMC2538524 | 18759966 | [
"<title>Introduction</title>",
"<p>The chiropractic profession has been in existence for over 110 years. In that time it has overcome a variety of hardships and adversities, including practitioners being jailed for practicing medicine without a license, attempts by the American Medical Association to contain and ... | [] | [] | [] | [
"<title>Conclusion</title>",
"<p>Reform of the chiropractic profession is long overdue. We need to make dramatic changes in the profession if we are to advance ourselves in the direction of becoming a credible, respected and widely utilized profession. Many mistakes were made in the past that prevented us from ma... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>Each of the authors makes his living practicing, teaching, administrating or studying chiropractic medicine (or some combination of these activities) and thus has a financial interest in the success of the profession.</p>",
"<title>Authors' contributions</title>",
"<p... | [] | [] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Examples of activities of chiropractors within the American Public Health Association (APHA)</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">1. Chiropractic members of the APHA conducted a session on immu... | [] | [] | [] | [] | [] | [] | [] | [] | [] | [{"surname": ["Wardwell"], "given-names": ["WI"], "source": ["Chiropractic - History and Evolution of a New Profession"], "year": ["1992"], "publisher-name": ["St. Louis , Mosby Year-Book"]}, {"article-title": ["Gallup poll: Americans have low opinion of chiropractors' honesty and ethics"], "source": ["Dynam Chiropr"],... | {
"acronym": [],
"definition": []
} | 47 | CC BY | no | 2022-01-12 14:47:37 | Chiropr Osteopat. 2008 Aug 29; 16:10 | oa_package/41/e4/PMC2538524.tar.gz |
PMC2538525 | 18694490 | [
"<title>Background</title>",
"<p>Accurate diagnosis or classification of patients with spinal pain has been identified as a research priority [##REF##11880849##1##]. We presented in Part 1 the theoretical model of an approach to diagnosis in patients with spinal pain [##REF##17683556##2##]. This approach incorpor... | [
"<title>Methods</title>",
"<title>Literature search and selection</title>",
"<p>The following databases were searched up to December 22, 2006: Medline, Cinahl, Embase and MANTIS. Searches of the authors' own libraries were also conducted. Finally, citation searches of relevant articles and texts were conducted ... | [
"<title>Results</title>",
"<p>The search strategy identified 1769 articles, and of these, 138 were deemed relevant. Additional files ##SUPPL##0##1## and ##SUPPL##1##2## provide a breakdown of the number of studies in each area of consideration. Additional files ##SUPPL##2##3## and ##SUPPL##3##4## present the data... | [] | [] | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Summary</title>",
"<p>In a previous paper the authors presented the conceptual model of a novel approach to the diagnosis and treatment of patients with spinal pain. The specific components of the diagnostic model were described and the decision making process based on the diagnostic approach were discuss... | [
"<title>Acknowledgements</title>",
"<p>The authors would like to thank Tovah Reis of the Brown University library and Mary Ott of the New York Chiropractic College library for help with information gathering.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Diagnostic algorithm for the application of the DBCDR</bold>.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Management algorithm for the application of the DBCDR.</p></caption></fig>"
] | [] | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Table 1. Number of studies identified that address factors related to question number 2.</p></caption></supplementary-material>",
"<supplementary-material content-type=\"local-data\" id=\"S2\"><caption><titl... | [] | [
"<graphic xlink:href=\"1746-1340-16-7-1\"/>",
"<graphic xlink:href=\"1746-1340-16-7-2\"/>"
] | [
"<media xlink:href=\"1746-1340-16-7-S1.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1746-1340-16-7-S2.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>",
"<media xlin... | [{"surname": ["Bigos", "Bowyer", "Braen"], "given-names": ["S", "O", "G"], "suffix": ["Brown K, Deyo R, Haldeman S"], "article-title": [" Acute Low Back Problems in Adults Clinical Practice Guideline Number 14 AHCPR Pub No 95-0642 Rockville, MD Agency for Health Care Policy and Research, Public Health Service, US Depa... | {
"acronym": [],
"definition": []
} | 142 | CC BY | no | 2022-01-12 14:47:37 | Chiropr Osteopat. 2008 Aug 11; 16:7 | oa_package/49/60/PMC2538525.tar.gz |
PMC2538526 | 18778467 | [
"<title>Background</title>",
"<p>With an ageing population, the prevalence of chronic disease is increasing. Osteoarthritis of the knee is a widespread chronic condition and one of the most common causes of musculoskeletal disability [##REF##11030685##1##]. Complementary to conventional medical care, self-managem... | [
"<title>Methods</title>",
"<p>This case series quality assurance project was conducted within the clinical services provided at Arthritis Western Australia. Public awareness of the programs offered by Arthritis WA is often generated via General Practitioner referral or suggestion from friends or family. Programs ... | [
"<title>Results</title>",
"<p>141 people expressed interest in the OAK program. Recruitment for the project was discontinued when 8 groups of eligible participants (19 men, 60 women, mean (SD) age 66 (9) had enrolled in the program. Of these, 68 participants completed the program and returned for all the follow-u... | [
"<title>Discussion</title>",
"<p>This SM program differs from others as the intervention is specific not only to their pathology (OA), but also to the joint affected (knee). Health professionals use their expertise to deliver information and education covering a wide spectrum of topics, while utilising the constr... | [
"<title>Conclusion</title>",
"<p>Improvements in pain, health status and physical function were observed in response to our SM education program specifically designed for people with OA knee, delivered by health professionals. Health professionals providing the program enabled inclusion of disease specific conten... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>SM: self-management; OAK: osteoarthritis of the knee; OA: osteoarthritis; HP: health professional; QA: quality assurance; WOMAC: Western Ontario and McMaster Universities Osteoarthritis Index; VAS: visual analogue scale; CI: confidence interval; ASMP: Arthritis Self-Management ... | [
"<title>Acknowledgements</title>",
"<p>Arthritis Foundation of WA and the Department of Health Western Australia for funding for the OAK program.</p>",
"<p>Jessica Rose for assistance with editing.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Flow chart time-points with number of participants attending</bold>. Baseline to week 8 (intervention), 6 months and 12 months (follow-up assessments)</p></caption></fig>"
] | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Characteristics of participants enrolled in OAK program</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Gender (F:M)</bold></td><td align=\"center\"><bold>60:19</bold></td></tr><tr><td align=\"left\... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>*Percentage adds > 100 as some participants have more than one coexisting disease</p></table-wrap-foot>",
"<table-wrap-foot><p>Values are mean (SE). Lower scores indicate improvement; F-values and p-values are for repeated measures ANOVA. Change at 12 months values are mean (95% CI). Effec... | [
"<graphic xlink:href=\"1471-2474-9-117-1\"/>"
] | [] | [{"surname": ["Lorig", "Mazonson", "Holman"], "given-names": ["K", "P", "H"], "article-title": ["Evidence suggesting that health education for self-management in patients with chronic arthritis has sustained health benefits while reducing health care costs"], "source": ["Arthritis and Rheumatism"], "year": ["1993"], "v... | {
"acronym": [],
"definition": []
} | 37 | CC BY | no | 2022-01-12 14:47:38 | BMC Musculoskelet Disord. 2008 Sep 8; 9:117 | oa_package/09/f1/PMC2538526.tar.gz |
PMC2538527 | 18752669 | [
"<title>Background</title>",
"<p>Interferons (IFNs) are cytokines with major therapeutic applications based on their antiviral, antiproliferative, and immunomodulatory activities. Type I IFNs (IFNα/β) are massively produced in most cell types in response to viral and other microbial infections, and play a vital r... | [
"<title>Methods</title>",
"<title>Material</title>",
"<p>The expression plasmid was purified with a maxi-prep plasmid purification kit (Qiagen, Mississauga, ON, Canada). F17 serum-free culture media and blasticidin were obtained from Invitrogen (Carlsbad, CA). Pluronic F68 and glutamine were from Sigma-Aldrich ... | [
"<title>Results</title>",
"<title>Generation of a stable IFNα2b-expressing HEK293 cell clone and production in fed-batch cultures</title>",
"<p>The expression plasmid pYD7 encoding the human IFNα2b gene codon-optimized for expression in human cells (Fig. ##FIG##0##1A##) is derived from the previously described ... | [
"<title>Discussion</title>",
"<p>We describe here the generation of a HEK293 cell clone (D9) able to stably produce glycosylated human recombinant IFNα2b for culture periods up to 4 months in the absence of selection. The volumetric production per litre of serum-free culture can reach more than 300 mg/L, and is t... | [
"<title>Conclusion</title>",
"<p>While additional studies are needed to determine whether HEK293-produced IFNα2b can offer advantages over non-glycosylated or pegylated IFN for <italic>in vivo </italic>applications, this work demonstrates that the HEK293 cell line is a suitable host for the high volumetric produc... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Abbreviations</title>",
"<p>EBV: Epstein Barr Virus; ESI: electrospray ionization; ETD: electron transfer dissociation; HEK: human embryonic kidney; IFNα2b: interferon alpha2b; PBS: phosphate buffered saline; SEAP: secreted alkaline phosphatase.</p>",
"<title>Authors' contributions</title>",
"<p>ML pe... | [
"<title>Acknowledgements</title>",
"<p>We thank France Dumas for N-terminal sequencing of IFNα2b, Alain Drouin, Wen Ding and Luc Tessier for their technical assistance with the mass spectrometry analysis and Phuong Lan Pham for insightful discussion.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Expression plasmid encoding human IFNα2b cDNA</bold>. <bold>A) </bold>The pYD7-IFNα2b expression plasmid has been used to generate the D9 clone. (Amp) ampicillin, (Blast) blasticidin, (CMV) cytomegalovirus promoter, (enh MLP) adenovirus maj... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Quantification and recovery of HEK293-produced IFNα2b from two production schemes.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"center\"><bold>Production scheme</bold></td><td align=\"center\" colspan=\"2\"><... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>* IFNα2b activity has been determined by inhibition of viral replication. Different viruses and hosts were used.</p></table-wrap-foot>",
"<table-wrap-foot><p>IFNα2b activity has been determined by inhibition of viral replication of vesicular stomatitis virus (VSV) in Madin Darby bovine kidney... | [
"<graphic xlink:href=\"1472-6750-8-65-1\"/>",
"<graphic xlink:href=\"1472-6750-8-65-2\"/>",
"<graphic xlink:href=\"1472-6750-8-65-3\"/>",
"<graphic xlink:href=\"1472-6750-8-65-4\"/>",
"<graphic xlink:href=\"1472-6750-8-65-5\"/>",
"<graphic xlink:href=\"1472-6750-8-65-6\"/>",
"<graphic xlink:href=\"1472-... | [] | [] | {
"acronym": [],
"definition": []
} | 58 | CC BY | no | 2022-01-12 14:47:38 | BMC Biotechnol. 2008 Aug 27; 8:65 | oa_package/a8/a0/PMC2538527.tar.gz |
PMC2538528 | 18691430 | [
"<title>Background</title>",
"<p>Integration of foreign DNA plays a pivotal role in genetic engineering, animal transgenesis, and therapeutic gene transfer. Lentiviral vectors (LV) efficiently insert genetic cargo in both dividing and non-dividing cells and have attracted, therefore, major attention as a gene tra... | [
"<title>Methods</title>",
"<title>Vector construction</title>",
"<p>The HIV-1-derived Flp substrate vector, pLV/FRT-hygro, was generated by replacing the eGFP gene (BamHI/XhoI digestion) of the third generation SIN-vector pCCL.WPS.PGK-eGFP.WHV (a kind gift from Dr. Patrick Aebischer, Swiss Federal Institute of ... | [
"<title>Results and Discussion</title>",
"<p>To provide proof-of-principle that <italic>trans</italic>-acting nonviral recombinases are able to gain access to lentivirally delivered substrates and facilitate their insertion, we designed an LV-derived hybrid integration system based upon the integrating properties... | [
"<title>Results and Discussion</title>",
"<p>To provide proof-of-principle that <italic>trans</italic>-acting nonviral recombinases are able to gain access to lentivirally delivered substrates and facilitate their insertion, we designed an LV-derived hybrid integration system based upon the integrating properties... | [
"<title>Conclusion</title>",
"<p>Site-specific integration systems as Cre and Flp are important tools in genetic engineering and animal transgenesis but can in some instances be hampered by the requirement for transfection of plasmid DNA. Lentiviral vectors efficiently transduce both proliferating and quiescent c... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>BM, NHS, and JGM conceived and designed the experiments and the hybrid vector constructs. RJYM assisted during development of the experimental design. All vectors were constructed by BM. Cell culture analyses were performed by BM, and molecular analyses were carried ou... | [
"<title>Acknowledgements</title>",
"<p>We thank Finn Skou Pedersen (Department of Molecular Biology, University of Aarhus, Aarhus, Denmark) for providing pecoenv-IRES-puro, Adrian Thrasher (Institute of Child Health, University College London, London, UK) for providing pMDLg/pRREintD64V, and Patrick Aebischer (Sw... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Strategy for Flp-directed integration of lentiviral DNA circles. (<bold>A) </bold>Schematic representation of vectors utilized for lentiviral transduction and generation of Sleeping Beauty vector-tagged cell lines. The lentiviral vector, pLV/FRT-... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1472-6750-8-60-1\"/>",
"<graphic xlink:href=\"1472-6750-8-60-2\"/>",
"<graphic xlink:href=\"1472-6750-8-60-3\"/>",
"<graphic xlink:href=\"1472-6750-8-60-4\"/>"
] | [] | [] | {
"acronym": [],
"definition": []
} | 21 | CC BY | no | 2022-01-12 14:47:38 | BMC Biotechnol. 2008 Aug 9; 8:60 | oa_package/2f/f2/PMC2538528.tar.gz |
PMC2538529 | 18700989 | [
"<title>Background</title>",
"<p>Small supernumerary marker chromosomes occur in 0.075% of unselected prenatal cases and in 0.044% of consecutively studied postnatal cases, and majority of them are <italic>de novo </italic>in origin [##REF##17901697##1##, ####REF##3857214##2##, ##REF##9482642##3##, ##REF##1550801... | [
"<title>Methods</title>",
"<title>Cytogenetic and fish studies</title>",
"<p>Cytogenetic study was carried out on peripheral blood lymphocytes by G-banding according to the standard procedures [##UREF##4##20##], and 50 G-banded metaphases were analyzed. FISH study was undertaken using all chromosome specific su... | [
"<title>Results</title>",
"<p>Cytogenetic study by Giemsa banding (G-banding) showed normal 46,XX chromosomes in all the 50 lymphocyte cells and 47,XX,+mar in all the 70 skin fibroblast cells studied (Fig. ##FIG##0##1a##). The marker chromosome was constitutive heterochromatin band (C-band) and nucleolar organize... | [
"<title>Discussion</title>",
"<p>Supernumerary marker chromosomes are a cause of great concern and pose huge challenge in routine medical practice, particularly in genetic diagnosis and counseling. Precise identification and complete characterization of the marker chromosome is very important to understand the un... | [] | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Case presentation</title>",
"<p>A one month old female child presenting with several dysmorphic features was referred to us for cytogenetic studies. She was the second child of unrelated parents. The first child was normal. The pregnancy and delivery at term were normal. Birth weight was 2.2 Kg, length 45... | [
"<title>Acknowledgements</title>",
"<p>We acknowledge the Department of Health and Medical Services (DOHMS), Dubai and Center for Arab Genomic studies (CAGS), Dubai for supporting the work.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>a) Partial G-banded metaphase from skin fibroblast cell showing the marker chromosome (arrow). b) Supernumerary marker chromosome showing no hybridization with human alpha-satellite Pan-centromeric probe (Cambio). (c) Chromosome 3 specific subtel... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Karyotype and clinical presentation of individuals reported with a supernumerary analphoid inversion-duplication 3q marker chromosome</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Case no.</td><td align... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>(PBL = peripheral blood lymphocyte culture)</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1755-8166-1-19-1\"/>",
"<graphic xlink:href=\"1755-8166-1-19-2\"/>"
] | [] | [{"surname": ["Dennis", "Veltman", "Thompson", "Craig", "Bolton", "Thomas"], "given-names": ["NR", "MW", "R", "E", "PF", "NS"], "article-title": ["Clinical findings in 33 subjects with large supernumerary marker(15) chromosomes and 3 subjects with triplication of 15q11-q13"], "source": ["Am J Med Genet"], "year": ["200... | {
"acronym": [],
"definition": []
} | 21 | CC BY | no | 2022-01-12 14:47:38 | Mol Cytogenet. 2008 Aug 14; 1:19 | oa_package/31/9a/PMC2538529.tar.gz |
PMC2538530 | 18764944 | [
"<title>Background</title>",
"<p>Kaposi sarcoma (KS) is a low-grade vascular neoplasm associated with Human Herpesvirus-8 (HHV8) infection. There are four clinical-epidemiological types, including African (endemic) KS, AIDS-associated (epidemic) KS, classic KS, and transplant-associated (iatrogenic) KS. KS is a m... | [] | [] | [
"<title>Discussion</title>",
"<p>This report represents the first documented case of isolated KS manifesting primarily in the soft tissue of the thigh. Lee et al reported a case describing a subcutaneous AIDS-KS tumor in a 58-year-old HIV seropositive man that presented initially with KS skin nodules over his low... | [
"<title>Conclusion</title>",
"<p>We present the first documented case of primary subcutaneous KS occurring in the setting of AIDS. The differential diagnosis of an isolated subcutaneous soft tissue tumor in an HIV-infected individual is broad, and requires imaging evaluation and a definitive pathological diagnosi... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Case presentation</title>",
"<p>A 43-year-old homosexual man who was HIV positive for 18 years presented with a one-year history of a slowly enlarging mass in the proximal left anterior thigh. He described stabbing pain, often experiencing sharp shooting pains down the left thigh. He had been on and off a... | [
"<title>Acknowledgements</title>",
"<p>Written consent was obtained from the patient for publication of this case report.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>MRI shows a solid, vascular enhancing subcutaneous thigh mass with spiculated margins.</bold>(see arrow)</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p><bold>Core needle biopsy of Kaposi sarcom... | [] | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1477-7819-6-94-1\"/>",
"<graphic xlink:href=\"1477-7819-6-94-2\"/>",
"<graphic xlink:href=\"1477-7819-6-94-3\"/>"
] | [] | [] | {
"acronym": [],
"definition": []
} | 17 | CC BY | no | 2022-01-12 14:47:38 | World J Surg Oncol. 2008 Sep 2; 6:94 | oa_package/7e/43/PMC2538530.tar.gz |
PMC2538533 | 18727824 | [
"<title>Introduction</title>",
"<p>In the past, when unpurified insulins were used, allergic reactions to the drug were reported in 10% to 56% of patients [##UREF##0##1##]. Since human insulin and its analogues have been introduced, insulin allergies are rare and currently reported in only 0.1% to 2% of all patie... | [] | [] | [
"<title>Discussion</title>",
"<p>Successful treatment of allergies due to insulin preparations has been reported during the last few years. In cases of hypersensitivity against protamine, the replacement of protamine-containing insulins by insulins without this additive is the simplest strategy to solve the probl... | [
"<title>Conclusion</title>",
"<p>We would like to recommend insulin desensitization using an ultra-rush protocol with subcutaneous insulin applications as a rapid and easy method of treatment, even in cases in which intracutaneous testing is positive for several or all insulin preparations on-hand.</p>"
] | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Case presentation</title>",
"<p>We evaluated a 68-year-old man in our dermatologic outpatient unit. He suffered from type 2 diabetes and was initially treated with oral anti-diabetic medication. As normoglycaemia was not being achieved using maximal oral treatment and a low caloric diet, the patient was t... | [
"<title/>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>Intradermal testing showing positive reactions against <italic>Levemir<sup>© </sup>(1), Huminsulin basal<sup>© </sup>(2), Humalog<sup>© </sup>(3)</italic>, and <italic>Lantus<sup>© </sup></italic>(4) 20 minutes after injection</bold>. Hista... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Substances used in intradermal testing</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td/><td align=\"left\"><bold>Substance</bold></td><td align=\"left\"><bold>20 minutes</bold></td><td align=\"left\"><bold>24 hours</bol... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>Test solutions A-J were obtained from the Sanofi Aventis Insuman<sup>© </sup>test kit. Test results were noted 20 minutes, 24 hours, and 48 hours after injection. Interpretation of test results: -, no skin reaction; +, erythema and infiltrate with a diameter of <20 mm; ++, erythema and infil... | [
"<graphic xlink:href=\"1752-1947-2-283-1\"/>",
"<graphic xlink:href=\"1752-1947-2-283-2\"/>",
"<graphic xlink:href=\"1752-1947-2-283-3\"/>"
] | [] | [{"surname": ["Liebermann"], "given-names": ["P"], "article-title": ["Allergic reactions to insulin"], "source": ["J Am Med Assoc"], "year": ["1971"], "volume": ["215"], "fpage": ["1106"], "lpage": ["1112"], "pub-id": ["10.1001/jama.215.7.1106"]}, {"surname": ["Moyes"], "given-names": ["V"], "article-title": ["Insulin ... | {
"acronym": [],
"definition": []
} | 19 | CC BY | no | 2022-01-12 14:47:38 | J Med Case Reports. 2008 Aug 26; 2:283 | oa_package/f7/e5/PMC2538533.tar.gz |
PMC2538534 | 18700978 | [
"<title>Background</title>",
"<p>The flavonoid biosynthesis pathway is central to the formation of the phenolic compounds involved in many plant traits, including resistance to abiotic and biotic stresses [##UREF##0##1##, ####UREF##1##2##, ##REF##11724379##3##, ##UREF##2##4####2##4##]. One branch of the pathway i... | [
"<title>Methods</title>",
"<title>Plant materials and RNA extraction</title>",
"<p>The bread wheat cultivars 'Chinese Spring', 'Opata', 'Flair', 'Prinz', 'Golubka', 'Novosibirskaya 67', the synthetic hexaploid wheat 'W7984', tetraploid <italic>T. timopheevii </italic>k-38555 (AAGG) and the diploids <italic>T. u... | [
"<title>Results</title>",
"<title>Sequence analysis of <italic>F3H </italic>genes in wheat and its relatives</title>",
"<p>Nine <italic>F3H </italic>copies were isolated by PCR cloning from bread wheat (genome AABBDD), the tetraploid wild wheat <italic>T. timopheevii </italic>(AAGG) and the presumed diploid pro... | [
"<title>Discussion</title>",
"<title>Cloning and analysis of <italic>F3H </italic>sequences</title>",
"<p><italic>F3H </italic>genes have been isolated from barley, maize and <italic>Arabidopsis thaliana </italic>[##UREF##7##13##,##REF##7773305##14##,##REF##8685272##24##] as well as from a range of other plant ... | [
"<title>Conclusion</title>",
"<p>There are at least four flavanone 3-hydroxylase gene copies in the hexaploid genome of bread wheat, three of which are the homoeologues on chromosomes 2AL, 2BL and 2DL, highly similar at structural and functional level, while the fourth one represents a distinct non-homoeologous c... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Authors' contributions</title>",
"<p>EKK carried out the molecular genetic studies, sequence alignment, primer design and statistical analysis, she conceived of the study, participated in its design and drafted the manuscript. MSR and EAS coordinated the study, contributed to its conception and design, to... | [
"<title>Acknowledgements</title>",
"<p>We thank Drs. A. Börner and B.S. Gill for seed of the wheat cultivars and lines, Drs. I. Leonova and E. Pestsova for providing the microsatellite genotyping data for, respectively, <italic>T. aestivum </italic>x. <italic>timopheevii </italic>and <italic>T. aestivum/Ae. tausc... | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p><bold>The structure of wheat <italic>F3H</italic>.</bold> Different gene segments referred in the paper text and tables are indicated in the figure part <bold>(a)</bold>, length of introns of the different <italic>T. aestivum F3H </italic>gene co... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Length, Genbank accession numbers and chromosome locations for <italic>F3H </italic>nucleotide sequences determined in the present study.</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Species, gene</td>... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>*Correspondence between <italic>F3H </italic>copies and ESTs was first determined based on identity at gene copy-specific sights, and then was confirmed by whole sequences comparison (see Figure 10).</p></table-wrap-foot>",
"<table-wrap-foot><p>*Ka – non-synonymous nucleotide substitutions, K... | [
"<graphic xlink:href=\"1471-2229-8-88-1\"/>",
"<graphic xlink:href=\"1471-2229-8-88-2\"/>",
"<graphic xlink:href=\"1471-2229-8-88-3\"/>",
"<graphic xlink:href=\"1471-2229-8-88-4\"/>",
"<graphic xlink:href=\"1471-2229-8-88-5\"/>",
"<graphic xlink:href=\"1471-2229-8-88-6\"/>",
"<graphic xlink:href=\"1471-... | [] | [{"surname": ["Bogdanova", "Sarbaev", "Makhmudova"], "given-names": ["ED", "AT", "KK"], "article-title": ["Resistance of common wheat to bunt [abstract]"], "source": ["Proceedings of the Research Conference on Genetics: 2002; Moscow"], "year": ["2002"], "fpage": ["43"], "lpage": ["44"]}, {"surname": ["Gould"], "given-n... | {
"acronym": [],
"definition": []
} | 46 | CC BY | no | 2022-01-12 14:47:38 | BMC Plant Biol. 2008 Aug 13; 8:88 | oa_package/7e/8a/PMC2538534.tar.gz |
PMC2538535 | 18724866 | [
"<title>Background</title>",
"<p>South Africa is at the southern extreme of malaria distribution in Africa. Malaria is endemic in the low-altitude areas of the northern and eastern parts of South Africa along the border with Mozambique and Zimbabwe, with transmission taking place mainly in Limpopo, Mpumalanga and... | [
"<title>Methods</title>",
"<p>For this descriptive study data from the malaria information system of Limpopo Province were used. This system has been developed by the Malaria Research Programme of the South African Medical Research Council using Microsoft Access for data entry and validation [##UREF##4##16##].</p... | [
"<title>Results</title>",
"<p>In total, 58,768 cases of malaria were reported, including 628 deaths, in the seasons 1998 – 1999 to 2006 – 2007. 3,047 (5.2%) of the cases were detected by active surveillance and 55,717 (94.8%) by passive surveillance (for 4 cases no data on surveillance type were available). In Ta... | [
"<title>Discussion</title>",
"<p>Over the seasons 1998 – 1999 to 2006 – 2007 the incidence rate of malaria showed a statistically significant decreasing trend in Limpopo Province. This is most likely to a considerable extent attributable to the scaling-up of DDT spraying in the region (in order to combat insectic... | [
"<title>Conclusion</title>",
"<p>This study gives an overview of the malaria incidence and mortality in Limpopo Province, South Africa, for the seasons 1998–1999 to 2006–2007. In summary, malaria is highly seasonal in Limpopo Province. The mean incidence rate was 124.5 per 100,000 person-years and the mean CFR 1.... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>AAMG designed the study, performed the statistical analysis and drafted the manuscript. PK conceived of the study, participated in the acquisition of data, in... | [
"<title>Acknowledgements</title>",
"<p>No financial support has been received for this study.</p>"
] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Limpopo Province districts, including mean malaria incidence rates, 1998 – 1999 to 2004 – 2005 seasons.</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Malaria incidence rates per season, Limpopo Prov... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Incidence of malaria cases and deaths, Limpopo Province, 1998 – 1999 to 2006 – 2007 seasons</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\">Malaria season</td><td align=\"right\">No. of reported malaria c... | [] | [] | [] | [] | [] | [] | [] | [
"<graphic xlink:href=\"1475-2875-7-162-1\"/>",
"<graphic xlink:href=\"1475-2875-7-162-2\"/>",
"<graphic xlink:href=\"1475-2875-7-162-3\"/>"
] | [] | [{"article-title": ["Malaria cases per year."], "year": ["2008"]}, {"article-title": ["Health Statistics."], "year": ["2008"]}, {"article-title": ["Malaria treatment guidelines [final draft 05 December 2007]."], "year": ["2008"]}, {"surname": ["Sharp", "Ngxongo", "Botha", "Ridl", "Le Sueur"], "given-names": ["BL", "S",... | {
"acronym": [],
"definition": []
} | 28 | CC BY | no | 2022-01-12 14:47:38 | Malar J. 2008 Aug 25; 7:162 | oa_package/6c/85/PMC2538535.tar.gz |
PMC2538536 | 18761741 | [
"<title>Background</title>",
"<p>The study of the health consequences of heavy alcohol consumption has a long research tradition: the first investigations of risk were undertaken in the early 19<sup>th </sup>century by life assurance companies who calibrated their premiums according to the alcohol consumption of ... | [
"<title>Methods</title>",
"<p>Study participants are from the <italic>West of Scotland Twenty-07 Study</italic>, a population-sampled cohort designed to investigate the influence of social factors on health. Ethics committee approval for the Twenty-07 study was granted by the General Practice Subcommittee of the ... | [
"<title>Results</title>",
"<p>Of men with complete data on alcohol consumption (N = 576) and a response to enquiries about problem drinking (N = 578), 20.8% (N = 120) exceeded weekly and 44.6% (N = 258) daily guidelines for sensible consumption; 14.9% (N = 86) were categorised as having alcohol-related drinking p... | [
"<title>Discussion</title>",
"<p>The aim of this study was to examine the association of socioeconomic disadvantage across the life course with the risk of exceeding existing guidelines for 'sensible' alcohol consumption and problem drinking. As indicated, only two studies [##REF##17074968##23##,##REF##16973534##... | [
"<title>Conclusion</title>",
"<p>Exposure to disadvantaged circumstances throughout the lifecourse, but particularly in adulthood, is associated with detrimental patterns of alcohol consumption and problem drinking in men in late middle age. Further research is needed to establish whether similar associations are... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>The idea for the present manuscript was generated during discussions amongst the co-authors. GDB wrote the first draft of the manuscript based on data analyse... | [
"<title>Acknowledgements</title>",
"<p>The West of Scotland Twenty-07 Study is funded by the UK Medical Research Council and the data were collected by the MRC Social and Public Health Sciences Unit. We are grateful to all of the participants in the Study, and to the survey staff and research nurses involved. At ... | [] | [] | [] | [] | [] | [] | [] | [
"<supplementary-material content-type=\"local-data\" id=\"S1\"><caption><title>Additional file 1</title><p>Table 1. Odds ratios (95% CI) for the association of indices of early life socioeconomic position with heavy weekly, heavy daily and problem drinking in men.</p></caption></supplementary-material>",
"<supple... | [] | [] | [
"<media xlink:href=\"1471-2458-8-302-S1.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>",
"<media xlink:href=\"1471-2458-8-302-S2.doc\" mimetype=\"application\" mime-subtype=\"msword\"><caption><p>Click here for file</p></caption></media>",
"<media xl... | [{"surname": ["Moore"], "given-names": ["RM"], "article-title": ["On the comparative mortality among lives of abstainers and non-abstainers from alcoholic beverages"], "source": ["Journal of Institute of Actuaries"], "year": ["1904"], "volume": ["38"], "fpage": ["213"], "lpage": ["76"]}, {"collab": ["Royal College of P... | {
"acronym": [],
"definition": []
} | 39 | CC BY | no | 2022-01-12 14:47:38 | BMC Public Health. 2008 Sep 1; 8:302 | oa_package/e3/58/PMC2538536.tar.gz |
PMC2538537 | 18721482 | [
"<title>Background</title>",
"<p>Variations and differences in terms of mortality are widely recognized both at national and international level [##REF##14985525##1##]. In particular, mortality inequalities across geographical localities are well documented in various developed countries [##UREF##0##2##]. These d... | [
"<title>Methods</title>",
"<p>Crude death rates (CDR) were calculated by gender in each of the 10 regional areas in Greece. Data regarding deaths were obtained from the annual series of the vital statistics of Greece – Deaths of the population (\"Natural movement of population\") during the period 1984–2004 (21 y... | [
"<title>Results</title>",
"<p>Among males and females at almost all age categories the region of Thrace recorded the highest age-specific crude mortality and standardised mortality rate (Figures ##FIG##0##1##, ##FIG##1##2##). The previously described trend of increased mortality of Thrace did not change during th... | [
"<title>Discussion</title>",
"<p>Descriptive analysis has indicated that Thrace was the region with the highest mortality in Greece for both men and women at almost all age categories. Furthermore, Thrace demonstrated mortality rates well above the EU average. There is a question about the aetiology of this incre... | [
"<title>Conclusion</title>",
"<p>Thrace presented the highest mortality risk among 10 regions in Greece, and in particular at age groups < 1 year; 1–4, and 5–14 years.</p>",
"<p>Further statistical analysis revealed that the low GDP and low ratio of doctors per population were significantly associated with t... | [
"<p>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<ext-link ext-link-type=\"uri\" xlink:href=\"http://creativecommons.org/licenses/by/2.0\"/>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is proper... | [
"<title>Competing interests</title>",
"<p>The authors declare that they have no competing interests.</p>",
"<title>Authors' contributions</title>",
"<p>PP participated to study design, data collection, statistical analysis, and manuscript preparation. GR participated to statistical analysis, preparation, and ... | [] | [
"<fig position=\"float\" id=\"F1\"><label>Figure 1</label><caption><p>Regional distribution of mortality risk in males, Greece (1984–2004).</p></caption></fig>",
"<fig position=\"float\" id=\"F2\"><label>Figure 2</label><caption><p>Regional distribution of mortality risk in females, Greece (1984–2004).</p></capti... | [
"<table-wrap position=\"float\" id=\"T1\"><label>Table 1</label><caption><p>Comparison of CDR (age categories: 0–14) with GDP, hospital beds and physicians for both sexes and in all regions (1984–2004).</p></caption><table frame=\"hsides\" rules=\"groups\"><thead><tr><td align=\"left\"><bold>Regions</bold></td><td ... | [] | [] | [] | [] | [] | [] | [
"<table-wrap-foot><p>*Gross domestic product, in euro (€).</p><p>**in some regions data were not available</p><p>+Data for the region of Attica in which Athens is included</p></table-wrap-foot>"
] | [
"<graphic xlink:href=\"1471-2458-8-297-1\"/>",
"<graphic xlink:href=\"1471-2458-8-297-2\"/>"
] | [] | [{"surname": ["Carstairs", "Elliott P, Wakefield JC, Best NG, Brigss DJ"], "given-names": ["V"], "article-title": ["Socioeconomic factors at area level and their relationship with health"], "source": ["Spatial epidemiology Methods and applications"], "year": ["2000"], "publisher-name": ["Oxford: Oxford University Press... | {
"acronym": [],
"definition": []
} | 11 | CC BY | no | 2022-01-12 14:47:38 | BMC Public Health. 2008 Aug 23; 8:297 | oa_package/5d/7e/PMC2538537.tar.gz |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.